ID: 1161709852

View in Genome Browser
Species Human (GRCh38)
Location 19:5841753-5841775
Sequence AATTTCCTCTGAGGCTTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 2, 1: 1, 2: 1, 3: 17, 4: 178}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161709852_1161709859 8 Left 1161709852 19:5841753-5841775 CCCTCTAAGCCTCAGAGGAAATT 0: 2
1: 1
2: 1
3: 17
4: 178
Right 1161709859 19:5841784-5841806 AGAGAAAGAGAAGTTGGGAAAGG 0: 3
1: 0
2: 13
3: 230
4: 1887
1161709852_1161709857 2 Left 1161709852 19:5841753-5841775 CCCTCTAAGCCTCAGAGGAAATT 0: 2
1: 1
2: 1
3: 17
4: 178
Right 1161709857 19:5841778-5841800 AGAGGCAGAGAAAGAGAAGTTGG No data
1161709852_1161709858 3 Left 1161709852 19:5841753-5841775 CCCTCTAAGCCTCAGAGGAAATT 0: 2
1: 1
2: 1
3: 17
4: 178
Right 1161709858 19:5841779-5841801 GAGGCAGAGAAAGAGAAGTTGGG No data
1161709852_1161709860 9 Left 1161709852 19:5841753-5841775 CCCTCTAAGCCTCAGAGGAAATT 0: 2
1: 1
2: 1
3: 17
4: 178
Right 1161709860 19:5841785-5841807 GAGAAAGAGAAGTTGGGAAAGGG 0: 3
1: 0
2: 10
3: 161
4: 1417

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161709852 Original CRISPR AATTTCCTCTGAGGCTTAGA GGG (reversed) Intergenic
901763784 1:11487422-11487444 AAGTTGCTCTGAGGCTCAGCAGG + Intronic
901912864 1:12474765-12474787 AATTTCCTAGGAGGCTCAAAAGG - Intronic
903637103 1:24828613-24828635 AATTTCTTCTGACACTTAGTGGG + Intronic
904243825 1:29171323-29171345 GATTGCCTCTGAGGGTGAGAGGG - Intronic
907250848 1:53138102-53138124 AATTTCCCCTCAGGTTTAGAAGG + Intronic
907672760 1:56491480-56491502 AATTTCCTCTGAGGTAGAGATGG - Intergenic
909753380 1:79192244-79192266 GCTTTCCTCTGAGACTTAGAAGG + Intergenic
910652219 1:89581938-89581960 AATTACCCCTTAGGCTTAGTGGG - Intronic
912704031 1:111898771-111898793 AGCTTCCACTGAGGCTAAGAGGG + Intronic
912719641 1:112008932-112008954 AATCTCTTGTGAGGCATAGAAGG - Intergenic
913324660 1:117616208-117616230 GAGTTCCTATGAGGATTAGATGG + Intronic
914963210 1:152225535-152225557 CATGTCCTCTGAGGCAAAGATGG - Intergenic
917107249 1:171504822-171504844 AATTTCTTCTGAGGTTTTGTTGG + Intronic
917516550 1:175713136-175713158 TCTTTCCTATGAGGCTTAGGAGG + Intronic
918194739 1:182210640-182210662 AAAGTCCTCTGAGGATAAGAGGG + Intergenic
919314598 1:195955087-195955109 CATTTCCTCTGGGGCTTCAAAGG + Intergenic
920774609 1:208923964-208923986 ATTTTCCTCTGGGTGTTAGACGG + Intergenic
921745324 1:218733754-218733776 AATCTCATCTGAGGCTTTGTTGG - Intergenic
923108886 1:230875381-230875403 GATTTCCTCTGAGGCAGCGAAGG - Intergenic
924284874 1:242475913-242475935 GATTTCCTGTGAGGCTGAGAGGG - Intronic
1063037665 10:2303061-2303083 ATTTTCCTCTATGGCTTACATGG + Intergenic
1066025013 10:31347835-31347857 AATTTACTGTGAGGCTTAAAAGG - Intronic
1067139660 10:43646546-43646568 GAATTCCTCTGGGGCTTGGAGGG - Intronic
1069772863 10:70910620-70910642 AATTTCCAGTGAGATTTAGAGGG + Intergenic
1069841428 10:71341787-71341809 AGTCTCCTCTGAGGCTTAGCTGG + Intronic
1071065935 10:81636224-81636246 AAGTTACTCTGACTCTTAGAGGG - Intergenic
