ID: 1161709477

View in Genome Browser
Species Human (GRCh38)
Location 19:5839800-5839822
Sequence AGGGCAGTCGTGATACTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 67}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161709477_1161709483 1 Left 1161709477 19:5839800-5839822 CCTCCAAGTATCACGACTGCCCT 0: 1
1: 0
2: 0
3: 10
4: 67
Right 1161709483 19:5839824-5839846 TTCTAGAAATCATTTCTGGGAGG 0: 1
1: 0
2: 1
3: 25
4: 274
1161709477_1161709481 -3 Left 1161709477 19:5839800-5839822 CCTCCAAGTATCACGACTGCCCT 0: 1
1: 0
2: 0
3: 10
4: 67
Right 1161709481 19:5839820-5839842 CCTGTTCTAGAAATCATTTCTGG 0: 1
1: 0
2: 0
3: 18
4: 200
1161709477_1161709482 -2 Left 1161709477 19:5839800-5839822 CCTCCAAGTATCACGACTGCCCT 0: 1
1: 0
2: 0
3: 10
4: 67
Right 1161709482 19:5839821-5839843 CTGTTCTAGAAATCATTTCTGGG 0: 1
1: 1
2: 1
3: 29
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161709477 Original CRISPR AGGGCAGTCGTGATACTTGG AGG (reversed) Intergenic
900372758 1:2339604-2339626 AGGGCAGTGGGGAGCCTTGGGGG - Intronic
910387882 1:86704788-86704810 AGGGCAGACGTGGTAGGTGGAGG - Intronic
916477020 1:165179416-165179438 TGAGCAGTCGTGCCACTTGGTGG - Intergenic
919818569 1:201457987-201458009 TGGGCAGAGGTGATCCTTGGTGG - Intergenic
1067079766 10:43206275-43206297 AGGGCAGGCGGGCTCCTTGGTGG + Intronic
1071221781 10:83475594-83475616 AAGGCAGTTGTGATACTGTGTGG - Intergenic
1076668494 10:132105906-132105928 AGGGGAGTCGGGTTATTTGGGGG + Intronic
1077703489 11:4462599-4462621 AGTCCAGCCCTGATACTTGGTGG - Intergenic
1080775641 11:35383831-35383853 AGGGCAGTGCTGATATTTTGAGG + Intronic
1081647200 11:44798478-44798500 AGGGCAGTGGTTAAGCTTGGGGG - Intronic
1089011111 11:115132513-115132535 TGGGCAGTCTTGCTACTTGGTGG - Intergenic
1091899677 12:4134751-4134773 AGGGCAGTCGTCATGCTTGTGGG - Intergenic
1095493530 12:42760936-42760958 AGTGCAGTCCAGCTACTTGGTGG + Intergenic
1102607386 12:114078696-114078718 AGGGCTTTAGTGATACATGGGGG + Intergenic
1104385820 12:128350759-128350781 AGGGCAGTCGTTATTCTGGGTGG - Intronic
1108143346 13:47449665-47449687 ATTGCAGTTGTGATTCTTGGAGG + Intergenic
1110603430 13:77402949-77402971 AGGGGGGTCATGATACCTGGAGG - Intergenic
1117807568 14:59510071-59510093 AGGGCAGTGGTGAGAATTGAAGG - Intronic
1118121431 14:62848508-62848530 AGTGCAGGTGAGATACTTGGGGG - Intronic
1122356598 14:101126480-101126502 AGGCCACTCGTGATCCTTGCGGG + Intergenic
1124343610 15:28905942-28905964 GGGGCAGTGGTGAAACTTGGGGG - Intronic
1124559535 15:30758909-30758931 AGGCCAGTGATGATACCTGGGGG - Intronic
1126963489 15:54025168-54025190 AGGGCAGTGAAGATGCTTGGAGG - Intronic
1130043952 15:80429864-80429886 AGGGCAGTCATGATATCTGGTGG - Intronic
1134867732 16:17623575-17623597 AGGACAGTGGTTATATTTGGAGG - Intergenic
1135665465 16:24331910-24331932 AGGACAGTCGTGAGATTGGGTGG - Intronic
1137737648 16:50736880-50736902 AGGGGAGTGGTGATGCTTAGGGG - Intergenic
1138894120 16:61182381-61182403 AGGGCAGTCCTGGTTCCTGGGGG + Intergenic
1143750608 17:9023884-9023906 AGGGCAGGAGTGATACTCGTCGG - Intronic
1155386717 18:25285842-25285864 GTGGCAGTCCTGATACATGGAGG - Intronic
1156563851 18:38160956-38160978 AGGGCAGTCCTGTGACTTAGAGG + Intergenic
1157531631 18:48426135-48426157 GGGGCACTTGTGATACTGGGTGG + Intergenic
