ID: 1161714579

View in Genome Browser
Species Human (GRCh38)
Location 19:5868122-5868144
Sequence CAGTGTGTCTGAGGGCCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 311}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161714579_1161714597 17 Left 1161714579 19:5868122-5868144 CCCTCTGGCCCTCAGACACACTG 0: 1
1: 0
2: 2
3: 27
4: 311
Right 1161714597 19:5868162-5868184 AGGCTGAGGCTGGGGAGAGGTGG 0: 1
1: 0
2: 19
3: 188
4: 2488
1161714579_1161714600 22 Left 1161714579 19:5868122-5868144 CCCTCTGGCCCTCAGACACACTG 0: 1
1: 0
2: 2
3: 27
4: 311
Right 1161714600 19:5868167-5868189 GAGGCTGGGGAGAGGTGGGGAGG 0: 1
1: 2
2: 47
3: 392
4: 2933
1161714579_1161714591 3 Left 1161714579 19:5868122-5868144 CCCTCTGGCCCTCAGACACACTG 0: 1
1: 0
2: 2
3: 27
4: 311
Right 1161714591 19:5868148-5868170 CCGTCCTGGGGGAGAGGCTGAGG 0: 1
1: 0
2: 2
3: 37
4: 394
1161714579_1161714594 8 Left 1161714579 19:5868122-5868144 CCCTCTGGCCCTCAGACACACTG 0: 1
1: 0
2: 2
3: 27
4: 311
Right 1161714594 19:5868153-5868175 CTGGGGGAGAGGCTGAGGCTGGG 0: 1
1: 0
2: 13
3: 160
4: 1417
1161714579_1161714595 9 Left 1161714579 19:5868122-5868144 CCCTCTGGCCCTCAGACACACTG 0: 1
1: 0
2: 2
3: 27
4: 311
Right 1161714595 19:5868154-5868176 TGGGGGAGAGGCTGAGGCTGGGG 0: 1
1: 1
2: 36
3: 284
4: 1988
1161714579_1161714585 -9 Left 1161714579 19:5868122-5868144 CCCTCTGGCCCTCAGACACACTG 0: 1
1: 0
2: 2
3: 27
4: 311
Right 1161714585 19:5868136-5868158 GACACACTGTCCCCGTCCTGGGG 0: 1
1: 0
2: 0
3: 13
4: 184
1161714579_1161714587 -3 Left 1161714579 19:5868122-5868144 CCCTCTGGCCCTCAGACACACTG 0: 1
1: 0
2: 2
3: 27
4: 311
Right 1161714587 19:5868142-5868164 CTGTCCCCGTCCTGGGGGAGAGG 0: 1
1: 0
2: 2
3: 38
4: 295
1161714579_1161714599 19 Left 1161714579 19:5868122-5868144 CCCTCTGGCCCTCAGACACACTG 0: 1
1: 0
2: 2
3: 27
4: 311
Right 1161714599 19:5868164-5868186 GCTGAGGCTGGGGAGAGGTGGGG 0: 2
1: 0
2: 13
3: 167
4: 1548
1161714579_1161714586 -8 Left 1161714579 19:5868122-5868144 CCCTCTGGCCCTCAGACACACTG 0: 1
1: 0
2: 2
3: 27
4: 311
Right 1161714586 19:5868137-5868159 ACACACTGTCCCCGTCCTGGGGG 0: 1
1: 0
2: 1
3: 12
4: 188
1161714579_1161714596 14 Left 1161714579 19:5868122-5868144 CCCTCTGGCCCTCAGACACACTG 0: 1
1: 0
2: 2
3: 27
4: 311
Right 1161714596 19:5868159-5868181 GAGAGGCTGAGGCTGGGGAGAGG 0: 1
1: 2
2: 77
3: 3113
4: 68852
1161714579_1161714598 18 Left 1161714579 19:5868122-5868144 CCCTCTGGCCCTCAGACACACTG 0: 1
1: 0
2: 2
3: 27
4: 311
Right 1161714598 19:5868163-5868185 GGCTGAGGCTGGGGAGAGGTGGG 0: 1
1: 0
2: 20
3: 200
4: 1632
1161714579_1161714593 7 Left 1161714579 19:5868122-5868144 CCCTCTGGCCCTCAGACACACTG 0: 1
1: 0
2: 2
3: 27
4: 311
Right 1161714593 19:5868152-5868174 CCTGGGGGAGAGGCTGAGGCTGG 0: 1
1: 0
2: 15
3: 290
4: 4014
1161714579_1161714602 30 Left 1161714579 19:5868122-5868144 CCCTCTGGCCCTCAGACACACTG 0: 1
1: 0
2: 2
3: 27
4: 311
Right 1161714602 19:5868175-5868197 GGAGAGGTGGGGAGGATAGGAGG 0: 1
1: 1
2: 17
3: 247
4: 1749
1161714579_1161714584 -10 Left 1161714579 19:5868122-5868144 CCCTCTGGCCCTCAGACACACTG 0: 1
1: 0
2: 2
3: 27
4: 311
Right 1161714584 19:5868135-5868157 AGACACACTGTCCCCGTCCTGGG 0: 1
1: 0
2: 0
3: 14
4: 124
1161714579_1161714601 27 Left 1161714579 19:5868122-5868144 CCCTCTGGCCCTCAGACACACTG 0: 1
1: 0
2: 2
3: 27
4: 311
Right 1161714601 19:5868172-5868194 TGGGGAGAGGTGGGGAGGATAGG 0: 1
1: 1
2: 24
3: 253
4: 2060