1073598201 10:104820902-104820924 ATTTTGATCTGAGGCTTAAATGG + Intronic
1074021039 10:109583200-109583222 AATTTCTTCAAAGGCTCAGAAGG + Intergenic
1074053664 10:109902899-109902921 AACATCCCCTGTGGCTTAGATGG + Intronic
1074341037 10:112630351-112630373 AATTTCCTCAGAGGGCTGGAGGG - Intronic
1074942966 10:118252782-118252804 AATTTTATCTGAGGCTTATCAGG - Intergenic
1075177521 10:120179321-120179343 AATATACTCTGAGGTTTATAAGG - Intergenic
1075930937 10:126295104-126295126 AGTTTCCTCTGAAGCTCTGATGG - Intronic
1077637390 11:3852955-3852977 AATTTCCTGTGACGCTAAAATGG - Intergenic
1079148170 11:17873309-17873331 AATTTGCTGTGAGGATTAAATGG + Intronic
1079374340 11:19878794-19878816 AGTTTCCTCCAAGGCTTAGTTGG - Intronic
1079747097 11:24147615-24147637 AATTTGATATGAGACTTAGATGG - Intergenic
1081156014 11:39691952-39691974 TTTTCCCTCTGAGGCTCAGAGGG - Intergenic
1081948843 11:47024521-47024543 AATGTCCTTTGATCCTTAGAAGG + Intronic
1084727020 11:70948550-70948572 AAGTTCCTCTGAGTCTTATTTGG - Intronic
1088477117 11:110252274-110252296 TAGTTACTCTAAGGCTTAGATGG - Intronic
1089699652 11:120236846-120236868 CATGTGCCCTGAGGCTTAGAAGG - Intronic
1090525443 11:127529394-127529416 AGTTACCTCTTTGGCTTAGACGG + Intergenic
1092113477 12:5981544-5981566 AATTTCCACTCAGGCTGAGCTGG + Intronic
1092882494 12:12898564-12898586 AGTTTCCTCTGAGCCATATATGG - Intronic
1095851296 12:46810082-46810104 AATTGGCTCTGAGGATAAGAAGG - Intronic
1099225782 12:79967503-79967525 AATTGCCTCTGGGGCTTTTATGG + Intergenic
1102046698 12:109833806-109833828 AATTTCCTCCGAGGCGTTGAAGG + Intergenic
1107790033 13:43992575-43992597 ATCTTACTCTGAGGCTTAGATGG + Intergenic
1108374130 13:49797507-49797529 AAGTTCTTCTGAGGTTCAGAGGG - Intergenic
1108806434 13:54162341-54162363 AATTCCTTCTGAGGGTTATAAGG + Intergenic
1109170491 13:59090656-59090678 ATTTTCCTCTGATGCCTAAATGG - Intergenic
1112257553 13:97848995-97849017 AACTTCCTCTGAGTCTCACAGGG - Intergenic
1112390794 13:98982204-98982226 AATTTCCTGTGAGGTTTTCATGG - Intronic
1113401493 13:109998188-109998210 AATTTCCTCTGGGAGTGAGAGGG + Intergenic
1117726134 14:58676316-58676338 AATATAATCTGAGGCTGAGAAGG + Intergenic
1120623562 14:86796017-86796039 ATTTTCCTCTGAGGCTTCAGCGG - Intergenic
1122927352 14:104911436-104911458 AATTCCTTCTGAGGCTGTGAGGG - Intergenic
1125789914 15:42357256-42357278 ATTTCCCTCTCAGGTTTAGAAGG - Intergenic
1125976287 15:43954773-43954795 GATTTCATCTGAGGCTTTGCAGG - Intronic
1127959597 15:63880929-63880951 ACTTTCCAGTGAGACTTAGAAGG + Intergenic
1129551366 15:76453280-76453302 AATGGGCTCTGAGGTTTAGATGG - Intronic
1133612147 16:7443272-7443294 AATTTTCTTGGTGGCTTAGAAGG + Intronic
1138249789 16:55493052-55493074 GATTTCTTCTGACTCTTAGATGG + Intronic
1140069629 16:71637985-71638007 CATATTGTCTGAGGCTTAGAAGG + Intronic
1141059290 16:80850654-80850676 AATTTCCTGAGAGCCTTATATGG + Intergenic
1143993032 17:10982863-10982885 GGTTTCTTCTGAGGCTGAGAGGG + Intergenic
1144016843 17:11204267-11204289 GATTTCTTCTGAGGCTATGAGGG + Intergenic
1146773081 17:35587128-35587150 AACATCCTCTGAGGCCCAGATGG + Intronic
