ID: 1161714876

View in Genome Browser
Species Human (GRCh38)
Location 19:5869926-5869948
Sequence TATAGGCATGTGCCAGCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 606
Summary {0: 1, 1: 0, 2: 24, 3: 126, 4: 455}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161714876_1161714882 2 Left 1161714876 19:5869926-5869948 CCAGGTGCTGGCACATGCCTATA 0: 1
1: 0
2: 24
3: 126
4: 455
Right 1161714882 19:5869951-5869973 CCCAGCTACTCGGGAGGCTGAGG 0: 97626
1: 275854
2: 227041
3: 130261
4: 162635
1161714876_1161714887 28 Left 1161714876 19:5869926-5869948 CCAGGTGCTGGCACATGCCTATA 0: 1
1: 0
2: 24
3: 126
4: 455
Right 1161714887 19:5869977-5869999 AATTGCTTGAACCCGGGAGGCGG 0: 9588
1: 51717
2: 117050
3: 131419
4: 77213
1161714876_1161714878 -7 Left 1161714876 19:5869926-5869948 CCAGGTGCTGGCACATGCCTATA 0: 1
1: 0
2: 24
3: 126
4: 455
Right 1161714878 19:5869942-5869964 GCCTATAATCCCAGCTACTCGGG 0: 6396
1: 90210
2: 219601
3: 229121
4: 189312
1161714876_1161714884 21 Left 1161714876 19:5869926-5869948 CCAGGTGCTGGCACATGCCTATA 0: 1
1: 0
2: 24
3: 126
4: 455
Right 1161714884 19:5869970-5869992 GAGGCAGAATTGCTTGAACCCGG 0: 717
1: 1046
2: 3741
3: 43324
4: 104188
1161714876_1161714880 -4 Left 1161714876 19:5869926-5869948 CCAGGTGCTGGCACATGCCTATA 0: 1
1: 0
2: 24
3: 126
4: 455
Right 1161714880 19:5869945-5869967 TATAATCCCAGCTACTCGGGAGG 0: 3485
1: 61047
2: 226834
3: 256535
4: 206825
1161714876_1161714885 22 Left 1161714876 19:5869926-5869948 CCAGGTGCTGGCACATGCCTATA 0: 1
1: 0
2: 24
3: 126
4: 455
Right 1161714885 19:5869971-5869993 AGGCAGAATTGCTTGAACCCGGG 0: 693
1: 1853
2: 5096
3: 47600
4: 139628
1161714876_1161714889 30 Left 1161714876 19:5869926-5869948 CCAGGTGCTGGCACATGCCTATA 0: 1
1: 0
2: 24
3: 126
4: 455
Right 1161714889 19:5869979-5870001 TTGCTTGAACCCGGGAGGCGGGG 0: 84
1: 708
2: 2127
3: 3532
4: 4509
1161714876_1161714877 -8 Left 1161714876 19:5869926-5869948 CCAGGTGCTGGCACATGCCTATA 0: 1
1: 0
2: 24
3: 126
4: 455
Right 1161714877 19:5869941-5869963 TGCCTATAATCCCAGCTACTCGG 0: 4701
1: 62037
2: 110139
3: 168034
4: 247405
1161714876_1161714888 29 Left 1161714876 19:5869926-5869948 CCAGGTGCTGGCACATGCCTATA 0: 1
1: 0
2: 24
3: 126
4: 455
Right 1161714888 19:5869978-5870000 ATTGCTTGAACCCGGGAGGCGGG 0: 178
1: 1128
2: 2665
3: 3865
4: 3956
1161714876_1161714886 25 Left 1161714876 19:5869926-5869948 CCAGGTGCTGGCACATGCCTATA 0: 1
1: 0
2: 24
3: 126
4: 455
Right 1161714886 19:5869974-5869996 CAGAATTGCTTGAACCCGGGAGG 0: 453
1: 17576
2: 86774
3: 182174
4: 202123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161714876 Original CRISPR TATAGGCATGTGCCAGCACC TGG (reversed) Intronic
900044879 1:497902-497924 TCGAGGCATGTGCCACCACAAGG - Intergenic
900066679 1:736216-736238 TCGAGGCATGTGCCACCACAGGG - Intergenic
900067075 1:739632-739654 TCGAGGCATGTGCCACCACAAGG - Intergenic
900796791 1:4712830-4712852 TACAGGCATGTGCAAGCTCATGG - Intronic
901702308 1:11052203-11052225 TACAGGCATGAGCCACCACCCGG + Intergenic
