ID: 1161707234

View in Genome Browser
Species Human (GRCh38)
Location 19:5827845-5827867
Sequence CGCACGCGCGCGCCGCCGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 1, 2: 4, 3: 24, 4: 239}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161707234_1161707243 1 Left 1161707234 19:5827845-5827867 CCCGGCGGCGGCGCGCGCGTGCG 0: 1
1: 1
2: 4
3: 24
4: 239
Right 1161707243 19:5827869-5827891 GGTTGGGGGCGCGGCCTTGCGGG 0: 1
1: 0
2: 0
3: 18
4: 223
1161707234_1161707241 -8 Left 1161707234 19:5827845-5827867 CCCGGCGGCGGCGCGCGCGTGCG 0: 1
1: 1
2: 4
3: 24
4: 239
Right 1161707241 19:5827860-5827882 CGCGTGCGCGGTTGGGGGCGCGG 0: 1
1: 0
2: 1
3: 24
4: 199
1161707234_1161707242 0 Left 1161707234 19:5827845-5827867 CCCGGCGGCGGCGCGCGCGTGCG 0: 1
1: 1
2: 4
3: 24
4: 239
Right 1161707242 19:5827868-5827890 CGGTTGGGGGCGCGGCCTTGCGG 0: 1
1: 0
2: 1
3: 10
4: 154
1161707234_1161707246 17 Left 1161707234 19:5827845-5827867 CCCGGCGGCGGCGCGCGCGTGCG 0: 1
1: 1
2: 4
3: 24
4: 239
Right 1161707246 19:5827885-5827907 TTGCGGGCTGCGCGAGCTGGAGG 0: 1
1: 0
2: 0
3: 5
4: 85
1161707234_1161707244 14 Left 1161707234 19:5827845-5827867 CCCGGCGGCGGCGCGCGCGTGCG 0: 1
1: 1
2: 4
3: 24
4: 239
Right 1161707244 19:5827882-5827904 GCCTTGCGGGCTGCGCGAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161707234 Original CRISPR CGCACGCGCGCGCCGCCGCC GGG (reversed) Exonic
900109151 1:998358-998380 CGGACCCGCGCGCTCCCGCCGGG + Intergenic
900155298 1:1201366-1201388 CGCACGCTGGGGCCCCCGCCAGG + Intergenic
900349686 1:2228548-2228570 CGCTGGAGCCCGCCGCCGCCCGG - Intergenic
901019789 1:6249799-6249821 GTCCCGCGCGCGCCGCCGCTCGG - Exonic
901084550 1:6602682-6602704 CGCGCCCGCCCGCCGCCTCCAGG + Exonic
901886970 1:12230180-12230202 CGGACCCGCGGGCCGCCGCTAGG + Intronic
902856480 1:19210047-19210069 CGCCCGCCAGAGCCGCCGCCCGG + Intronic
903398409 1:23020009-23020031 CGCCCTCCCCCGCCGCCGCCGGG + Intronic
903652368 1:24929916-24929938 CGCCCGCGCCGGCCGCCCCCGGG - Intronic
903750223 1:25616838-25616860 CACACGCGCGCACAGCCACCCGG - Intergenic
904746144 1:32712386-32712408 CGCAGCCGCGCGGGGCCGCCCGG + Intergenic
904769029 1:32870802-32870824 CGCGAGCGCGAGCGGCCGCCGGG - Exonic
904822900 1:33256688-33256710 GGCAGGCGCCCGCCGCCGCTGGG - Intronic
905066846 1:35192093-35192115 CGCTTGCGCGCGCCGCTGCGGGG - Intronic
905449212 1:38046368-38046390 CGCCCGCGTGGGCCGCCCCCTGG + Exonic
907430038 1:54406303-54406325 CGCTCGCTCGCGCGCCCGCCCGG + Exonic
910337895 1:86155236-86155258 CGCGCGCGCGAGCCCCAGCCAGG + Intronic