1146807601 17:35877837-35877859 TAGTTCCTCTGAGGTTTAGGTGG + Intronic
1147422299 17:40327932-40327954 AATTCCCTCCTAGGCTGAGAGGG - Intronic
1147478063 17:40733157-40733179 AATCTCCACTCAGGCTCAGAGGG - Intergenic
1150346733 17:64410536-64410558 AATTTTCTCTGAGGGTGAGAGGG + Intronic
1150972934 17:70050536-70050558 AATTACCTCTTAGCCTTTGAAGG + Intergenic
1151408460 17:73904516-73904538 AATTTGCTCTGGGGCTTTTAGGG - Intergenic
1153008453 18:516415-516437 TTTTTCCTGAGAGGCTTAGAGGG + Intergenic
1153874706 18:9358798-9358820 ATTTTACTCTCAGGCTTAGAAGG - Intronic
1154353445 18:13606202-13606224 ATTTTCTTCTGGGGCTTGGAAGG + Intronic
1155273758 18:24166255-24166277 ACTCTCCTCTGAGGCTGACAAGG + Intronic
1158062516 18:53363055-53363077 AAGTTAAACTGAGGCTTAGAAGG + Intronic
1161709852 19:5841753-5841775 AATTTCCTCTGAGGCTTAGAGGG - Intergenic
1161713621 19:5863637-5863659 AATTTCCTCTGAGACTTAGAGGG - Intergenic
1161716056 19:5876905-5876927 AATTTCCTCTGAGGCTTAGAGGG - Intronic
1161944504 19:7426951-7426973 AACTTTCTCTGAGACTCAGAAGG - Intronic
1167408574 19:49331123-49331145 ATTGTCCTCTGAGCCTTTGAAGG - Intergenic
1167647981 19:50716130-50716152 ACTTCCCTGTGATGCTTAGAAGG + Intronic
1167771071 19:51518956-51518978 AATTTCTTCTAAGGCTGAAAAGG - Intergenic
1167925108 19:52814970-52814992 AATTTCTTGTGAGTCTTTGAAGG - Intronic
925378584 2:3407197-3407219 AATTCCCTTTGAGTCTTAGATGG + Intronic
925925912 2:8670245-8670267 AAGTTCCTCAGAGACTTAAATGG - Intergenic
927700932 2:25268537-25268559 ATTTTGCTCTGAGAATTAGAAGG + Intronic
931459815 2:62440874-62440896 TCTGTCCTCTGAGGCTTTGATGG - Intergenic
932099177 2:68880944-68880966 AATTTCCTCTGTGAATTAAAAGG + Intergenic
932283603 2:70514962-70514984 GATGTCCTCAGACGCTTAGAGGG + Intronic
933006974 2:77006801-77006823 GATTTCCACTGAAGCTTAGCTGG - Intronic
934527552 2:95060961-95060983 GCTTCCCTCTGAGGCTTAAAAGG + Intergenic
936056116 2:109263484-109263506 AATGTCCTCTGTGGATTAGGGGG + Intronic
939091544 2:137786090-137786112 AAACTCCCCTGAGGCTTTGAGGG - Intergenic
940118343 2:150235415-150235437 AATTTCCTCAGCAGCATAGATGG + Intergenic
941513874 2:166447516-166447538 AATTTCTTCAGAATCTTAGATGG - Intronic
942723487 2:178981293-178981315 ACTTTCCTCTCAAGCTTACATGG + Intronic
942910769 2:181241767-181241789 ATTTTCCCCTGTTGCTTAGAAGG + Intergenic
945887113 2:215387403-215387425 AATTTCCTCTTGAGCTTAGGAGG - Intronic
947036947 2:225870100-225870122 AATTTCCTCTTACTCATAGAAGG + Intergenic
948555698 2:238809217-238809239 CATGTCCTCTAAGTCTTAGAAGG - Intergenic
1169307727 20:4507584-4507606 AATTTCCCTCGATGCTTAGAAGG + Intergenic
1172636690 20:36414754-36414776 CATTTCCCATGAGGCTTACATGG - Intronic
1177599233 21:23289172-23289194 AATATCCTCAGAGATTTAGATGG - Intergenic
1178638058 21:34322537-34322559 AAGTCCTTCTGAGGCTTGGAAGG - Intergenic
1181416299 22:22761993-22762015 TATTTCCTCTCAGGCCTAGTGGG - Intronic
1183749210 22:39710146-39710168 TAATTCCTATGAGTCTTAGAAGG + Intergenic
952499868 3:33951144-33951166 AATTTCCTGCTAGGCTGAGAAGG - Intergenic
953330832 3:42051696-42051718 CATCTCCTCTGAGCCTTTGAAGG - Intronic