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161714579 Original CRISPR CAGTGTGTCTGAGGGCCAGA GGG (reversed) Intronic
900998500 1:6135577-6135599 CAGTGTGGCTGAGGAAAAGAGGG - Intronic
901537028 1:9889196-9889218 CAGTGCGTGGGAGGGACAGAAGG - Intronic
901646313 1:10718595-10718617 CAAAGTCGCTGAGGGCCAGAGGG + Intronic
902261252 1:15226514-15226536 CAGTGGGTCTGAGAGCCGGGAGG - Intergenic
902574110 1:17366479-17366501 GAGTGTTTCTGTGGACCAGAAGG + Intergenic
903044800 1:20556698-20556720 CAGTGTGTATGATGGACTGAGGG + Intergenic
904258265 1:29271273-29271295 GAGTGTGTCTGGGTGCCAGATGG + Intronic
904396467 1:30225531-30225553 CCCAGTGTCTGACGGCCAGATGG - Intergenic
905656640 1:39690213-39690235 CAGAGTGTCTCAGTGCCAGAAGG + Intronic
906157792 1:43624106-43624128 CTGTGTGTCCAGGGGCCAGATGG - Intergenic
906329691 1:44874954-44874976 CAGTATTTCTCAGGGCCACAAGG + Intronic
907470767 1:54672055-54672077 CAGTGTGACTGGAGCCCAGAGGG + Intronic
907559491 1:55375608-55375630 CAGTGGGTTTAAGGGCCAGCAGG - Intergenic
908640851 1:66221758-66221780 CAGAGGGTGGGAGGGCCAGAGGG - Intronic
909078904 1:71085673-71085695 TAGGGTGGCTTAGGGCCAGATGG + Intergenic
912617625 1:111121105-111121127 CAGTGTGTCTGATGGTGAAAAGG + Intronic
913972177 1:143423721-143423743 CTGTGTGGCAGAGGCCCAGAAGG - Intergenic
914066558 1:144249334-144249356 CTGTGTGGCAGAGGCCCAGAAGG - Intergenic
914112595 1:144717020-144717042 CTGTGTGGCAGAGGCCCAGAAGG + Intergenic
915980525 1:160417122-160417144 CAGTATGTCTAGGGGTCAGAGGG + Intronic
916256673 1:162794926-162794948 CAGTGAGGCTGTGGGGCAGAAGG + Intronic
916578838 1:166089944-166089966 CAGTGTGGCTCAGGGACAGTGGG - Intronic
921612827 1:217232581-217232603 CAGTGTGTGTGAAAGCAAGAGGG + Intergenic
921648091 1:217643450-217643472 CAGTGTGTCCCATGGACAGAAGG - Intronic
924055177 1:240118090-240118112 CAGTGTGTTTGAGGAGGAGAAGG + Intronic
924101825 1:240611699-240611721 GCGTGTGTCTGGGGGCCACAAGG - Intronic
1065020920 10:21500920-21500942 CAGTGGGGCTTTGGGCCAGAAGG + Intergenic
1066723134 10:38360583-38360605 CAGTGAGGCTGTGGGGCAGAAGG + Intergenic
1067539474 10:47141405-47141427 AAGCATGTCTGAGGGCCAAAGGG + Intergenic
1067684509 10:48458474-48458496 CAGTGTGGGTGAGGCGCAGACGG + Intronic
1068340776 10:55699478-55699500 CAGTGTGTCACATGGCAAGAGGG - Intergenic
1068778906 10:60898480-60898502 CAGTGTGTATGAGATGCAGAGGG + Intronic
1069091216 10:64200965-64200987 CCCTTTGTCTGAGAGCCAGAAGG - Intergenic
1069242913 10:66164541-66164563 CTATGTGTCTGAGGGGAAGAGGG - Intronic
1069353133 10:67553210-67553232 TAGTGTGTCTAAGTGCCTGAGGG - Intronic
1072192732 10:93089560-93089582 CAGTGTGTGTCGGTGCCAGACGG - Intergenic
1072742742 10:97919799-97919821 CAGTGAGCCTGAGTGACAGAGGG - Intronic
1073102654 10:101014874-101014896 CACTGTGTGTGAGGGCGAGCTGG - Intronic
1073183517 10:101601280-101601302 TAGTGTCTCTGTGGACCAGAAGG + Exonic
1073293756 10:102425880-102425902 CAGCAAGTCTGAGGGACAGAAGG - Intronic
1074563507 10:114555286-114555308 CAGAATATCTGAGAGCCAGAGGG + Intronic
1074573998 10:114651432-114651454 CAGTTTCTCTGAGGCCCAGCAGG - Intronic
1074913654 10:117935636-117935658 CTGTGTGTGTAAGGGACAGAGGG - Intergenic
1075247604 10:120837695-120837717 CAGTGTGTCACATGGCGAGAGGG + Intergenic
1075263829 10:120984220-120984242 ACTTGTGTCTGAGGGACAGAGGG + Intergenic
1075598578 10:123750240-123750262 CAGTGTTCCTGAGAGCCTGAGGG + Intronic
1075733638 10:124651207-124651229 CAGAGCGTCTGAGGGCAAGGTGG - Intronic
1076215859 10:128693012-128693034 CAGTGAGTCTGAGGCCTGGAGGG + Intergenic