910338330 1:86157156-86157178 CGGGCGCGCTCGCCTCCGCCTGG + Intergenic
910533950 1:88275029-88275051 CGCGCGCGCGCGCGCGCGCCTGG + Intergenic
924502849 1:244653133-244653155 CGCTCCCGGGCGCCGCCGACAGG - Exonic
924560604 1:245154575-245154597 CGCTCGCTCGCGCGGCCCCCGGG + Intergenic
1064769541 10:18710278-18710300 CGCGCGGTGGCGCCGCCGCCAGG - Intergenic
1065188927 10:23193236-23193258 CCCAGGCGCCCGCCGCCGCCCGG - Exonic
1066080661 10:31928332-31928354 CGCCCGCCCGCCCCGCCCCCAGG - Intronic
1067769889 10:49115512-49115534 CGCGGGAGAGCGCCGCCGCCTGG + Intergenic
1072089637 10:92115042-92115064 CCCCCGCGCCCGCGGCCGCCGGG - Intronic
1073290046 10:102409039-102409061 CGAGCGCGAGCGCAGCCGCCCGG + Intronic
1073403536 10:103277445-103277467 CGTTGGTGCGCGCCGCCGCCTGG - Exonic
1073491414 10:103855537-103855559 CGCTCGCTCTCTCCGCCGCCCGG + Intronic
1074088343 10:110225882-110225904 CGCACCCGCCCGCGGCTGCCGGG - Intronic
1074377496 10:112951643-112951665 CGCCCGCCCGCGCCGCCCGCCGG + Intronic
1074503343 10:114044973-114044995 CCCGCGCCCGCGCCGCCGCCCGG + Exonic
1076880522 10:133237307-133237329 CGCCCCCGCGCGCCGCTCCCCGG + Intergenic
1081831473 11:46119884-46119906 CCCCCGCCCGCGCCCCCGCCGGG - Intronic
1082035551 11:47642562-47642584 CGTGCGCGCGCGCCGCGGGCGGG - Exonic
1082986081 11:59172362-59172384 CGCGCGCCGCCGCCGCCGCCGGG - Intronic
1083207546 11:61161590-61161612 CACACACGCTCGCGGCCGCCCGG + Exonic
1083772831 11:64878022-64878044 CGGACGCGCCCCCCGCCCCCTGG + Intronic
1083789051 11:64972143-64972165 CGCACGCGCAGACCGCGGCCAGG - Intergenic
1083890254 11:65592388-65592410 CGGACACGCGCGCGGCCTCCGGG - Exonic
1084295934 11:68213446-68213468 CGCCCCCGCGCCCCGCCACCCGG + Intronic
1084636852 11:70398605-70398627 CGCGCTCGCTCACCGCCGCCTGG - Exonic
1085416526 11:76322125-76322147 CGCACGCGCCGACCCCCGCCGGG - Intergenic
1087761732 11:102110328-102110350 CGCCCGCCCGCACCGCGGCCCGG - Intergenic
1091113638 11:132994226-132994248 CTCCCGCGCGCGCCGGCTCCTGG - Intronic
1096459481 12:51814367-51814389 GGCACGCGGGCGGCGGCGCCGGG + Intergenic
1096771617 12:53939200-53939222 CACACTGGCGCGCCGCCTCCGGG - Exonic
1102056517 12:109900474-109900496 CGCCCGCGCGGGCCGCCTGCGGG - Intronic
1102645517 12:114401066-114401088 TGCACGCGCGCGCCCAGGCCTGG - Intronic
1102973622 12:117190469-117190491 CGCGCGCGCGCGGCGGCCCCAGG - Intronic
1103432964 12:120903909-120903931 CGAGCGAGCCCGCCGCCGCCGGG - Exonic
1103856340 12:123973147-123973169 CGCACGCATGCGCGGCCACCCGG - Exonic
1104448852 12:128853564-128853586 CGCATGCCGCCGCCGCCGCCCGG - Exonic
