ID: 1161711828

View in Genome Browser
Species Human (GRCh38)
Location 19:5853036-5853058
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2748
Summary {0: 5, 1: 27, 2: 288, 3: 352, 4: 2076}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161711828 Original CRISPR AAGGGGGAATGGAGGGCGGA AGG (reversed) Intergenic
Too many off-targets to display for this crispr