1077210827 11:1370281-1370303 CCGGGTGTCTGTGGGCCTGAAGG - Intergenic
1078087387 11:8242458-8242480 CTGTGTCTCTGGGGGCCAGTGGG + Intronic
1078101055 11:8330560-8330582 CAGTCTGGCTCACGGCCAGATGG - Intergenic
1078335248 11:10458033-10458055 GTGTGTGTCTGAGGGCATGAAGG + Intronic
1080639117 11:34148558-34148580 CACTCTGTCTGGGGGCCAGATGG - Intergenic
1081264466 11:41002770-41002792 CAGTGTGTATGACAGCCACATGG + Intronic
1082720593 11:56670436-56670458 CAGGGTGTCTAAGGACTAGAAGG - Intergenic
1083212909 11:61200146-61200168 CAGTTTGTCTGGGGCCCACATGG - Intergenic
1083218737 11:61238138-61238160 CAGTTTGTCTGGGGCCCACATGG - Intergenic
1083738507 11:64695170-64695192 CAGTGGGGCTGGGGGCCAGGAGG - Intronic
1084579933 11:70016892-70016914 CAGGATGTCTGAGGGACAGAGGG - Intergenic
1084647051 11:70464724-70464746 CCAGGTGTCTGAGGACCAGATGG + Intergenic
1085392183 11:76188120-76188142 CAGCGTGTCTGATGCCCAGTGGG - Intronic
1085937453 11:81165801-81165823 CAGTGTGTTGGAGGGAGAGATGG - Intergenic
1086986524 11:93255995-93256017 CAGTGTGGCTCAGGAGCAGATGG + Intergenic
1088721337 11:112594738-112594760 GTTTGTGTCTGAGGGCCAGTAGG - Intergenic
1091202327 11:133791235-133791257 CAGTGTCTCTGCGGGTGAGAAGG - Intergenic
1093414965 12:18909249-18909271 CAGGGTGTCTGAGAGACACAGGG + Intergenic
1094871486 12:34601502-34601524 CAGAGTGTCTCAGGCCCACAGGG + Intergenic
1094871845 12:34603177-34603199 CAGAGTGTCTCAGGCCCACAGGG + Intergenic
1095867318 12:46986250-46986272 CAGTGTCTCTTAGGTCCAGTTGG - Intergenic
1096198508 12:49664525-49664547 CCCTGTGTGTGAGGGCAAGAAGG - Intronic
1096545802 12:52339463-52339485 GAGTGTGTCTGAAGGTGAGAGGG - Intergenic
1097579410 12:61435268-61435290 GAGTGTGTGTGAGGGACAGTGGG - Intergenic
1098226674 12:68332000-68332022 CAGTGTGTCGAAGAGTCAGATGG - Intronic
1100569969 12:95838099-95838121 CAATTTGACTGAGGGGCAGAAGG + Intergenic
1105255947 13:18744244-18744266 CAGGGTGTCTTGGGGCCATAAGG - Intergenic
1105600023 13:21878504-21878526 CAGTGTGACTGAGGGGCATAGGG - Intergenic
1105611106 13:21970366-21970388 CAGTGGGTCTGAGGTCCTCAGGG + Intergenic
1105640792 13:22261869-22261891 TACTGTGTCTGGGTGCCAGAAGG - Intergenic
1108094826 13:46890662-46890684 CAGTGTGGCTGAGGAAAAGATGG + Intronic
1109310698 13:60689322-60689344 CAGGATGTCTGAGGGCCCCAAGG - Intergenic
1111665887 13:91267347-91267369 CAGTGCCTCTCAGGGACAGAGGG + Intergenic
1112095866 13:96131011-96131033 CAGAGTATTTGAGGGCCAGGGGG + Intronic
1112938514 13:104830688-104830710 CAGTGTGTACGAGGACCAGAAGG - Intergenic
1113020242 13:105877111-105877133 CAGGCTGGATGAGGGCCAGAAGG - Intergenic
1114339319 14:21726641-21726663 CAGTGTGTCTGTAGGGCACATGG + Intergenic
1114368107 14:22052497-22052519 CAGTGAGTCTAAGTGACAGAAGG + Intergenic
1115571474 14:34670721-34670743 CAGTGTGTAGGAGAGCCACAAGG - Intergenic
1116186049 14:41601872-41601894 CATCGTGTCTGAGAGGCAGAAGG - Intergenic
1116476304 14:45344338-45344360 CAGTGTCTCTGAGAGTCACAGGG + Intergenic
1116997552 14:51339679-51339701 CAGAGTGGATAAGGGCCAGAGGG - Intergenic
1117495452 14:56297658-56297680 CAGTGTGACTGGTGGACAGATGG + Exonic
1118328987 14:64801312-64801334 CAATGTGGCTGAGCGCCAGCTGG - Exonic
1119648710 14:76367864-76367886 CAGGGTGTCTGAGCACCACAAGG - Intronic
1122424239 14:101596403-101596425 AAGTGGGTCTGAGTGGCAGATGG + Intergenic
1122424245 14:101596438-101596460 AAGTGGGTCTGAGTGGCAGATGG + Intergenic
1125502579 15:40248654-40248676 CACTGGGTGTGAGGGGCAGAGGG - Intronic