1105243659 13:18628852-18628874 CCCAGGCGGCCGCCGCCGCCAGG + Intergenic
1106735652 13:32586233-32586255 CACACGGGCACGCCGCCGCGGGG - Intergenic
1108227416 13:48303756-48303778 CGGACGCGCCCTCCCCCGCCCGG - Exonic
1110706262 13:78603707-78603729 CGCGCGCGCGCGCAGACGCACGG - Intergenic
1113200998 13:107867342-107867364 CGCCCGCGGGCGCCGCCGCCGGG + Intergenic
1113660571 13:112104365-112104387 CGCCAGCGCGCGCCGGCGACAGG + Intergenic
1115398159 14:32933014-32933036 AGCAGGCGCGGGACGCCGCCAGG + Intergenic
1118854583 14:69611437-69611459 TGCACGCACGCGCCGCCGGCCGG - Intergenic
1119309568 14:73634490-73634512 CGCAGGCGCGCGGCGCAGCTCGG - Intergenic
1119743510 14:77028491-77028513 CGCAGGCTCCCGCCGCCCCCAGG + Exonic
1120788035 14:88554757-88554779 CCCATGAGCGCGCCGCGGCCCGG - Intergenic
1122221335 14:100240381-100240403 CGCGCGCCCCCGCCCCCGCCCGG + Intronic
1122275250 14:100587533-100587555 CGCACCCCCGCGCCCCTGCCCGG - Intergenic
1128067657 15:64774975-64774997 CGCGCGCGCCGGCCGCCGTCCGG - Intronic
1128454895 15:67826915-67826937 CGTACGCCGGCGCCGCCACCGGG - Exonic
1128455632 15:67829870-67829892 CGCGAGCGCGCGTGGCCGCCGGG - Intronic
1129503208 15:76059799-76059821 GGCGCGCGCGCGCGGCCGGCGGG + Intergenic
1129739105 15:77981413-77981435 CGCACGCGAGATCCGCCTCCAGG + Intergenic
1130224567 15:82047018-82047040 CGCACGCCCGCGCCGCCCGCTGG - Intergenic
1132419388 15:101652388-101652410 CCCAGGCGCGCCCCGCCCCCCGG - Intronic
1132519789 16:381865-381887 CGCCGGCCCCCGCCGCCGCCCGG + Exonic
1132527721 16:425906-425928 CGCCCGCCCGCGCCGCCGAGGGG + Exonic
1132879522 16:2155841-2155863 CTCACCCGCCCGCGGCCGCCCGG - Exonic
1133021464 16:2968795-2968817 CTCACGCGCCCGCAGCCGTCGGG - Intronic
1133188431 16:4116293-4116315 CGCCCGCCCGCGCCCACGCCGGG + Intergenic
1133340663 16:5033667-5033689 CGCGCGCGCGCGCCTCCCCCGGG - Exonic
1137617327 16:49855698-49855720 CGCTCGCTCGCGCCTCCGCCGGG + Intronic
1138178723 16:54928830-54928852 GGCCCGCGCGCGCCGCCCGCCGG - Intergenic
1140462246 16:75148960-75148982 CCCGCGCGCGCGCGCCCGCCGGG - Intronic
1141132319 16:81444846-81444868 CACACGCGCGCGGCGGCGCGGGG + Intergenic
1142637723 17:1268410-1268432 CGCCCCCGCCCGCCCCCGCCCGG + Intergenic
1143223742 17:5282640-5282662 CGCGCGCCCCCGCCTCCGCCCGG - Intronic
1143749967 17:9021182-9021204 CGCCCGCGCCCCGCGCCGCCCGG - Intergenic
1146095947 17:29930275-29930297 CCTCGGCGCGCGCCGCCGCCTGG + Intronic
1146283352 17:31559193-31559215 CGCCCGCCCGCACCGCCTCCCGG - Intergenic