902445830 1:16463599-16463621 TAAAGGCATGAGCCACCACATGG + Intergenic
902831626 1:19017569-19017591 TACAGGCATGAGCCACCACCCGG - Intergenic
903924191 1:26819837-26819859 TACAGGCATGAGCCACCAACCGG - Intergenic
904203942 1:28840392-28840414 TACAGGCATGAGCCACTACCTGG + Intronic
904628893 1:31826715-31826737 TACAGGCATGAGCCACCACCCGG + Intergenic
905189533 1:36222984-36223006 TACGGGCATATGCCACCACCCGG - Intergenic
905469553 1:38181603-38181625 TATAGGCGTGAGCCACCACGCGG + Intergenic
905814769 1:40940955-40940977 TATAGGCATGAGCCACTACCAGG - Intergenic
906088595 1:43157608-43157630 TACAGGCGTGAGCCACCACCCGG - Intergenic
906483331 1:46215755-46215777 TACAGGCATGTACCTACACCTGG - Intronic
906539099 1:46571399-46571421 TACAGGTGTGTGCCACCACCTGG - Exonic
908502890 1:64761972-64761994 TACAGGCATGTGCCACCACTAGG - Intronic
909763265 1:79320883-79320905 TACAGGCATGAGCCAGCGCCTGG + Intergenic
909765420 1:79349602-79349624 TACAGGCATGAGCCAGCGCCCGG + Intergenic
910054940 1:83022467-83022489 TATAGGCACATGCCAACACCTGG + Intergenic
910247842 1:85161448-85161470 TACAGGCGTGAGCCACCACCTGG - Intronic
910887404 1:91979252-91979274 TACAGGCATGCGCCACCACACGG + Intronic
910943438 1:92561911-92561933 TATAGGCGTGCGCCCACACCTGG + Intronic
912280662 1:108309148-108309170 CATAGGCATGCGCCACCACAAGG - Intergenic
912287564 1:108385209-108385231 CATAGGCATGCGCCACCACAAGG + Intronic
912649292 1:111423858-111423880 TATATGCCTCTCCCAGCACCAGG + Intronic
912887133 1:113486790-113486812 TACAGTCATGTGCCACCACGTGG + Intronic
912992805 1:114506104-114506126 TATAGGCGTGAGGCACCACCTGG - Intronic
913438533 1:118872476-118872498 TACAGGCATGAGCCACCATCCGG + Intergenic
914436804 1:147667713-147667735 TACAGGCGTGAGCCAGCACCCGG - Intronic
914763062 1:150614626-150614648 TACAGGCATGAGCCACCACCTGG + Intronic
915411452 1:155704004-155704026 TACAGGCATGTGCAACCACCTGG - Intronic
915435067 1:155898389-155898411 TACAGGCATGAGCCACCACCTGG - Intronic
915957306 1:160232242-160232264 TATAGGCATGAGCCAGTGCCTGG - Intronic
916011792 1:160712740-160712762 TATAGGCATGGGCCTGTGCCTGG + Intergenic
916177179 1:162052115-162052137 TATAGGCATGAGCCACCACCTGG + Intergenic
916982254 1:170151130-170151152 AATAGGCATGTGCTAGGACCTGG + Intronic
917236669 1:172900063-172900085 TACAGGTATGTGCCACCACATGG + Intergenic
917892083 1:179450129-179450151 TACAGGCATCTGCCAGTAGCTGG + Intronic
917996698 1:180446763-180446785 TACAGGCATGAGACTGCACCTGG - Intronic
918045780 1:180940223-180940245 TATAGGCATGAGCCACTGCCTGG - Intronic
918374690 1:183897406-183897428 TAGAGGAATGCGCCACCACCTGG - Intronic
918610931 1:186490951-186490973 TACAGGCCTGAGCCACCACCTGG + Intergenic
920103143 1:203530768-203530790 TATAGTCTTGGGCCACCACCAGG - Intergenic
920320396 1:205117383-205117405 TACAGGCATGAGCCACCACACGG - Intronic
920514292 1:206573183-206573205 TACAGGCATGAGCCACCACACGG - Intronic
921459243 1:215409736-215409758 TATAGGAATGTGGAAGCCCCAGG + Intergenic