1128128127 15:65207757-65207779 CTGTCTCCCTGAGGGCCAGAAGG + Exonic
1128724631 15:69979303-69979325 CAGTGTGTGTGGGTCCCAGAGGG + Intergenic
1129392665 15:75228370-75228392 CTGTGTGTCTCTGGGCCAGCAGG - Intergenic
1129521132 15:76186928-76186950 TAGTGTGTACAAGGGCCAGAGGG - Intronic
1129742345 15:77995461-77995483 CAGTGAGAGTCAGGGCCAGAGGG + Exonic
1129843137 15:78756016-78756038 CAGTGAGAGTCAGGGCCAGAGGG - Intergenic
1129975325 15:79816761-79816783 CACTGTGTCTGAGGGCGAAGGGG + Intergenic
1132524044 16:405510-405532 CAGGGCATCTGAGGACCAGATGG + Intronic
1132659613 16:1055512-1055534 AAGGGTCTCTGAGGGCCAGCTGG + Intergenic
1132815102 16:1822097-1822119 CAGTGACTCTGAGGCCCCGAGGG - Intronic
1132891339 16:2206273-2206295 CAGCCTGTGTGAAGGCCAGATGG + Intronic
1133162394 16:3920653-3920675 CAGTGTGTGTGAAGCCCCGAGGG - Intergenic
1133302623 16:4792093-4792115 CAGGAAGACTGAGGGCCAGAGGG + Intronic
1133464213 16:6014606-6014628 CAGTCAGTCTGAGGACCACAGGG - Intergenic
1134187590 16:12096903-12096925 TAGGGTGGCTGAGGTCCAGAGGG + Intronic
1134528265 16:14961675-14961697 CAGTGTCTCTGAGTGCAAGAAGG - Intergenic
1135083850 16:19458899-19458921 GAGGGTGGCTGAGGGACAGAGGG - Intronic
1137088699 16:36161554-36161576 CAGTCTTTCTGAGGGCCATGTGG + Intergenic
1138269239 16:55682976-55682998 GTGTGTGTCCGAGGCCCAGATGG + Intronic
1139126519 16:64084901-64084923 CACTGTGCCTGGGGGCCAGATGG - Intergenic
1139292755 16:65873227-65873249 CAGTGAGTCTAAGGCTCAGAGGG - Intergenic
1140911596 16:79458394-79458416 CTCTGTCTCTGAGGGCCACATGG - Intergenic
1142114938 16:88351652-88351674 CTGTGGATCTGAGGTCCAGACGG + Intergenic
1142223068 16:88864782-88864804 CTGTGTGTCCCAGGGCCAGTGGG + Intronic
1143173055 17:4940992-4941014 CGGTGAGTCTGAGGGACGGATGG + Exonic
1143393897 17:6576746-6576768 CAGTGGGTCTGAAAGGCAGAAGG - Intergenic
1144749142 17:17636125-17636147 CAGTGTGTCACATGGCGAGAGGG - Intergenic
1146643315 17:34557218-34557240 CTGTGTCTCTAAGAGCCAGAAGG - Intergenic
1147155478 17:38542569-38542591 CAGGGTGTCTGGGGGCCATGAGG + Intronic
1147170848 17:38617878-38617900 CAGGGTGTCTGGTGTCCAGAAGG - Intergenic
1147915036 17:43880913-43880935 CAGGGAGGCTGAGGGCAAGAGGG + Intronic
1148105181 17:45115056-45115078 CTGGGTGTCTGGGGGCGAGAGGG - Intronic
1148647259 17:49226124-49226146 CAGTGTGTGAGAGGCGCAGAGGG + Intronic
1149313624 17:55420351-55420373 CGGTGTGTCTAAGGGCAAAATGG - Intronic
1149536847 17:57439852-57439874 GATAGTGTGTGAGGGCCAGAGGG + Intronic
1150643663 17:66965408-66965430 CATTGTGTCTGTGGGCGAGGGGG - Intronic
1150650248 17:67005435-67005457 CAGTGATTCAGAGGGGCAGAAGG - Intronic
1151339265 17:73459256-73459278 CAGTGTGTAAGATGGACAGAAGG - Intronic
1151821719 17:76500547-76500569 GGGTGTGTCTGAGGAGCAGAAGG - Intronic
1151830144 17:76544679-76544701 CTGTCAGGCTGAGGGCCAGAGGG + Intronic
1152289887 17:79434018-79434040 CAGTGTTCCTGAGCGCCAGGAGG - Intronic
1152365612 17:79854667-79854689 GAGTGTGTTTGAGGACCAGAAGG + Intergenic
1152420298 17:80189208-80189230 CAGTGCACCTGAGGCCCAGAGGG - Intronic
1152461102 17:80442996-80443018 CAGAGTGTCTCAGAGCCAGGAGG + Intergenic
1152479730 17:80542548-80542570 CAGTGACTCTGATGGCCAGCTGG - Intergenic
1152587145 17:81194200-81194222 CAGCCTGTCTCAGGCCCAGAGGG + Intronic
1153413095 18:4815985-4816007 CAGTGTGGAAGAGGACCAGAGGG - Intergenic
1154435087 18:14336444-14336466 CAGGGTGTCTTGGGGCCATAAGG + Intergenic
1159997551 18:74980887-74980909 CAGTGTGTCTGGGGCTGAGAAGG - Intronic