1146922377 17:36722397-36722419 CCCACCCGCGCACCCCCGCCCGG + Intergenic
1147150328 17:38510444-38510466 CACTCTGGCGCGCCGCCGCCTGG + Exonic
1148021782 17:44558178-44558200 CTCACCACCGCGCCGCCGCCGGG + Exonic
1149610488 17:57955224-57955246 CGGACGCGCGTGGCGCTGCCCGG - Exonic
1149994611 17:61400086-61400108 CCACCGCGCGCGCCGCCGCCCGG + Exonic
1150239940 17:63622914-63622936 CCCGCTCGCGCGCCGCGGCCCGG + Intronic
1150268785 17:63849268-63849290 CACCCTCGCGCGCCCCCGCCTGG + Intergenic
1151296857 17:73192575-73192597 CGGGCGCGCTCGCCGCCGCTGGG - Intergenic
1152175193 17:78782421-78782443 CTCCCGCGCGCGCCGCACCCCGG + Intergenic
1152744220 17:82031730-82031752 CGGCCGCGCCCGCCGCCGCCCGG + Exonic
1152809543 17:82375070-82375092 CGCGCGCGCCCCCGGCCGCCGGG - Exonic
1153457311 18:5295538-5295560 CGCGCGGGGCCGCCGCCGCCTGG + Intronic
1153457516 18:5296224-5296246 CGCACGCGCGCGCACGCGCGCGG + Intronic
1154241567 18:12657983-12658005 CGGCCGCGCGCGCCGCCGCCGGG + Exonic
1154445283 18:14431033-14431055 CCCAGGCGGCCGCCGCCGCCAGG - Intergenic
1157464205 18:47930536-47930558 CGCGCGCCCGGGCCGCCGGCCGG - Exonic
1160691049 19:460834-460856 CAGCCGCCCGCGCCGCCGCCGGG + Exonic
1160745376 19:708930-708952 CCCCCGCGCCCGCCGCCGCCCGG + Intergenic
1160745436 19:709092-709114 CACCCGCGCCCGCCCCCGCCCGG + Exonic
1160873261 19:1286400-1286422 CCCACGCGCGCGCCGCCGCCGGG + Intronic
1161028196 19:2046287-2046309 CTCACGCCCGCCCCGCTGCCCGG - Intronic
1161080624 19:2308237-2308259 AGCCCCCGCGCGCCCCCGCCAGG - Intronic
1161222030 19:3122310-3122332 CGCCCCCGAGCGCCGCCCCCGGG + Exonic
1161398000 19:4054810-4054832 CCGACGCGGGCGCCGACGCCGGG - Exonic
1161707234 19:5827845-5827867 CGCACGCGCGCGCCGCCGCCGGG - Exonic
1162720054 19:12656942-12656964 GGCTCACGCGCGCCGCCGTCTGG + Exonic
1162954509 19:14090797-14090819 CGCACGCGCGCCCTGCGCCCGGG + Intronic
1163304898 19:16471874-16471896 CGCACCCCGGCGCCGCCCCCAGG + Intronic
1165349389 19:35268097-35268119 CCCGCGCCCGCGCCGCCGGCCGG + Intergenic
1165469517 19:35995350-35995372 CGCACTCGCGCCTCGGCGCCCGG - Exonic
1166106684 19:40601236-40601258 CGCGCCCCCGCGCGGCCGCCGGG + Intronic
1166888252 19:45973943-45973965 CGCCCGCGCCCGCCGCCCCCCGG - Intergenic
1167709023 19:51098864-51098886 CGGACGGCCGCGCCGCCTCCAGG + Exonic
1167862796 19:52298488-52298510 TACACGCGCGCGCTGACGCCCGG - Intronic
925927284 2:8679274-8679296 CGGACGCGAGAGCCGCCGCGGGG + Exonic
925984958 2:9207551-9207573 CGCCGCCGCCCGCCGCCGCCCGG + Intronic
926077348 2:9951811-9951833 CGCGCCCGCTCGCCGCTGCCGGG - Exonic