921827594 1:219691242-219691264 TACAGGCATGAGCTTGCACCTGG - Intronic
922101398 1:222480158-222480180 TCGAGGCATGTGCCACCACAAGG - Intergenic
922262480 1:223955270-223955292 TAGAGGTATGTGCCACCACAAGG - Intergenic
922453370 1:225754639-225754661 TACAGGCATGAGCCACCACATGG + Intergenic
922928078 1:229367294-229367316 TATAGGCATGAGCCACGGCCTGG + Intergenic
923172860 1:231432974-231432996 TACAGGCATGCACCACCACCTGG - Intergenic
923315788 1:232778840-232778862 TACAGGCGTGTGGCACCACCCGG - Intergenic
923995146 1:239485423-239485445 TACAGGCACATGCCACCACCTGG + Intronic
924344319 1:243060270-243060292 TCGAGGCATGTGCCACCACAAGG - Intergenic
924662409 1:246033508-246033530 TACAGGTGTGAGCCAGCACCCGG - Intronic
924760776 1:246983241-246983263 TACAGGCATGTGCCACCATGTGG - Intronic
1063442489 10:6084250-6084272 TACAGGCATAAGCCTGCACCTGG - Intergenic
1064074673 10:12259181-12259203 TACAGGCATGAGCCACCAGCTGG + Intergenic
1065013178 10:21437781-21437803 TACAGGCGTGAGCCACCACCCGG + Intergenic
1065302240 10:24333298-24333320 TACAGGCATGAGCCACCACAGGG + Intronic
1065826834 10:29580051-29580073 TACAGGCATAAGCCACCACCAGG - Intronic
1066067450 10:31772661-31772683 TATAGGCGTGAGCCACCACATGG + Intergenic
1066629281 10:37442882-37442904 TATAGGGGTGAGCCACCACCCGG - Intergenic
1066732014 10:38444790-38444812 TAGAGGTATGTGCCACCACAAGG + Intergenic
1067017267 10:42767676-42767698 TACCGGCATGAGCCACCACCCGG - Intergenic
1068880606 10:62044638-62044660 TACAGTCATGAGCCACCACCAGG + Intronic
1069114472 10:64488326-64488348 TATAGGCATGCCACTGCACCTGG - Intergenic
1069453023 10:68532364-68532386 TACAGGCATGAGCCACAACCAGG + Intergenic
1069520959 10:69120839-69120861 TACAGGCATGCCCCACCACCTGG + Intergenic
1070018755 10:72562427-72562449 TATAGGCATGAGCCACCATGCGG + Intronic
1070087301 10:73249929-73249951 TATAGGCGTGAGCCACCGCCCGG - Exonic
1070125373 10:73617313-73617335 TACAGGCATGCGCCACCGCCTGG - Intronic
1070258377 10:74829409-74829431 TGTAGGCATGTGTAAGCACGTGG - Intronic
1070293936 10:75142708-75142730 TACAGGCATGAGCCACCACCCGG + Intronic
1070294202 10:75145218-75145240 TACAGGCGTGAGCCACCACCTGG + Intronic
1071555259 10:86596580-86596602 TACAGGCATGTGCCACCAACGGG - Intergenic
1071690399 10:87812536-87812558 TATAGGCGTGAGCCACCACATGG + Intronic
1072161546 10:92771526-92771548 TACAGGCGTGAGCCATCACCCGG + Intergenic
1072419751 10:95280232-95280254 TACAGGCACCTGCCACCACCTGG - Intronic
1072825083 10:98598638-98598660 TTCAGGCCTGTCCCAGCACCAGG - Intronic
1073582361 10:104680422-104680444 TCTAGGCGTGTGCCAGAAGCAGG + Intronic
1074074648 10:110111770-110111792 TACAGGCATGCGCCACCACCCGG - Intronic
1074187638 10:111110688-111110710 TACAGGCATGAGACTGCACCTGG + Intergenic
1074256448 10:111807331-111807353 TATAGGCATGAGCCACTGCCAGG + Intergenic
1074343852 10:112661256-112661278 TATAGGCACATACCATCACCTGG + Intronic
1075056953 10:119226120-119226142 TACAGGCATGAGCCAGCACCCGG + Intronic
1075096656 10:119475912-119475934 TATTGTCATGTGCAAACACCTGG - Intergenic