958445555 3:94210517-94210539 AATTTCAACTGAGGTTTGGAGGG + Intergenic
963708500 3:148718640-148718662 AATGTCCTTTCAGTCTTAGAAGG - Intronic
966246754 3:177817122-177817144 AATTTCCTCAGAGAGTTTGAAGG + Intergenic
966400105 3:179539056-179539078 ATCTTCCTCTGAGGCTTCCAAGG + Intergenic
967841914 3:194012060-194012082 AATGGCATCTGAGGATTAGATGG + Intergenic
970480093 4:16463898-16463920 AATTTCATCTGAATCTCAGAAGG + Intergenic
970693453 4:18646289-18646311 ATCTTCCTCTGAGTCTCAGAGGG + Intergenic
972324518 4:38002704-38002726 TTTGTGCTCTGAGGCTTAGAGGG + Intronic
975179013 4:71321814-71321836 AATTTCCACTGAGTTTTGGATGG + Intronic
976707451 4:88034356-88034378 AATTTCCTATGATGCTTGAAAGG + Intronic
977744958 4:100535649-100535671 AATGTCATCTGAGACCTAGAGGG - Intronic
978593118 4:110347821-110347843 AATTCTCTCTTAGCCTTAGATGG - Intergenic
978705798 4:111709202-111709224 AATGACCTCTGAGGAATAGAGGG + Intergenic
981338740 4:143595910-143595932 AACTGCCTTTGAGGCTCAGAAGG + Intronic
981550134 4:145935799-145935821 AATTTCCTCTCAGACGGAGAGGG + Intronic
981568481 4:146126422-146126444 AATGCCTTCTGAGGCTCAGATGG + Intergenic
982587629 4:157262511-157262533 AATCACCTCTTAGACTTAGAGGG + Intronic
982983786 4:162177823-162177845 GATTTCTTCTGAGGCTGTGAGGG - Intergenic
983403295 4:167292943-167292965 AATTTTCTCTAACACTTAGAAGG - Intergenic
987693311 5:21296620-21296642 AATGTCCTCTAATGCTTAGCTGG + Intergenic
991746966 5:69752936-69752958 AATGTCCTCTAATGCTTAGCCGG - Intergenic
991750739 5:69802306-69802328 AATGTCCTCTAATGCTTAGCCGG + Intergenic
991798568 5:70332878-70332900 AATGTCCTCTAATGCTTAGCCGG - Intergenic
991826343 5:70628248-70628270 AATGTCCTCTAATGCTTAGCCGG - Intergenic
991830028 5:70677203-70677225 AATGTCCTCTAATGCTTAGCCGG + Intergenic
991890899 5:71332201-71332223 AATGTCCTCTAATGCTTAGCCGG - Intergenic
994536160 5:101031855-101031877 AATTTCCTAAGAGGTTTAGAAGG + Intergenic
994876431 5:105428522-105428544 AATTTCCTCTGGGCTTGAGAGGG + Intergenic
995826578 5:116306228-116306250 AATCACTTCTGAGGCTCAGAGGG + Intronic
999026936 5:148243525-148243547 AATTTTCTCTGATGGCTAGATGG - Intergenic
1001241732 5:170076460-170076482 TATTTCTTCTGAGGTTCAGAAGG + Intronic
1002291116 5:178201521-178201543 AATTTATTCTGAGGCTCAGCTGG - Intergenic
1003248319 6:4402609-4402631 AATTTCCGCTGAGTCATAGCTGG + Intergenic
1006250957 6:32784042-32784064 AATTTACTCTGAGGCTTAAAAGG + Intergenic
1008245997 6:49173865-49173887 AATTCTTTCTGAGGCTCAGATGG + Intergenic
1010224000 6:73472330-73472352 AATTTTCTTTGAGTTTTAGAAGG + Intronic
1010727860 6:79355723-79355745 ATTTCCCTCTTAGGCTTATAAGG + Intergenic
1014406632 6:121060581-121060603 AATTTCCAGTGAGGCACAGATGG - Intergenic
1014957093 6:127634074-127634096 AAATTCATCTGATCCTTAGATGG + Intergenic
1015483404 6:133741258-133741280 CAGGTCCTCTGAGGCTAAGAGGG + Intergenic
1015537565 6:134282010-134282032 CATTTCCTATAAGGCTTAGAGGG - Intronic
1015799783 6:137048361-137048383 TATTGCCTGGGAGGCTTAGATGG - Intergenic
1016239316 6:141909951-141909973 AGATTTCTCTGAGGCATAGATGG + Intergenic