927125961 2:20012598-20012620 GGCCCCCGCGCGCCGCCTCCCGG - Exonic
927720096 2:25376952-25376974 CCCAGCCGCGCGCCGCAGCCGGG - Intergenic
929252937 2:39779301-39779323 CGCCCCTGCGCGCCGCCTCCAGG - Intergenic
929788679 2:45009132-45009154 CGCCCGCGCGCGCCCTCACCGGG + Exonic
932180719 2:69643754-69643776 CCCCCGCGCGCGCTCCCGCCCGG + Intronic
932699978 2:73985403-73985425 GCCGCGCGCGCGCCGCCGCTCGG - Intergenic
934738525 2:96702705-96702727 CACACGTGCGCTCCGCCGCCAGG - Intergenic
935112423 2:100105151-100105173 CGCCCGCGCCCGGCCCCGCCCGG + Intronic
936038375 2:109129931-109129953 CGCGCGGGCGGGCTGCCGCCGGG - Exonic
936278669 2:111120583-111120605 CGCACGCCGCGGCCGCCGCCGGG + Intronic
937221742 2:120346064-120346086 CGCCCGCGCCCGCGCCCGCCCGG - Intergenic
938397933 2:130964274-130964296 CGCACGCGCCCTCCGCGCCCGGG + Intronic
938429187 2:131217775-131217797 CGCACGCGCACGCGCACGCCCGG + Intronic
940918995 2:159286872-159286894 CGCATGCGCGCTCTTCCGCCCGG + Intergenic
942116732 2:172735771-172735793 CGCACCCGCGTCCCGCCCCCCGG + Intronic
943342134 2:186694111-186694133 CCCTGGCGCCCGCCGCCGCCCGG + Exonic
945245259 2:207711716-207711738 CGCCCGCCCGCCCCGCGGCCCGG - Intronic
947669143 2:231925785-231925807 CCCACGCGCCCGCCGGCGCGGGG + Intronic
948207371 2:236169267-236169289 CTCACCCTGGCGCCGCCGCCCGG + Intergenic
948467386 2:238158884-238158906 CGCCCGCCCGCGCCCCCTCCCGG - Intergenic
948953992 2:241272898-241272920 CGCCCGCCCGCCCCGCCGCTGGG + Intronic
1172474471 20:35226716-35226738 CGGGCGCGGGCCCCGCCGCCGGG + Exonic
1173210725 20:41029363-41029385 CGCGCGCGCTCGCCGCCGGAGGG + Intronic
1173454174 20:43190041-43190063 CTCACGCGCACGCCCGCGCCTGG + Intergenic
1174467772 20:50731034-50731056 CGCACGCGCGAGCGCGCGCCTGG - Intergenic
1175877649 20:62238129-62238151 CGCAGGCCCGCACTGCCGCCAGG + Intronic
1176450708 21:6858830-6858852 CCCAGGCGGCCGCCGCCGCCAGG + Intergenic
1176548955 21:8213395-8213417 CGCGCGCGCGCCCGCCCGCCCGG + Intergenic
1176550492 21:8218941-8218963 CGCACGCGCGCGCGCGCGCGCGG - Intergenic
1176556848 21:8257607-8257629 CGCGCGCGCGCCCGCCCGCCCGG + Intergenic
1176567884 21:8396425-8396447 CGTACGCGCGCCCGCCCGCCCGG + Intergenic
1176575788 21:8440644-8440666 CGTACGCGCGCCCGCCCGCCCGG + Intergenic
1176577334 21:8446211-8446233 CGCACGCGCGCGCGCGCGCGCGG - Intergenic
1176828877 21:13723848-13723870 CCCAGGCGGCCGCCGCCGCCAGG + Intergenic
1177905359 21:26966553-26966575 CGCACGCTGGCACCGCAGCCCGG - Intergenic
1178535109 21:33404020-33404042 CCCACCCGCGCGCCCGCGCCGGG + Intronic