1160318022 18:77866145-77866167 CAGCGTGTGTGAGCGGCAGAAGG - Intergenic
1160962443 19:1729539-1729561 CAGTGTGTGTGAGTGGCAGAAGG + Intergenic
1161714579 19:5868122-5868144 CAGTGTGTCTGAGGGCCAGAGGG - Intronic
1162117786 19:8442027-8442049 CAGTGTGATTGAGGGGCAGGTGG + Intronic
1162373594 19:10292646-10292668 CAGCGTCTCCGAGGGGCAGATGG + Exonic
1163613619 19:18313320-18313342 CAGGGTGGCTGGGGGCCAGGTGG + Intronic
1163816266 19:19466394-19466416 GAGTTTGTCAGAGGGCCAGCCGG - Intronic
1164621172 19:29696868-29696890 CAGGGTGTCTGGGTGGCAGAGGG + Intergenic
1164621330 19:29697554-29697576 CAGGGTGTCTGGGTGGCAGAGGG - Intergenic
1165063925 19:33218395-33218417 CAGTGTCTCTGAGGTCCTCAGGG + Intronic
1165767084 19:38358355-38358377 CAGGGTGGCTGTGGGCCAGGAGG + Intronic
1165773585 19:38391931-38391953 AAGGTTGTCTGAGGGGCAGAAGG - Exonic
1166120861 19:40685511-40685533 CTGTGAGTCTGAGGCCCTGAAGG + Intronic
1167214458 19:48155121-48155143 CAGTGTGGCTGAGGGCATGCTGG - Intronic
1167216320 19:48167882-48167904 CAGAGTTTCTCAGGGCCAGTTGG + Intronic
1167354426 19:48994351-48994373 CAGTGTGTCTGAGAGCGCGAGGG + Intronic
925021814 2:575578-575600 CAGGGTGTGCAAGGGCCAGAAGG + Intergenic
925075268 2:1011202-1011224 CGGGGTGACTGAGGGCCAGGTGG + Intronic
927461373 2:23301222-23301244 TAGAGTGTCTGTGGGCCTGAGGG - Intergenic
927868482 2:26608375-26608397 CTGTGTGTCTGAGTCCCACAGGG + Intronic
928423122 2:31155167-31155189 CAGTGTTTCAGAGAGCGAGATGG - Intronic
928796796 2:35033161-35033183 CAGTGGGTAAGAGGGGCAGAGGG + Intergenic
931382744 2:61768388-61768410 CAGTGTGTCACATGGCAAGAGGG + Intergenic
932454167 2:71835609-71835631 CACATTCTCTGAGGGCCAGAGGG + Intergenic
933779774 2:85793264-85793286 CATGTTGTCTGTGGGCCAGATGG - Intergenic
934176874 2:89584658-89584680 CTGTGTGGCAGAGGCCCAGAAGG - Intergenic
934287181 2:91659018-91659040 CTGTGTGGCAGAGGCCCAGAAGG - Intergenic
934557751 2:95296429-95296451 CAGGGTGGCTGAGGACCTGACGG - Intergenic
935368611 2:102321055-102321077 TGGTGTGTCCGAGGGCCAGTAGG - Intronic
935936438 2:108189499-108189521 CACTGTGTCTGCTGCCCAGAAGG + Intergenic
936667732 2:114616535-114616557 AAGTGTTTCTGAGGGTCAGCTGG - Intronic
936749483 2:115623655-115623677 CAGTGGAGCTGAGGGCCTGAGGG + Intronic
937046541 2:118854937-118854959 TAGTGGGGCTGAGGGCGAGAGGG + Intergenic
937543292 2:122985949-122985971 CAGTGGGACTGAGGCCCACAGGG - Intergenic
938566762 2:132525661-132525683 CTGTATGTCTGACGGCCAAAGGG - Intronic
939014631 2:136887591-136887613 CAGTGTGTCACATGGCAAGAGGG - Intronic
947690665 2:232133095-232133117 CAGTGTTTCTGAGTGGGAGAGGG - Intronic
948000001 2:234559986-234560008 CCGTGTGTGTGAAGGCCAGGGGG + Intergenic
948085601 2:235244184-235244206 CAGCATGTCTGGGGGCCTGAGGG - Intergenic
948993345 2:241565394-241565416 CAGTGGGCCTGAGGGGCAGAAGG - Intronic
1168734259 20:116321-116343 CAATGTGGTTGAGGGCCACAGGG - Intergenic
1169197856 20:3693015-3693037 CGGCGTGGCTGAGGGCCAGCTGG + Exonic
1170305547 20:14934069-14934091 CAGGAACTCTGAGGGCCAGATGG - Intronic
1171157597 20:22890653-22890675 CAGAGTGGCTGAGGTCCAGATGG - Intergenic
1171215688 20:23350714-23350736 CAGTGGGACTGCGGGCCGGAAGG - Exonic
1171880701 20:30615983-30616005 CAGTGTGTCTTGGGGCCATAAGG - Intergenic
1172625269 20:36343075-36343097 AACTGGGGCTGAGGGCCAGAAGG - Intronic
1173189918 20:40868374-40868396 CACTCTATCTGAAGGCCAGATGG - Intergenic
1173247584 20:41347314-41347336 CAGTGTGAGTGAGGGAGAGATGG + Intronic
