ID: 1161708624

View in Genome Browser
Species Human (GRCh38)
Location 19:5834464-5834486
Sequence ACCCAGTGCCCACACTCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 128}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161708624_1161708634 18 Left 1161708624 19:5834464-5834486 CCCCCGGAGTGTGGGCACTGGGT 0: 1
1: 0
2: 0
3: 7
4: 128
Right 1161708634 19:5834505-5834527 AGAAACCTTCAGGCCGGGTGTGG No data
1161708624_1161708635 21 Left 1161708624 19:5834464-5834486 CCCCCGGAGTGTGGGCACTGGGT 0: 1
1: 0
2: 0
3: 7
4: 128
Right 1161708635 19:5834508-5834530 AACCTTCAGGCCGGGTGTGGTGG 0: 1
1: 9
2: 155
3: 1060
4: 5220
1161708624_1161708633 13 Left 1161708624 19:5834464-5834486 CCCCCGGAGTGTGGGCACTGGGT 0: 1
1: 0
2: 0
3: 7
4: 128
Right 1161708633 19:5834500-5834522 GAAAGAGAAACCTTCAGGCCGGG 0: 1
1: 0
2: 2
3: 50
4: 442
1161708624_1161708632 12 Left 1161708624 19:5834464-5834486 CCCCCGGAGTGTGGGCACTGGGT 0: 1
1: 0
2: 0
3: 7
4: 128
Right 1161708632 19:5834499-5834521 AGAAAGAGAAACCTTCAGGCCGG 0: 1
1: 0
2: 6
3: 47
4: 455
1161708624_1161708631 8 Left 1161708624 19:5834464-5834486 CCCCCGGAGTGTGGGCACTGGGT 0: 1
1: 0
2: 0
3: 7
4: 128
Right 1161708631 19:5834495-5834517 CCAGAGAAAGAGAAACCTTCAGG 0: 1
1: 0
2: 3
3: 54
4: 454

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161708624 Original CRISPR ACCCAGTGCCCACACTCCGG GGG (reversed) Intronic
900314849 1:2051419-2051441 CCCCACCGCCCACACTTCGGGGG - Intronic
902216503 1:14937558-14937580 ACCCAGGCCCCATACTCAGGAGG - Intronic
903541733 1:24100328-24100350 CCCCTGTGCCCACACACCGCAGG + Intronic
905309742 1:37041111-37041133 ACCCAGTGCCCACTCCCCTCTGG - Intergenic
905369054 1:37473467-37473489 ACACAGAGCCCACACGCTGGAGG - Intergenic
907188408 1:52629572-52629594 GCCCAGTGACCACAATCCCGGGG - Intergenic
911090346 1:94012504-94012526 ACTCAGTGCCCACCCTCCAGGGG - Intronic
912519850 1:110237856-110237878 ATCCAGTGCCCACCCTCGTGGGG + Intronic
914433471 1:147640398-147640420 ACCCACTGCCCACAGCCCTGAGG + Intronic
915691514 1:157695551-157695573 TCCCAGGGCCCACACTGTGGTGG - Exonic
916561404 1:165936690-165936712 TCCCACTGCCCACACACCAGAGG - Intergenic
917171491 1:172180999-172181021 ACCAAGTGCCGCCACTCCGCTGG + Intronic
1063150644 10:3333347-3333369 ACCCAGTGCTCAGACACTGGAGG + Intergenic
1063724267 10:8619852-8619874 CCCCCGTGCCCACACTCGCGTGG - Intergenic
1067945101 10:50684265-50684287 ACCCCGTCCCCACCCTCCTGGGG - Intergenic
1071289397 10:84177436-84177458 CCCCAGTGCCCACTCTCAAGAGG + Intronic
1073123628 10:101136395-101136417 GCGCAGCGCCCACACCCCGGAGG - Intronic
1074461276 10:113639299-113639321 ACCCAGTGCCCAGACATCAGAGG - Intronic
1075316545 10:121458009-121458031 ACCCACTGCCTACTCTCAGGGGG - Intergenic