1180951935 22:19724388-19724410 CCCGCGCTCGCGCCGCAGCCCGG + Exonic
1181610872 22:24011170-24011192 CGCGCGCGCGCGCCGCCCAAGGG + Intronic
1182296993 22:29315704-29315726 CGCTCGCTCGCGCCGGCGGCTGG - Exonic
1182804456 22:33058391-33058413 CGCGCGCGAGCGCCCCCGCCCGG + Intergenic
1184086898 22:42270692-42270714 CCCGCCCGCGCGCCGCGGCCCGG - Intronic
1184236967 22:43187575-43187597 CGCAGACGCGCGCCCCCTCCTGG - Intergenic
1184362013 22:44024461-44024483 CGCCCGCGCCCGCCGACCCCCGG + Intronic
1184523109 22:45007439-45007461 CGCCCCCGCGCGCCCCCGCCCGG - Intronic
1184680789 22:46071338-46071360 CGCCCGCGCGCGCCGTCCCGGGG + Intronic
1203253839 22_KI270733v1_random:129702-129724 CGCGCGCGCGCCCGCCCGCCCGG + Intergenic
1203261895 22_KI270733v1_random:174781-174803 CGCGCGCGCGCCCGCCCGCCCGG + Intergenic
949552438 3:5122383-5122405 CACACGAGCGGGCCTCCGCCCGG - Exonic
950054013 3:10011216-10011238 CGCCGCCGCTCGCCGCCGCCTGG + Intergenic
950316371 3:12004862-12004884 CTCCCGCGCCCGCAGCCGCCAGG + Exonic
952383471 3:32821811-32821833 CGCGGGCCTGCGCCGCCGCCCGG + Intronic
953614458 3:44477674-44477696 CGCGCACGCGCGTCGGCGCCCGG + Intergenic
954778976 3:53045665-53045687 CCCGCGCGCCCGCCGGCGCCCGG + Intronic
955161499 3:56468523-56468545 CGCGCTCGCGCGGCGCTGCCAGG + Intergenic
957193568 3:77039969-77039991 TGCTCGCGCCCGCAGCCGCCTGG + Intronic
960639145 3:119810207-119810229 CGCGCGGGCGGGCCGGCGCCGGG + Intronic
961389151 3:126542181-126542203 CGCGCGCGCTCCCCGACGCCCGG + Exonic
961827447 3:129606504-129606526 CGCCGGCCCGCGCCGCCCCCAGG + Exonic
963228765 3:142889038-142889060 CTCACGCGCGCACCGCCGCGGGG + Exonic
964437989 3:156674446-156674468 CGCACGCGCGCGCAGGGGGCGGG + Intronic
967055207 3:185824672-185824694 CGGGCGCGGGAGCCGCCGCCGGG + Intronic
968659521 4:1793360-1793382 CGCACCGGCGGGCCGCCGGCCGG + Exonic
968701320 4:2059454-2059476 CGGCCGTGCCCGCCGCCGCCCGG + Intergenic
968879834 4:3293175-3293197 CGCCCGCGCCCTCCGCCTCCCGG + Intronic
969053348 4:4387360-4387382 CGCAAGGGCGCACCGCGGCCAGG - Intronic
971244008 4:24912665-24912687 CGCACCCGCGCGACCCCGCCAGG - Intronic
973110385 4:46390295-46390317 CCCAGGCGCCCGACGCCGCCCGG - Intronic
974047114 4:56907791-56907813 CGCCCGCGCGCGTGGCCGCTAGG - Intergenic
981429600 4:144645080-144645102 CGCACGCGCGCGCAGTCCCTGGG - Intergenic
984999882 4:185471921-185471943 CGCACACGCGCGCGGCTGTCCGG + Intronic
985006011 4:185535666-185535688 CCCCCGCGCCCGCCGCGGCCCGG - Intergenic
985129711 4:186726930-186726952 CGCCCGCGCTCGCCGGCGCCCGG - Intergenic