1174128378 20:48325382-48325404 TAGTGTGTCTGAGGGGCAGGGGG - Intergenic
1174677556 20:52373055-52373077 CAGAGTGTGTGAGGGGAAGAGGG - Intergenic
1175246336 20:57584455-57584477 GTGTGGGTCTGAGGGTCAGAGGG + Intergenic
1175266021 20:57704000-57704022 GAGTGAGACCGAGGGCCAGAGGG - Intronic
1175322848 20:58101559-58101581 CAGTGTGGCTCGGGGCCAGCAGG - Intergenic
1176260754 20:64178341-64178363 GAATGGGTCTGAGGACCAGATGG - Intronic
1176841949 21:13849258-13849280 CAGGGTGTCTTGGGGCCATAAGG - Intergenic
1176960776 21:15156452-15156474 CAGTGTGTCTGGGGCTCACAAGG - Intergenic
1177673464 21:24265729-24265751 CAGTGACTATGAGTGCCAGAAGG + Intergenic
1178743522 21:35225887-35225909 CAGTGGCTCTGAGGGGCAGGTGG + Intronic
1179110023 21:38438451-38438473 CAGTATGTCTAAGGCCCTGATGG + Intronic
1179292294 21:40029361-40029383 CCTTGTGTCTGGGGCCCAGAGGG - Intronic
1182459683 22:30475002-30475024 CAGGGTGTCTTGGGGCCAGAAGG + Intergenic
1183654765 22:39178001-39178023 CTGTCTGTCTGAGGGACAGTAGG + Intergenic
1184115730 22:42421058-42421080 CAGTGCTGCAGAGGGCCAGATGG + Intronic
1184945664 22:47802080-47802102 AATTGTGTCTGCAGGCCAGAGGG - Intergenic
1185404695 22:50641271-50641293 CTGTGTGGCTGAGGGCCCCAAGG + Intergenic
949584933 3:5428162-5428184 CTCTGTGTCTGCGGGGCAGAAGG - Intergenic
949894166 3:8757010-8757032 CAGTGTTTCTGTGGGCCAGGGGG - Intronic
950261755 3:11547100-11547122 AAGAGTGTCTGGGGCCCAGAGGG + Intronic
950707112 3:14789723-14789745 CTGTCTGTCTGGGGGCAAGACGG + Intergenic
953268773 3:41419245-41419267 CGGTGTTTCTGAGGACCAGCAGG + Intronic
953575830 3:44112473-44112495 CTCTGTGTCTGAGGGGCAAAAGG - Intergenic
953708026 3:45245778-45245800 CAGAGTGTCTGCTGGCCACATGG + Intergenic
953717705 3:45330091-45330113 CAGTCTGTCAGCCGGCCAGAAGG - Intergenic
954463408 3:50640544-50640566 CAGGGAGCCTGAGGGCCACAGGG - Intronic
955801232 3:62688828-62688850 CAGAGTGTCTGGGTGGCAGAAGG + Intronic
958768140 3:98395489-98395511 CAGCTTCTCTGAGGGTCAGAGGG - Intergenic
960955669 3:123028625-123028647 TAGTGTTTCTGATGGCTAGAAGG + Intergenic
961557944 3:127709502-127709524 AAGTGACTCAGAGGGCCAGAAGG + Intronic
961978665 3:131054007-131054029 CAGTGTGTCTTAGGGACAGAGGG + Intronic
962436943 3:135375454-135375476 CAGTGTGGCTGAAATCCAGATGG - Intergenic
962913815 3:139880427-139880449 TAGTTTGTCTGAGAGACAGAAGG - Intergenic
963542024 3:146603935-146603957 CAGTGATTCTGAGGGACTGAGGG + Intronic
964616497 3:158672370-158672392 CAGGGTGTTTGAGGTGCAGAAGG - Exonic
965608460 3:170519854-170519876 CAGTATGTCTGAGTTCCAGAAGG - Intronic
966007594 3:175035305-175035327 ATGTGTGTCTGAGGGATAGAAGG + Intronic
968226466 3:196975507-196975529 CTCTGTGTCTGAGGGCCAGCAGG + Intergenic
968349933 3:198045814-198045836 CAGGGTGTCTTGGGGCCATAAGG - Intergenic
968578309 4:1378075-1378097 AAATGTGGCTGAGAGCCAGAGGG - Intronic
968609628 4:1551133-1551155 CAGTGTGTCTAAGGGCCATGGGG + Intergenic
968751087 4:2389380-2389402 CAGTGTGTCTGTGGCTCACAGGG - Intronic
968801695 4:2747171-2747193 CAGTGTGTCTGAGTGCATGCAGG - Intronic
970840462 4:20462606-20462628 CAGTGTGTCAGAGAGTCAGTGGG - Intronic
973687552 4:53388225-53388247 CAGTGAATCTGAAGTCCAGATGG + Intronic
976145334 4:82037299-82037321 CAGTTTGTTTGAGGGCCAATTGG - Intronic
976214574 4:82704254-82704276 CTGTGTGTCTGAGGGCCACAGGG + Intronic
978167468 4:105625975-105625997 AAGAGTGCCTGAGGACCAGATGG - Intronic
985198204 4:187455921-187455943 CAGAGTGTATGAGGGGCTGATGG + Intergenic