1077391655 11:2303177-2303199 ACACTGTGCCCACGCTCCTGTGG - Intronic
1084143981 11:67254045-67254067 ACCCAGTGCTCACACCCTGAAGG + Intronic
1084732080 11:71080177-71080199 ACCCCGTACCCACTCTCCTGAGG + Intronic
1088764603 11:112963006-112963028 ACCCAGTGCGCCCCCTCCGCGGG + Intronic
1089017403 11:115177719-115177741 GCCCTCTGCCCACACTCAGGAGG - Intronic
1089737634 11:120561149-120561171 ACCCAGAGACCACACACCAGGGG - Intronic
1091317078 11:134622036-134622058 ACTCAGTGTCCACACACCAGAGG + Intergenic
1091390922 12:125708-125730 ACCCAGTGCCCATGCCCCGAAGG + Exonic
1101815138 12:108140515-108140537 AGCCAGTGCCCAAAATCAGGCGG - Intronic
1102240304 12:111320792-111320814 TCCCAGAGCCCAGACACCGGGGG - Intronic
1103077993 12:118000316-118000338 ACCCAGGCCCCACACTCATGAGG - Intergenic
1103949856 12:124544716-124544738 AGCCGGTGCCCACACACAGGAGG + Intronic
1104870399 12:131991151-131991173 ACACAATGCCCACCCTCCTGGGG - Intronic
1105932926 13:25069324-25069346 GCCCAGGGCCCACCCTCCGGAGG + Intergenic
1107147005 13:37070172-37070194 CCTCAGTGCCCAAAGTCCGGAGG - Intergenic
1109172882 13:59117987-59118009 TCCCAGTGGCCTGACTCCGGGGG - Intergenic
1111542603 13:89688876-89688898 AGCCAGTGCCCACAGACAGGGGG + Intergenic
1116176221 14:41473536-41473558 ACCCAGTGCCCCCAATCCCCTGG - Intergenic
1116753203 14:48912471-48912493 ATCCAGTATTCACACTCCGGAGG - Intergenic
1122985298 14:105209023-105209045 TCCCGGTGCCCACACTGCGCTGG + Intergenic
1202902788 14_GL000194v1_random:52961-52983 ACACTGGGCCCACACCCCGGAGG + Intergenic
1125200327 15:37096761-37096783 ATCCACTCCCCACACTACGGAGG + Intronic
1125241515 15:37582252-37582274 CCTCAGTGCCCAGAGTCCGGAGG - Intergenic
1128937447 15:71758934-71758956 ACCCAGTCACCCCACTCCTGGGG + Intronic
1130101030 15:80894165-80894187 ACCCAGAGCCCACCATGCGGTGG + Intronic
1132877557 16:2147130-2147152 GCCCAGTGCACACACACTGGGGG + Intronic
1136228589 16:28874272-28874294 ACTCAGTGCCCACAGGCCAGAGG + Intergenic
1141659605 16:85434990-85435012 ACACAGGCCCCACACTCAGGAGG + Intergenic
1142200433 16:88758541-88758563 ACCCACTGCCCCCACTCCACAGG + Intronic
1147651881 17:42067530-42067552 CCCCAGTCCCCACACTCAAGGGG + Intergenic
1147971403 17:44220398-44220420 AACCAGCGGCCACGCTCCGGGGG - Intronic
1150208876 17:63430434-63430456 ACCCAGCGCCTGCACTCCGTGGG - Intergenic
1153230567 18:2931369-2931391 TCCCAGTCCCCACAGTCCGTGGG - Exonic
1160229037 18:77032523-77032545 ACCCCGTCCCCACCCTCCTGAGG - Intronic
1160872668 19:1284233-1284255 ACCCAAGGCCCTCACTCCAGGGG + Intergenic
1161019231 19:2000195-2000217 TCCCAATGCCCACACACTGGGGG - Intronic
1161708624 19:5834464-5834486 ACCCAGTGCCCACACTCCGGGGG - Intronic
1161714651 19:5868353-5868375 ACCCAGTGCCTACACTCTGAGGG - Intronic
1164586620 19:29479943-29479965 ACCAAGGGCCCACACTCCTCAGG + Intergenic