986315480 5:6583651-6583673 CACACTCGCGCACCGCAGCCCGG - Intergenic
992487590 5:77210877-77210899 CGCCCGCGCCCGCGGCCGCCGGG - Exonic
992549176 5:77845017-77845039 CCCACGCGCGCGCCTCCTCGTGG + Intronic
1002055784 5:176597287-176597309 TGGGCGCGCGCGGCGCCGCCTGG + Exonic
1002559475 5:180071776-180071798 CGCGCGCTCCCGCCGCCGCCCGG - Exonic
1004720447 6:18264218-18264240 CGCGTGCGCGCGCGCCCGCCCGG + Intronic
1004903272 6:20212653-20212675 CGCCAGCGGGCGCCGCCGCCTGG + Intergenic
1005288956 6:24359854-24359876 CGCACCCGAGCTTCGCCGCCAGG - Intergenic
1005953438 6:30647549-30647571 CGCAGACGCGCCCCGCTGCCTGG - Exonic
1007444503 6:41894991-41895013 CGCCCGCGCGCCCCGACTCCCGG + Intronic
1007623571 6:43229465-43229487 CGCCCGCGCTCTCCGGCGCCAGG + Exonic
1010781246 6:79947713-79947735 CGCAGGCGCGCGCCGTCGAGCGG + Intergenic
1016010758 6:139135525-139135547 CGCAACCGGCCGCCGCCGCCAGG - Exonic
1019343052 7:517538-517560 GGCACGCGCCCCCGGCCGCCAGG + Intronic
1019625444 7:2013619-2013641 CGCTGGCACACGCCGCCGCCGGG - Intronic
1020201219 7:6081538-6081560 CCCACGCGCGCGCCGCAGTTTGG + Intergenic
1020418206 7:7969442-7969464 CGCCCGCCGTCGCCGCCGCCGGG + Exonic
1021452776 7:20798056-20798078 CGCCCGCGGCCGCCGCAGCCCGG - Intergenic
1021890318 7:25180444-25180466 CCCACCCGCGCCCCGCCCCCAGG + Intergenic
1023405812 7:39833266-39833288 CGCTCGCTCGCGCGCCCGCCCGG - Intergenic
1029496347 7:100897092-100897114 GGCACGCGGGCGCCGCCGCCAGG + Intergenic
1029544180 7:101201783-101201805 CGGAGGCGCGCCCCACCGCCTGG - Intergenic
1029896341 7:103989093-103989115 CCTCCGCGCTCGCCGCCGCCGGG - Intronic
1030093336 7:105876700-105876722 CTCGCGCGCCCGCGGCCGCCAGG + Intergenic
1031043544 7:116862907-116862929 CGCCCCCGCCCGCCGTCGCCCGG - Intronic
1031899413 7:127392784-127392806 CGCATGCGCGCGGCGCTCCCGGG - Intronic
1032344358 7:131105944-131105966 CGCGCGCGCCCGCCGCCGCCCGG - Intergenic
1033220508 7:139523992-139524014 CGCCCGCCCCCGCCGCCCCCAGG + Exonic
1034456780 7:151174888-151174910 CGCTTGCGCACTCCGCCGCCTGG + Intergenic
1034469861 7:151249249-151249271 CGCAGGGCCACGCCGCCGCCCGG - Intronic
1035153159 7:156892474-156892496 CGCCCCCGCGCTCCGCCGCCAGG - Intronic
1035171227 7:157018380-157018402 CCCACGCGCTCGCCGCAGTCCGG - Intergenic
1035361726 7:158317980-158318002 CGCCCGCCCGCGCAGCTGCCAGG - Intronic
1036398254 8:8386562-8386584 GGCCCGCGCGCCCCGCCGCCCGG + Intergenic
1036482418 8:9150795-9150817 AGCACCCCCGCGCGGCCGCCTGG + Intronic
1037903824 8:22703763-22703785 CACAGGCGCCCCCCGCCGCCCGG + Intergenic