1020644979 7:10803842-10803864 ATTTTCCTCTCAGGCTACGAAGG + Intergenic
1020670053 7:11095411-11095433 AATTTGCTCTGAGGATATGATGG + Intronic
1021705811 7:23366589-23366611 TATTTCTTCTAAGGATTAGAGGG - Intronic
1021859332 7:24890660-24890682 TATTTCCTCTGTGGCAGAGAAGG - Intronic
1023094703 7:36648893-36648915 AATTTCCTCAGATGTTTAAAGGG + Intronic
1028031772 7:85924213-85924235 TATTTACTCTGAGTCTTAAAAGG - Intergenic
1028891987 7:95998413-95998435 AATTTCCATTTAGGGTTAGAAGG - Intronic
1029328824 7:99834096-99834118 GATTTCCTCTTAGCCTCAGAAGG - Intronic
1031019771 7:116614458-116614480 AATTTCATGTGAAGTTTAGATGG + Intergenic
1035993156 8:4514963-4514985 CATTTCCACTGAGGCTTAAAAGG - Intronic
1036076700 8:5510397-5510419 ACTTCCATCTGAGACTTAGATGG - Intergenic
1037381634 8:18291646-18291668 AATTTCCCCGAAGTCTTAGAAGG + Intergenic
1037986375 8:23293124-23293146 AATTTCCTCTGAAGCCCATATGG - Intronic
1040633781 8:49248000-49248022 CATTTCATTTGAGACTTAGAAGG + Intergenic
1041055463 8:53981346-53981368 AAAGTCCTTTGAGGCTTTGAAGG - Intronic
1041231839 8:55760205-55760227 ATTTTCCTCTGAGGCATAGTTGG - Intronic
1041282964 8:56229950-56229972 AATTCTCCCTGTGGCTTAGAGGG - Intergenic
1043128695 8:76433418-76433440 ATTTTCCCCTGAGGCTTGAAAGG - Intergenic
1045961774 8:107977178-107977200 AATATCCTCATATGCTTAGAAGG + Intronic
1047172479 8:122507315-122507337 AATCACCTGTGAGGCTTGGAGGG + Intergenic
1048380018 8:133857245-133857267 ATTATCCTGTGTGGCTTAGATGG + Intergenic
1048966597 8:139619218-139619240 AATTTCCTCTGCAGGGTAGAGGG + Intronic
1050688101 9:8194589-8194611 ATTTTCCTCTGATGCCTAGTTGG - Intergenic
1051441199 9:17085206-17085228 CATATCCCCTGGGGCTTAGAAGG + Intergenic
1051587143 9:18738648-18738670 AATCTGCTCTGAGGATCAGAGGG + Intronic
1052407733 9:28083514-28083536 AGTTTCCTCTGTGGCACAGAGGG + Intronic
1052658444 9:31396221-31396243 ACTTTGCTCTTAGGCTTAGTAGG - Intergenic
1053226102 9:36359045-36359067 AATTTCATCTGAGGCCAAGGCGG + Intronic
1053424632 9:38003114-38003136 AGTTTCCTCTGAGGATCAGCTGG + Intronic
1055663067 9:78526049-78526071 AACTTCCTCTCTTGCTTAGAGGG + Intergenic
1056850343 9:90078661-90078683 CAGTTACTCTGAGGCTGAGATGG - Intergenic
1058621992 9:106892998-106893020 AATTTGCTCTGAGATATAGAAGG - Intronic
1061436398 9:130565470-130565492 AAGTTCATCTGAGGCTAAGCAGG + Intergenic
1062251125 9:135594635-135594657 AATTTCCTTTGTGGCTTAGCAGG + Intergenic
1187241399 X:17517243-17517265 TATTACCTCAAAGGCTTAGAGGG - Intronic
1188845752 X:35070072-35070094 AATTTCCACTGATGCTAAAAAGG - Intergenic
1191708313 X:64117465-64117487 AAATTCCTCAGAGGCCTAGAGGG - Intergenic
1193353208 X:80485559-80485581 AATCTCCTCAGAGCCTTAGGTGG + Intergenic
1195977487 X:110543400-110543422 AATTCCCTCTGAGGATTTCATGG - Intergenic
1196740725 X:119023697-119023719 TCTTTCCTCTGGGGCCTAGATGG - Intergenic
1196796052 X:119502747-119502769 AATATCCTGTGCGGCTGAGAAGG - Intergenic
1198251328 X:134881908-134881930 AATCTCCTCCCAGGATTAGAAGG + Intergenic
1200855313 Y:7931755-7931777 AATTCCCTCTGCGGTTAAGAAGG + Intergenic