985500567 5:241849-241871 CAGTGTGACTAAGGCACAGAAGG + Intronic
985519427 5:366068-366090 CAGTGTGTGTGTGGGGCAGGGGG - Intronic
986207361 5:5637736-5637758 GAGTGAGGCTAAGGGCCAGATGG + Intergenic
986707051 5:10460832-10460854 GGGTGTGTCTCCGGGCCAGATGG + Intronic
987403321 5:17500249-17500271 CAGTGTGTCTTAGAGACACAAGG + Intergenic
987413364 5:17636476-17636498 CAGTGTGTCTTAGAGACACAAGG + Intergenic
988484480 5:31657249-31657271 CAATGTCTTTGAGGGCAAGATGG + Intronic
989217173 5:38917378-38917400 CAGTGTGGCTGTGGACCAGTGGG + Intronic
990791697 5:59487966-59487988 CTGTGTGTCTGATGTGCAGAGGG - Intronic
991547276 5:67796354-67796376 CAGTGTGGCTGAAAGCCTGAAGG - Intergenic
991548800 5:67813801-67813823 CAGTGAGTCTGAAGGCAACAGGG + Intergenic
992891272 5:81206556-81206578 CAGTGAGTCTGAGGGTGAGCTGG - Intronic
993177255 5:84502726-84502748 CAATTTGACTGAGGGGCAGAAGG + Intergenic
994000816 5:94776808-94776830 CAGTGTGTCTGAGTGGAAGAAGG - Intronic
994662089 5:102666344-102666366 CAGTGTGGGTCAGAGCCAGATGG + Intergenic
995187039 5:109282180-109282202 GAGTGTGTCTGAGAGGTAGAGGG + Intergenic
997101438 5:130973572-130973594 GTGTGTGTCTGAGAGACAGAGGG + Intergenic
997439822 5:133901267-133901289 CAGAGGGTCAGAGGGGCAGATGG - Intergenic
997632257 5:135377808-135377830 CAGAGTGTCTGAGGGTAAGGGGG - Intronic
998693027 5:144608617-144608639 CAATGTGTGTGAAGGCGAGAAGG - Intergenic
999138196 5:149337939-149337961 AAGCGTGCCTGATGGCCAGATGG + Intronic
999573461 5:152946896-152946918 TACTGTGTCTCAGGCCCAGAGGG - Intergenic
1003297870 6:4849857-4849879 CAGTGTGTTTGATGGTGAGATGG + Intronic
1003327197 6:5100931-5100953 CAGTGTCTGTGTGGGTCAGATGG - Intergenic
1004456742 6:15798448-15798470 CAGTTTGTCAGAAGGGCAGATGG + Intergenic
1006104269 6:31707233-31707255 GAGGGGGTCTGAGGGCAAGAGGG - Intronic
1006622843 6:35378563-35378585 CAGCGTCTCTGAGTGCCAGGTGG + Intronic
1007095009 6:39207675-39207697 CAGGGTGTTTGAAGGCCTGATGG + Intronic
1008556685 6:52679330-52679352 CAGAGTGAAAGAGGGCCAGATGG + Intronic
1009831279 6:68939162-68939184 CACTGTGTCCGATGTCCAGAAGG + Intronic
1010732165 6:79402847-79402869 CAGTGTGTCTGAGTGGAAGAAGG - Intergenic
1013013749 6:106143073-106143095 CAGTCAGTCAGAGGGCCAAATGG - Intergenic
1013532205 6:111030293-111030315 CAGTGTGTGAGAGGGACAGAGGG - Intergenic
1013658497 6:112270384-112270406 CAGTGTGTCTGGTGGGCAGCTGG + Intergenic
1016338848 6:143039034-143039056 CAATGTGTCTAACAGCCAGAAGG - Intergenic
1016843661 6:148548950-148548972 CAGGATGCCCGAGGGCCAGATGG + Exonic
1016844285 6:148555966-148555988 CAGTCAGGCTGAGGGCCAGGTGG - Intergenic
1017909436 6:158780435-158780457 AAATGTGTTAGAGGGCCAGAGGG + Intronic
1018638034 6:165882072-165882094 CAGTGGTTCTTTGGGCCAGAGGG - Intronic
1018997239 6:168719228-168719250 CAGTGTGTCTGGATGCCACACGG - Intergenic
1020592472 7:10158283-10158305 CAGTATTTCTTAGGGCCATATGG + Intergenic
1023888178 7:44375417-44375439 CAGTGTGTCTGGTGGCCGGGAGG - Intergenic
1024338261 7:48231434-48231456 CAGTGTGTCTGAGGTACAGTGGG + Intronic
1025565737 7:62432146-62432168 CAGTATGTCTGAGGGCTATGTGG + Intergenic
1027449566 7:78315272-78315294 CAGGACGTCTGTGGGCCAGAGGG + Intronic
1027773315 7:82433938-82433960 CAGTCTGAATGTGGGCCAGATGG - Intronic
1029868793 7:103665421-103665443 AGGTGTGGCTGAGGGACAGAGGG - Intronic
1034244548 7:149634677-149634699 AAGTGTGGCTGAGGGACAGGGGG + Intergenic
1034901001 7:154907758-154907780 CAGTGTGCCTGAGGCCAGGAAGG - Intergenic