1164687117 19:30174152-30174174 AGCCAGTCCCCACTCTCCTGTGG - Intergenic
1166420947 19:42635382-42635404 CCCCAGTGCCCACACTAGGCAGG - Intronic
925170524 2:1747500-1747522 ATCCTGTGCACACACTCCAGTGG + Intergenic
925911435 2:8575898-8575920 ACCCAGAGTCCAGACTCCGCGGG + Intergenic
933658490 2:84907542-84907564 ACCCAGTGCCCAGCCTCTTGGGG - Intergenic
933782784 2:85813569-85813591 CCCCAGTGCCCACACCCAAGAGG + Intergenic
937903573 2:127040625-127040647 ACCCTGAGGCCACACTCAGGAGG - Intergenic
938079994 2:128364795-128364817 GCCCAGTGCCCACACTCCCAGGG + Intergenic
938653632 2:133408842-133408864 TCCCAGTGCCCAGACTCCAGTGG - Intronic
938947576 2:136226998-136227020 ACACAGTGTCCACTCTCCTGTGG + Intergenic
1170370032 20:15638548-15638570 GGCCAGTGCCCACAGTCCTGAGG - Intronic
1172990531 20:39032909-39032931 ACCCAGTGACCACACTAATGTGG + Intronic
1175390754 20:58625859-58625881 ACTCAGAGCTCACAGTCCGGTGG - Intergenic
1176622154 21:9067728-9067750 ACACTGGGCCCACACCCCGGAGG + Intergenic
1177570453 21:22879153-22879175 AACCAGTGCCAACACTGCTGTGG - Intergenic
1179950391 21:44706143-44706165 TCCCAGTGCCCACCAACCGGCGG + Intronic
1180703139 22:17792642-17792664 ACCCAGTGGCCACACCAAGGAGG + Intronic
1181465701 22:23109527-23109549 ACCCAGGGCCTACACTTGGGAGG + Intronic
1184272217 22:43391170-43391192 ACCGAGTGTCCACACTCCAGAGG + Intergenic
1185128043 22:49022657-49022679 ATCCAGAGGCCACACTCAGGAGG - Intergenic
1185343249 22:50300725-50300747 ACCCAGAGCCCAGACTGCAGGGG - Intronic
954740518 3:52746102-52746124 ACCCAGTGACCACTCTACGTTGG + Exonic
955008536 3:54992392-54992414 GCTGAGTGCCCACACTCAGGAGG - Intronic
955054818 3:55445852-55445874 AGCCAGTGTCCACCCTCCAGGGG + Intergenic
955692247 3:61602354-61602376 ACCCAGTGTACACAATCCAGAGG + Intronic
955734062 3:62017998-62018020 CTCCAGTGCCCACACTCCAAAGG + Intronic
962378526 3:134878062-134878084 ACTCAGTGCCTGCCCTCCGGGGG - Intronic
963068217 3:141280691-141280713 ACCCAGATCCCACAGTCCTGGGG - Intronic
967790879 3:193547742-193547764 ACACAGGGCCCACACTCAGAAGG + Intronic
969962810 4:10962740-10962762 GGCCAGTGCCCTCACTCCTGCGG - Intergenic
975143314 4:70939937-70939959 ACACAGTGGCCAGACTCCAGGGG - Intronic
979233599 4:118374482-118374504 ACTCAGAGCCCACACTCCAGTGG - Intergenic
979383678 4:120038457-120038479 AAGCAGTGCCCAAAGTCCGGAGG + Intergenic
984796568 4:183665708-183665730 ACTCAGTGCCCAGACTCAAGTGG + Intronic
985576790 5:677353-677375 AGCCACTGCCCCCACTCCTGGGG + Intronic
988734678 5:34008177-34008199 GCCCAGTGCGCAGACTCCGCGGG - Intronic
998141109 5:139700019-139700041 CCCCAGTGCCCACCCTCCTCTGG + Intergenic
998940785 5:147280276-147280298 ATCCAGTGTGCAGACTCCGGGGG + Intronic
1003033753 6:2624698-2624720 CACCAATGCCCACAGTCCGGAGG + Intronic
1006369594 6:33635771-33635793 AGCCAGTGCCCACTCCCCTGGGG + Intronic
