ID: 1161706670

View in Genome Browser
Species Human (GRCh38)
Location 19:5825339-5825361
Sequence CACGCCTCAGATGCCCGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161706670_1161706674 -10 Left 1161706670 19:5825339-5825361 CCTGCGCGGGCATCTGAGGCGTG No data
Right 1161706674 19:5825352-5825374 CTGAGGCGTGGATGCCGGCAGGG No data
1161706670_1161706678 16 Left 1161706670 19:5825339-5825361 CCTGCGCGGGCATCTGAGGCGTG No data
Right 1161706678 19:5825378-5825400 GTGTGCAGCGCCTTTGGGTGTGG No data
1161706670_1161706676 10 Left 1161706670 19:5825339-5825361 CCTGCGCGGGCATCTGAGGCGTG No data
Right 1161706676 19:5825372-5825394 GGGTGCGTGTGCAGCGCCTTTGG No data
1161706670_1161706679 17 Left 1161706670 19:5825339-5825361 CCTGCGCGGGCATCTGAGGCGTG No data
Right 1161706679 19:5825379-5825401 TGTGCAGCGCCTTTGGGTGTGGG No data
1161706670_1161706677 11 Left 1161706670 19:5825339-5825361 CCTGCGCGGGCATCTGAGGCGTG No data
Right 1161706677 19:5825373-5825395 GGTGCGTGTGCAGCGCCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161706670 Original CRISPR CACGCCTCAGATGCCCGCGC AGG (reversed) Intronic