1075163621 10:120046274-120046296 TACAGGCGTGAGCCTGCACCTGG + Intergenic
1076971206 11:134393-134415 TCGAGGCATGTGCCACCACAAGG - Intergenic
1077603213 11:3588728-3588750 AAGAGGCATGAGCCAGAACCGGG + Intergenic
1077747514 11:4923799-4923821 AATAAGCATGAGCCAGCACATGG + Exonic
1078052595 11:7980014-7980036 TACAGGCATGAGCCACCGCCTGG + Intronic
1078198681 11:9159459-9159481 TACAGGCATGCACCACCACCTGG + Intronic
1079491234 11:20991123-20991145 TAGAGCCATGTGCCATCACAAGG + Intronic
1080947636 11:36992916-36992938 TACAGGCGTGAGCCACCACCCGG - Intergenic
1082080267 11:48007382-48007404 TACAGGCATGAGCCACCACACGG + Intronic
1082128389 11:48457538-48457560 TTGAGGCATGTGAGAGCACCTGG + Intergenic
1082637314 11:55612418-55612440 TATTAGCATGTGCCAGGAGCTGG + Intergenic
1083170770 11:60922943-60922965 TGTAGGCATGTGCCTGCAAGTGG + Exonic
1083570317 11:63757499-63757521 TACAGGCATGTGCCATGCCCTGG + Intronic
1084279164 11:68075658-68075680 TACAGGCATGAGCCACCGCCTGG - Intronic
1084293623 11:68194897-68194919 TATAGGCATAAGCCACCACCTGG - Intronic
1084309311 11:68307387-68307409 TATAGGTATGAGCCACCCCCCGG - Intergenic
1084409047 11:68995653-68995675 TACAGGCGTCTGCCACCACCTGG + Intergenic
1084895888 11:72267758-72267780 TACAGGCATTAGCCAGCACCTGG + Intergenic
1085651797 11:78274832-78274854 TATAAGCATCTGCCAGAAACAGG - Intronic
1086901341 11:92371439-92371461 TATAGGCATAAGCCACTACCTGG - Intronic
1087264212 11:96043019-96043041 TACAGGCATGAGCCACCACCCGG + Intronic
1089073904 11:115721710-115721732 TGCAGGCATGTGCAACCACCTGG + Intergenic
1089230862 11:116974529-116974551 TACAGGCATGTGCCACCATAGGG + Intronic
1089449126 11:118579394-118579416 TACAGGCATGAGCCACCGCCCGG - Intronic
1090028404 11:123186796-123186818 TACAGGCATGAGCCAGAGCCTGG + Intronic
1090270748 11:125384408-125384430 TACAGGCGTGAGCCACCACCCGG - Intronic
1090415450 11:126537186-126537208 TGTGTGCATGTGTCAGCACCAGG - Intronic
1090823534 11:130366654-130366676 TACAGGCACATGCCACCACCTGG - Intergenic
1091598256 12:1895770-1895792 TATAGCCATGTGCCACCACATGG + Intronic
1091836098 12:3586866-3586888 TATAGGCATGTGCCAAGAAGAGG - Intronic
1091927125 12:4361890-4361912 TACAGGCATGAGCCACCACCCGG + Intergenic
1092169198 12:6362818-6362840 TACAGGCTTGTGCCACCACATGG + Intronic
1092278174 12:7078352-7078374 TACAGGCATGTGCCACCACCTGG + Intergenic
1092668214 12:10830923-10830945 TACAGGCCTGAGCCCGCACCCGG + Intronic
1092819143 12:12336795-12336817 TATAGGCATGAGCTACCACATGG + Intronic
1093064633 12:14644206-14644228 TACAGGCATGAGCCATCACGGGG - Intronic
1094776381 12:33733101-33733123 TAAAGGCATTTGCCAGAGCCTGG - Intergenic
1095050485 12:37549813-37549835 TACAGGCTTGAGCCAGCGCCTGG - Intergenic
1095202815 12:39405074-39405096 TATATGCATGAGCCAGTGCCTGG - Intronic
1096125779 12:49118531-49118553 CAAAGGCATGTACCACCACCAGG + Intergenic
1096247714 12:50002744-50002766 TACAGGCATGAGCCATCGCCTGG - Intronic
1096820956 12:54233905-54233927 TGCAGGCGTGAGCCAGCACCCGG - Exonic