1161709477 19:5839800-5839822 AGGGCAGTCGTGATACTTGGAGG - Intergenic
1161715788 19:5875594-5875616 AGGGAAGTCGTGATACCTGAAGG - Intronic
929803120 2:45121311-45121333 AGGGCAGTTGTAAAACTTGAAGG - Intergenic
933293526 2:80464113-80464135 AGGGCTGCAGTGATGCTTGGAGG - Intronic
945212130 2:207394576-207394598 AGGGCAGTCTGAATCCTTGGTGG - Intergenic
945607228 2:211950015-211950037 AGGGCCGGAGTGATACTTGTTGG - Intronic
946413803 2:219529303-219529325 AGGGCAGGGGTGATACCTGTGGG + Intronic
948878001 2:240840504-240840526 GGGGCAGTCGTGACCCATGGAGG + Intergenic
1168891464 20:1297619-1297641 AGGGCAGGCCTGATGCCTGGAGG - Intronic
1172387397 20:34543775-34543797 AGGGCAGAAATCATACTTGGAGG - Intergenic
1176237437 20:64060221-64060243 TCTGCAGTCCTGATACTTGGAGG + Intronic
1179167550 21:38946683-38946705 AGGGCTGTCCTGATACCTTGTGG - Intergenic
1181032034 22:20152946-20152968 AGGCCGGTCGTGGTCCTTGGTGG + Intergenic
1181115093 22:20627391-20627413 AGGGCAGGCTTGGTACTAGGTGG + Intergenic
1181511509 22:23391237-23391259 AGGCCAGTCGTGGTCCTTGGTGG - Intergenic
1181764401 22:25080746-25080768 AGGGCAGTGGTCCTGCTTGGAGG - Intronic
1184148719 22:42626509-42626531 AGGGCAGCAGTGAGACTTGGTGG - Intronic
1184249898 22:43254012-43254034 AGGGCAGTGGTCATACCTGTTGG + Intronic
949222632 3:1654036-1654058 TGAGGAGTTGTGATACTTGGAGG - Intergenic
949497139 3:4642807-4642829 AGAGCAGTCCTGATATTTGTTGG + Intronic
950028935 3:9839222-9839244 AGGGGAGGAGTGATACTGGGTGG - Intronic
950190547 3:10973534-10973556 AGGACAGTCCTGAAACTGGGAGG - Intergenic
951754043 3:26069627-26069649 AGGGCAGTGGGGATAGTTTGTGG - Intergenic
977033917 4:91924971-91924993 AGGGCAGGCCTGAAACCTGGGGG + Intergenic
978076904 4:104542277-104542299 AGAGGAGTGGTGATCCTTGGAGG - Intergenic
996479250 5:123955274-123955296 ACAGCAGTCCTGAGACTTGGTGG + Intergenic
998104719 5:139461305-139461327 AGGGCAGACTTGAGACTTGGAGG - Intronic
1004516661 6:16327180-16327202 ACAGCAGTCGTGATCCTTCGGGG - Exonic
1006102402 6:31693626-31693648 AGGCCAGTCCTGATACCTGATGG - Intronic
1007806312 6:44452023-44452045 AGGGTGCTCTTGATACTTGGAGG + Intergenic
1015620493 6:135126990-135127012 AGGCCAGTAGTGCTACTGGGTGG + Intergenic
1020970889 7:14936861-14936883 ATTGCAGTGGTGACACTTGGAGG + Intronic
1022343455 7:29489774-29489796 AAGGCAGTAGGGATACTTGTTGG + Intronic
1025294206 7:57762666-57762688 TGGGCAGTTGTGATACTTTTGGG + Intergenic
1029144888 7:98438864-98438886 TGGGCAGTGGTGATGCTGGGAGG - Intergenic
1036227305 8:6970687-6970709 AGGGCAGTTGAGAAATTTGGAGG + Intergenic
1044015855 8:87048196-87048218 AGGGCAGTCCTATTTCTTGGGGG + Intronic
1045329388 8:101142397-101142419 AGGGGAGCCGTGCTACCTGGGGG + Intergenic
1050940498 9:11451776-11451798 TGTGCAGTCTTGAGACTTGGTGG + Intergenic
1054732398 9:68714538-68714560 AGGGCACTTGTGATGGTTGGAGG + Intronic
1059741308 9:117152760-117152782 AGGGAAGAAGTGAAACTTGGAGG - Intronic
1061532096 9:131222447-131222469 TGGGCAGTCTTGACACTTGCAGG + Intronic
1185803179 X:3031937-3031959 AGTGCAGGTGTGATGCTTGGAGG - Intronic
1186436889 X:9550818-9550840 AGGGCAGTTGTGTTCCTTGGGGG + Intronic
1188598702 X:31933713-31933735 AGGGTACTGGTTATACTTGGAGG - Intronic
1196728606 X:118920096-118920118 AAGGCAGTACTGATATTTGGGGG + Intergenic