1040688760 8:49910020-49910042 CCCCCGCGCGCGCCGCAGGCCGG + Intronic
1041107686 8:54458465-54458487 CGCCAGCGCGCCCGGCCGCCTGG - Intronic
1045327297 8:101126684-101126706 CTCCCGGCCGCGCCGCCGCCCGG + Intergenic
1045443550 8:102238691-102238713 CGCCCGCCCTCGCCGCAGCCTGG - Intronic
1049803180 8:144527503-144527525 CGCCCGCACGCTCCGGCGCCGGG + Exonic
1049843202 8:144787245-144787267 CCCGCGCGCCCGCCCCCGCCGGG + Intronic
1050345288 9:4679882-4679904 CTCACCTGGGCGCCGCCGCCTGG - Exonic
1050472548 9:6008041-6008063 GCCGTGCGCGCGCCGCCGCCGGG - Intergenic
1053003160 9:34589064-34589086 CACACGCGCGCGCGGGCGCGCGG + Intronic
1053493127 9:38526665-38526687 CGCCTCCGCGAGCCGCCGCCTGG - Intergenic
1057146939 9:92764849-92764871 CGCCCGCCCGCGCCGCCGCACGG + Intergenic
1059264388 9:113012209-113012231 CGCCTGCGCACGCGGCCGCCAGG + Intergenic
1059769921 9:117415122-117415144 CGCCCCCCCGCGCCGCCTCCCGG + Intergenic
1060952327 9:127612205-127612227 CCCCCGCGCGCGCCGGCGGCGGG + Intergenic
1061000542 9:127899735-127899757 CGGACCCGGGTGCCGCCGCCTGG + Intronic
1061453514 9:130681669-130681691 AGCGCGCCCGCGCCCCCGCCGGG + Exonic
1061540904 9:131277479-131277501 CGGGCGCGCTCGCCGCTGCCGGG + Intergenic
1061559727 9:131394468-131394490 CGCCCGGGCCCGCCGCCCCCAGG - Intronic
1061976096 9:134068531-134068553 CCCGCGCGCGCGCTCCCGCCAGG - Intronic
1062537790 9:137028416-137028438 ACCCTGCGCGCGCCGCCGCCGGG + Intronic
1062621250 9:137423447-137423469 CGCAGCCCCGCGCCGCCGCCTGG + Exonic
1203518474 Un_GL000213v1:25687-25709 CCCAGGCGGCCGCCGCCGCCAGG - Intergenic
1203470239 Un_GL000220v1:112846-112868 CGTACGCGCGCCCGCCCGCCCGG + Intergenic
1203478060 Un_GL000220v1:156818-156840 CGTACGCGCGCCCGCCCGCCCGG + Intergenic
1186200014 X:7147783-7147805 CCCACGCGCGGGCCGCCGACCGG + Intronic
1186426128 X:9465304-9465326 AGCAGCCGCGCGCCGCCCCCGGG - Exonic
1187507091 X:19887101-19887123 AGCCCGCGCGCGGCGCCGACGGG - Intronic
1195625180 X:106999823-106999845 CGGACGCGCGCGCGGGCCCCTGG - Intronic
1197226375 X:123960323-123960345 CGCAGGGGCGCGCCGCCGAGTGG - Intronic
1198727458 X:139692237-139692259 CTGACCCGCGCGCCGCCGCTGGG + Intronic
1199699295 X:150364220-150364242 CGCCCGCGCTAGCCGGCGCCGGG - Intronic
1200098225 X:153673986-153674008 TGCTCGCTCGCGCCGCCTCCCGG + Exonic
1200155335 X:153972036-153972058 CGCAGGCGCGCCCCGCCCCACGG + Intergenic
1200155449 X:153972467-153972489 CGCAGCCGAGCGCCGGCGCCCGG + Exonic
1200244622 X:154516330-154516352 CGCTCGCGCTGGCCGCCGCATGG + Intergenic
1200249884 X:154547180-154547202 CGCGAGCGCGCGAGGCCGCCGGG - Exonic