1097921055 12:65074540-65074562 TACAGGCATGAGCCAGCACCTGG - Intronic
1098452438 12:70635016-70635038 TATACACATGTGCAAGCTCCTGG - Intronic
1099483335 12:83196171-83196193 TACAGGCATGAGCCACCTCCCGG - Intergenic
1100080014 12:90837818-90837840 TTTAGGCATGAACCACCACCTGG - Intergenic
1101510504 12:105388602-105388624 TATAGGCATGAGCCACTGCCCGG + Intronic
1101528879 12:105556655-105556677 TACAGGCATGAGCCACCACGTGG + Intergenic
1102159641 12:110758080-110758102 TACAGGCGTGAGCCTGCACCTGG - Intergenic
1102570091 12:113822282-113822304 GAAGGGCCTGTGCCAGCACCAGG - Intronic
1102685667 12:114722669-114722691 TACAGGCATGAGCCACCACAGGG + Intergenic
1102882106 12:116493532-116493554 TATTGGCATGCGCCACCACTCGG + Intergenic
1102948440 12:117010998-117011020 TAGGGGCCTGTGCCAGCCCCGGG + Intronic
1103336808 12:120195787-120195809 TACAGGCATGTGCCACCACTCGG - Intergenic
1103645418 12:122388492-122388514 TACAGGCGTGAGCCACCACCCGG + Intronic
1103818209 12:123676001-123676023 TACAGGCATGAGCCACCACCTGG - Intronic
1107115532 13:36742101-36742123 TTGAGGCATGAGCCAGCCCCCGG + Intergenic
1107917165 13:45164455-45164477 TACAGGCATGAGCCACTACCTGG - Intronic
1109237731 13:59845184-59845206 TATAGGCATAAACCACCACCTGG + Intronic
1109440856 13:62370959-62370981 TATAGGCATGAGCCGCCACCTGG + Intergenic
1111057027 13:82964669-82964691 TACAGGCATGAGCCACCACCAGG - Intergenic
1112281639 13:98067997-98068019 TATAAGCATGAGCCACCGCCTGG - Intergenic
1112288024 13:98121242-98121264 TATAGGCATGAGCCACTGCCTGG - Intergenic
1112863308 13:103862207-103862229 TACAGGCATGCGCCACCACGCGG + Intergenic
1112976646 13:105327814-105327836 GAGAGGCATCAGCCAGCACCCGG - Intergenic
1113726950 13:112611657-112611679 TATAGGTGTGTGCCACCACAAGG - Intergenic
1114445572 14:22785450-22785472 TACAGGCGTGAGCCAGCGCCTGG - Intronic
1115211687 14:30972931-30972953 TACAGGCGTGAGCCCGCACCCGG - Intronic
1115251139 14:31349245-31349267 TACAGGCATGTGCCACCACCCGG - Intronic
1115269495 14:31536164-31536186 TACAGGCATGTGCCGTCACTGGG + Intronic
1115346924 14:32353116-32353138 TATAGGTAAGTGCCAGCCACTGG - Intronic
1115591152 14:34866345-34866367 TACAGGCATGTGCCACCACGTGG - Intronic
1116254617 14:42535527-42535549 TACAGGTGTGTGCCAACACCCGG - Intergenic
1117151165 14:52889851-52889873 TACAAGCATGAGCCAACACCTGG - Intronic
1117349656 14:54869012-54869034 TACAGGCATGCACCACCACCTGG + Intronic
1117400741 14:55356586-55356608 TACAGGCATGCGCCACCACGTGG + Intronic
1118834524 14:69467493-69467515 TACAGGCATGAGCCACCACACGG - Intergenic
1119067148 14:71540403-71540425 TACAGACATGAGCCACCACCAGG - Intronic
1119197858 14:72731023-72731045 TACAGGCATGTGCCACCATCTGG - Intronic
1119663933 14:76470826-76470848 TACAGGCATGTGCCAACATGTGG + Intronic
1121284394 14:92724005-92724027 TATAGGTGTGAGCCACCACCCGG + Intronic
1122156404 14:99753014-99753036 TATGGGCAAGTGGCTGCACCTGG + Intronic
1122727764 14:103770236-103770258 TACAGGCATGAGCTACCACCTGG - Intronic
1122825513 14:104368672-104368694 TGTGGAAATGTGCCAGCACCTGG + Intergenic