1007226670 6:40320307-40320329 CCCCAGTGCCCACACAGTGGAGG - Intergenic
1007686342 6:43669443-43669465 ACTCAGTGCCCACCCACTGGGGG - Intronic
1011627024 6:89291106-89291128 ACCCAGGTCACACACTCAGGAGG + Intronic
1011634662 6:89359976-89359998 ATCCAGTGACTACACTCAGGAGG - Intergenic
1012606805 6:101167903-101167925 ACCCAGTGGCCTAACTCCAGGGG + Intergenic
1015875408 6:137817401-137817423 ACCCAGTGCTCACCCCCTGGTGG - Intergenic
1017818040 6:158029043-158029065 ACCCAGGGCCCACCCTCTGCAGG - Intronic
1025150287 7:56541946-56541968 ACCCAGTCCCCAGCCTCAGGTGG + Intergenic
1028596081 7:92547271-92547293 AGTCAGTGCCCAAAGTCCGGAGG - Intergenic
1029428040 7:100509611-100509633 TCTCAGAGCCCCCACTCCGGGGG - Intergenic
1029560603 7:101300268-101300290 AGCCAGAGCCCAAACCCCGGGGG + Intergenic
1029562014 7:101308964-101308986 AACCAGAGCCCAAACCCCGGGGG + Intergenic
1029629945 7:101743891-101743913 CCCCAAAGCCCACTCTCCGGAGG + Intergenic
1032399219 7:131611946-131611968 TACCAGTGCCCACACTCCTTTGG + Intergenic
1034412992 7:150950892-150950914 ACCCACTGGCCACGCTCTGGTGG + Intronic
1035335887 7:158126705-158126727 AACCACTGCCCGCTCTCCGGGGG - Intronic
1036705542 8:11043546-11043568 ACCCAGTGCCTGCCCTCCAGGGG - Intronic
1040625878 8:49149585-49149607 ACACAGTGCCCACCCTCTAGTGG + Intergenic
1047968905 8:130068139-130068161 ATCCAGTGCCCCAACTCCTGGGG - Intronic
1049326122 8:142022404-142022426 GCCCAGCACCCACACCCCGGTGG - Intergenic
1049828850 8:144687084-144687106 ACCCCGTGACCACACACTGGCGG + Intergenic
1049828928 8:144687405-144687427 ACCCCGTGACCACACACTGGCGG + Intergenic
1049828936 8:144687440-144687462 ACCCCGTGACCACACACTGGCGG + Intergenic
1049828952 8:144687511-144687533 ACCCCGTGACCACACACTGGCGG + Intergenic
1049828960 8:144687546-144687568 ACCCCGTGACCACACACTGGCGG + Intergenic
1049828968 8:144687581-144687603 ACCCCGTGACCACACACTGGCGG + Intergenic
1049828976 8:144687616-144687638 ACCCCGTGACCACACACTGGCGG + Intergenic
1049829012 8:144687793-144687815 ACCCCGTGACCACACACTGGCGG + Intergenic
1049829033 8:144687899-144687921 ACCCCGTGACCACACACTGGCGG + Intergenic
1053298299 9:36930840-36930862 GCCCAGTGCACACTCTCCTGGGG - Intronic
1056994514 9:91443627-91443649 TCCCAGTGCCCACTCTGGGGTGG - Intergenic
1061775371 9:132959521-132959543 ACTCAGTGCTCACACTGCGTGGG - Intronic
1061995594 9:134181237-134181259 TCCCAGTCCCCACGCTCCCGTGG - Intergenic
1185874482 X:3691415-3691437 ACCCAGTCCCCCCGCCCCGGGGG + Intronic
1190924179 X:54887232-54887254 ACCCAGGGCCCAGTCTCTGGAGG - Intergenic
1195687848 X:107601983-107602005 CACCAGTGCCCAGCCTCCGGGGG + Exonic
1197171964 X:123444470-123444492 ACCCAATGCCCACACCCAGCAGG - Intronic
1197755869 X:129994242-129994264 ACCCATAGCCTACACTGCGGTGG - Intronic