1035455785 7:159007681-159007703 AAGTGTGTGTGAGCTCCAGAGGG - Intergenic
1037538591 8:19850967-19850989 CAGAATCTCTGAGGGGCAGAGGG - Intronic
1037834680 8:22208972-22208994 TAGCAGGTCTGAGGGCCAGATGG - Intronic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1039226470 8:35393586-35393608 CAGTGTGTCTGAGAGCAGGGTGG - Intronic
1039415518 8:37390629-37390651 CAGTGTGCCTCTGGGCCAGAAGG + Intergenic
1040007815 8:42635649-42635671 CTGGGTGTCTGTGGGACAGAAGG - Intergenic
1041542950 8:59007857-59007879 AAGTTTGTCTAAGAGCCAGAAGG + Intronic
1043859094 8:85294876-85294898 CAGGATGTCTGAGTGACAGATGG - Intergenic
1047924049 8:129665464-129665486 AAGTGTGTGTGAGGAACAGAAGG + Intergenic
1048843061 8:138581817-138581839 AAGGGTTTCTGAGGGCCACAAGG - Intergenic
1048944886 8:139435978-139436000 CAGGATGGCTGAGGGCCAGCTGG + Intergenic
1049473369 8:142786028-142786050 CTATGTTTCTGAGGGCCTGACGG + Intronic
1049744938 8:144259306-144259328 CAGTGCGTATGAGAACCAGAGGG + Exonic
1051335728 9:16064355-16064377 CAGTGTGTCTGCGAGAGAGAAGG + Intergenic
1052610630 9:30769113-30769135 CATTTTGTCTGTTGGCCAGATGG - Intergenic
1054737605 9:68771142-68771164 CAGGGAGTCTGAGGTTCAGAAGG - Intronic
1055103684 9:72490975-72490997 GAGGGGGTCTGAGGACCAGATGG + Intergenic
1056592311 9:87973791-87973813 CAGTGTGTGTGAGTGACAGCGGG + Intronic
1057221735 9:93261155-93261177 CAGAGGGTCTCAGGGCCAGCAGG + Intronic
1057334348 9:94144093-94144115 CTGTGTGTCCTAGGACCAGAAGG + Intergenic
1057495280 9:95555519-95555541 TGGTGTGTCTGAGGGACAGGAGG - Intergenic
1057675066 9:97131567-97131589 CAGGGTGTCTTGGGGCCATAAGG - Intergenic
1057818269 9:98311679-98311701 CAGTGGGGCTGTGGGCAAGAGGG - Intronic
1057949238 9:99356666-99356688 CAGTGAGACTGACGGACAGAGGG - Intergenic
1058069906 9:100591387-100591409 CAGTGTGGCTGAGGAACAAAGGG + Intergenic
1058797683 9:108514249-108514271 TGGTGTGTCTAAGGGGCAGATGG + Intergenic
1060633616 9:125182213-125182235 CAGTGTTTGTGAGGGCAAGAGGG - Intronic
1060789458 9:126476232-126476254 GAGCCTGCCTGAGGGCCAGAAGG + Intronic
1061322410 9:129839569-129839591 AAGGGTGTGCGAGGGCCAGAGGG + Intronic
1061373823 9:130212642-130212664 CAGCGTGTCTGAAGGAGAGAGGG + Intronic
1061420292 9:130469892-130469914 CAGTGGGGCTGAGGGGCTGAAGG + Intronic
1062536029 9:137021514-137021536 CACTGTGCCTGAGAGTCAGAAGG - Exonic
1185711851 X:2310480-2310502 CAGTAGGTCTTAGGGGCAGATGG - Intronic
1187619448 X:21034424-21034446 CAGTGTGGCTGAAGTCCAGAAGG + Intergenic
1188369417 X:29350262-29350284 CAGTGTGTCTATGAGCCAGGTGG - Intronic
1189905405 X:45754191-45754213 CAGTGAGTCCCAGAGCCAGAAGG + Intergenic
1193331480 X:80239467-80239489 CAGTGTGTCAGAGGCTCACAGGG + Intergenic
1194295158 X:92118204-92118226 CAGTGTTTCTGAAGGGCATATGG - Intronic
1195366289 X:104129407-104129429 TAGTGTTTCTAAGAGCCAGAAGG - Intronic
1195713064 X:107790588-107790610 CAGTGTGTATGAAGGCATGAAGG - Intronic
1196370867 X:114978336-114978358 CAGTGTGGCTGAAAGACAGATGG + Intergenic
1196574510 X:117302469-117302491 CAGTCTGTGTGAAGCCCAGAGGG - Intergenic
1196843007 X:119875872-119875894 CAGTGAGTCAGAGGACAAGAAGG - Intronic
1199684261 X:150252234-150252256 GTGTGTGTGTGAGGCCCAGAGGG + Intergenic
1199828797 X:151528253-151528275 CAGTGTGTCTGGGGCAGAGAGGG + Intergenic
1199875126 X:151922584-151922606 CACTGTGTCTGTAGACCAGATGG - Intronic
1200612658 Y:5342728-5342750 CAGTGTTTCTGAAGGGCATATGG - Intronic
1201898146 Y:19016027-19016049 CTGTGTTGCTGAGGGCCAGCTGG - Intergenic