1122993894 14:105252197-105252219 TACAGGCATGAGACCGCACCTGG - Intronic
1124941357 15:34221472-34221494 TACAGGCATGAGCCCACACCTGG - Intergenic
1125545818 15:40503949-40503971 TACAGGCATGACCCACCACCCGG - Intergenic
1125549069 15:40530850-40530872 TATAGGCGTGCGCCACCACCCGG + Intronic
1125669826 15:41462894-41462916 TATAGGCGTGTGCCACCACCTGG + Intronic
1125819990 15:42621027-42621049 TATAGGGGTGAGCCACCACCTGG + Intronic
1125830771 15:42715781-42715803 TACAGGCATGAGCCACCGCCCGG + Intronic
1126317216 15:47383039-47383061 TACAGGCATGAGCCACCACCTGG + Intronic
1126319510 15:47407087-47407109 TACAGGCATGAGCCACCCCCCGG - Intronic
1127825248 15:62697246-62697268 TATAGGCATGTACCACCACTCGG + Intronic
1128818233 15:70629751-70629773 TGGAGTCATGTGCCAGGACCAGG - Intergenic
1129210063 15:74063252-74063274 TACAGGCACGTGCCACCACCAGG - Intergenic
1129403960 15:75302150-75302172 TACAGGCAAGTGCCACCACCAGG + Intergenic
1129476971 15:75792179-75792201 TACAGGCACGTGCCACCACCAGG + Intergenic
1129512203 15:76132652-76132674 TACAGGCATGCGCCACCACCTGG - Intronic
1129744925 15:78011787-78011809 TACAGGCATGTGCCACCGTCTGG + Intronic
1129775297 15:78232823-78232845 TACAGGCACGTACCACCACCTGG + Intronic
1129994277 15:79991161-79991183 TATGGGCAGGAGCCAGCAGCTGG - Intergenic
1130108891 15:80949081-80949103 TAGGGGCAGGTGGCAGCACCAGG - Exonic
1130528868 15:84730535-84730557 TACAGACATGTGCCACCACATGG + Intergenic
1130879775 15:88045029-88045051 GATGGGCAGGTGCCAACACCTGG - Intronic
1131085481 15:89572482-89572504 TACAGGCATGAGCCACCACCCGG - Intergenic
1131181993 15:90246645-90246667 TACAGGCATCTGCCACCACACGG - Intergenic
1132470273 16:98660-98682 TATAGGCATGAGCCAGTCCTTGG - Intronic
1132505312 16:305190-305212 TGTAGGCGTGAGCCACCACCTGG - Intronic
1132781754 16:1630425-1630447 TACAGGCACGAGCCACCACCTGG + Intronic
1132799492 16:1744618-1744640 TATGGGCAGGTCCCAGCTCCAGG - Intronic
1133097016 16:3454243-3454265 TACAGGCAAGTGCCATGACCTGG + Intronic
1133780618 16:8936241-8936263 GATACGCATGGGCCAACACCTGG + Intronic
1134438257 16:14281524-14281546 TACAGGCATGTGCCACCACGTGG - Intergenic
1134618265 16:15668538-15668560 TATAGGCATGAGCCACCACCTGG + Intronic
1135028502 16:19017542-19017564 TACAGGCATGAACCACCACCTGG - Intronic
1136015199 16:27393965-27393987 GACAGGCATGAGCCACCACCTGG - Intergenic
1136489773 16:30599417-30599439 TACAGGTGTGTGCCACCACCTGG + Intergenic
1136491026 16:30608555-30608577 TACAGGCATGAGCCACCAGCCGG + Intronic
1136704387 16:32173985-32174007 TACAGGCATGAGCCACCGCCTGG + Intergenic
1136763525 16:32755421-32755443 TACAGGCATGAGCCACCGCCTGG - Intergenic
1136804575 16:33114965-33114987 TACAGGCATGAGCCACCGCCTGG + Intergenic
1137235906 16:46617900-46617922 TATAGGCATGAGCCACTGCCTGG - Intronic
1137434565 16:48445057-48445079 TATAGGGACCTGCCAGCTCCTGG - Intronic
1138380239 16:56595707-56595729 TACAGGCATGTACCACCACCTGG - Intergenic
1138566499 16:57837190-57837212 TATAGGCAAGAGCCACCACCTGG - Intronic
1138634645 16:58328020-58328042 TAAAGGCGTGTGCCACCACCTGG - Intronic
1139441224 16:66968441-66968463 TACAGGCATGAGGCTGCACCCGG + Intronic
1139587420 16:67913042-67913064 TACAGGCATGTGCCCACACCTGG - Intronic
1139646358 16:68333911-68333933 TACAGGCATGCACCACCACCTGG + Intronic
1139750075 16:69104569-69104591 TACAGGCGTGAGCCTGCACCCGG + Intergenic
1140051596 16:71486223-71486245 TACAGGCGTGTGCCCACACCTGG - Intronic
1140184215 16:72752244-72752266 TACAGGCGTGAGCCACCACCTGG + Intergenic
1140200150 16:72888472-72888494 CAAAGGCATTTGGCAGCACCAGG + Intronic
1140241080 16:73201248-73201270 TATTGGCATGTGGTAGCCCCTGG - Intergenic
1141321546 16:83014588-83014610 TACAGGCATGGGCCACCACTCGG - Intronic
1203065674 16_KI270728v1_random:1015742-1015764 TACAGGCATGAGCCACCGCCTGG - Intergenic
1142458444 17:72160-72182 TCGAGGCATGTGCCACCACAAGG - Intergenic
1142587568 17:983233-983255 TACAGGCATGAGCCACCACCCGG + Intergenic
1142729281 17:1840559-1840581 TACAGGCGTGAGCCACCACCTGG + Intronic
1143657501 17:8304395-8304417 TACAGGCATGCGCCACCGCCAGG + Intergenic
1143704317 17:8686636-8686658 TACAGGTATGAGCCACCACCCGG + Intergenic
1143853024 17:9827010-9827032 TACAGGTACGTGCCACCACCCGG + Intronic
1144184081 17:12779807-12779829 TACAGGCATGAGCCACCGCCCGG + Intergenic
1144649356 17:16997700-16997722 CATAGGGAGGTGCCAGCGCCTGG - Intergenic
1144697198 17:17312992-17313014 TACAGGTGTGAGCCAGCACCCGG - Intronic
1145305539 17:21672603-21672625 TACAGGCATGAGCCAGAGCCTGG + Intergenic
1145371120 17:22306912-22306934 TACAGGCATGAGCCAGCGCCTGG - Intergenic
1145742585 17:27288018-27288040 TACAGGCATGAGCCACCACTTGG + Intergenic
1146048023 17:29526554-29526576 TACAGGCATGCACCACCACCTGG + Intronic
1146606573 17:34263583-34263605 TACAGGCACGCGCCACCACCCGG + Intergenic
1146851390 17:36224848-36224870 TATAGGCATAAGCCACCACCTGG - Intronic
1146867300 17:36348721-36348743 TATAGGCATAAGCCACCACCTGG - Intronic
1147070177 17:37949332-37949354 TATAGGCATAAGCCACCACCTGG - Intergenic
1147081698 17:38028858-38028880 TATAGGCATAAGCCACCACCTGG - Intronic
1147097649 17:38152828-38152850 TATAGGCATAAGCCACCACCTGG - Intergenic
1147212911 17:38882521-38882543 TATAGGCATGAGCCACTGCCCGG + Intronic
1147610435 17:41798885-41798907 TATAGGAATGAGCCACCACCAGG - Intergenic
1147737965 17:42653049-42653071 TACAGGCATGTGCCACCACCCGG + Intergenic
1148838303 17:50478259-50478281 TAAGGGCATGAGCCACCACCAGG - Intergenic
1149276048 17:55038636-55038658 TATAACCTTGTGCCAGCAGCAGG - Intronic
1149287783 17:55185144-55185166 TACAGGCATGAACCACCACCTGG + Intergenic
1149789395 17:59464017-59464039 TACAGGCATGCGCCACCACCTGG - Intergenic
1150060935 17:62067770-62067792 TATAACCGAGTGCCAGCACCAGG + Intergenic
1150345358 17:64400398-64400420 TATAGGCATGTGCCACCGCCCGG - Intronic
1150441143 17:65192471-65192493 CACGGGCATGTGCCACCACCTGG - Intronic
1150777068 17:68089723-68089745 TACAGGCATGCGCCGCCACCTGG + Intergenic
1151515660 17:74593546-74593568 TACAGGCGTGTGCCACCACCTGG - Exonic
1151520937 17:74629063-74629085 TACAGGCGTGTGCTACCACCAGG - Intergenic
1151806982 17:76411824-76411846 TACAGGCACATGCCACCACCCGG + Intronic
1152175701 17:78785800-78785822 TACAGGCATGAGCCTGCTCCTGG + Intergenic
1152687067 17:81699797-81699819 TATAGGCGTGAGCCACCGCCCGG - Intronic
1153943547 18:9997643-9997665 TCTAGGCCTGTCCCAGCACCAGG + Intergenic
1154228824 18:12534832-12534854 TACAGGCATGAGCCTGCACCTGG + Intronic
1154307458 18:13241068-13241090 TACAGGCATGTGCCACTACCCGG + Intronic
1155323624 18:24644082-24644104 TACAGGCATGTGCCACCATGCGG + Intergenic
1155671649 18:28378718-28378740 GATGGTTATGTGCCAGCACCTGG - Intergenic
1156298578 18:35815621-35815643 TATAAGCATGTGACCACACCAGG + Intergenic
1158356772 18:56629921-56629943 TACAGGCATGAGCCATCATCGGG - Intronic
1158999430 18:62958062-62958084 TACAGGCTTGCGCCACCACCTGG + Intronic
1159863463 18:73676117-73676139 TAGATGCATGTACCACCACCTGG - Intergenic
1160169703 18:76543097-76543119 TATAGGCGTGAGCCCGCACCTGG - Intergenic
1160203381 18:76813463-76813485 TACAGGCATGAGCCAACATCCGG + Intronic
1160404274 18:78634459-78634481 TCTAGGCATGTGGAGGCACCAGG - Intergenic
1160803503 19:980901-980923 TACAGGCATGAGCCACCGCCTGG - Intergenic
1161289638 19:3486247-3486269 TACAGACATGAGCCACCACCTGG - Intergenic
1161624960 19:5320984-5321006 TACAGGCATGAGCCAGCACCGGG - Intronic
1161714876 19:5869926-5869948 TATAGGCATGTGCCAGCACCTGG - Intronic
1161852889 19:6746916-6746938 TATAGGCATGAGCCACTGCCCGG + Intronic
1162024353 19:7885178-7885200 TACAGGCATGCGCCACCACTCGG - Intergenic
1162047126 19:8007451-8007473 TACAGGCATGAGCCACCACCCGG + Intronic
1162048958 19:8020636-8020658 TACAGGCATGTGCCACCATGCGG + Intronic
1162289174 19:9765791-9765813 TACAGGCATGAGCCACCCCCTGG - Intronic
1162447479 19:10732323-10732345 TACAGGCATGAGCCACCGCCCGG - Intronic
1162664357 19:12197005-12197027 TACAGGCATGTGCCTCCACACGG + Intergenic
1162692132 19:12441519-12441541 TACAGGCACGCGCCACCACCCGG + Intronic
1162974394 19:14200190-14200212 TATAGGCACGGTCCAGCCCCAGG - Intronic
1163072285 19:14854281-14854303 TACAGGCATGTGCCACCATGCGG + Intergenic
1163335190 19:16666677-16666699 TATAGGCATGAGCCACCGCAGGG - Intronic
1163414342 19:17176877-17176899 CCCAAGCATGTGCCAGCACCAGG + Intronic
1164698720 19:30266323-30266345 TATAGGCATGAGTCACCACCTGG + Intronic
1164836691 19:31359564-31359586 TACAGGCATGAGCCACCACAGGG - Intergenic
1164889188 19:31808445-31808467 TATGGGCAGATTCCAGCACCAGG + Intergenic
1165182078 19:33980002-33980024 TACAGGCATGAGCCACCGCCTGG - Intergenic
1165706699 19:37981281-37981303 TACAGTCACGTGCCACCACCTGG - Intronic
1166084965 19:40468353-40468375 TATAGGCGTGAGCCACCGCCTGG + Intronic
1166129348 19:40736778-40736800 TATAGGCATGATCCCACACCTGG + Intronic
1166352363 19:42205805-42205827 TACAGGCATGAGCCACCGCCTGG - Intronic
1167905620 19:52658267-52658289 TACAGGCATGAGCCAGAACCTGG - Intronic
1168045331 19:53790221-53790243 TATAGGCGTGAGCCACCACGTGG + Intergenic
1168055030 19:53858691-53858713 TATAGGCATGAGCCAGGTCGTGG - Intergenic
1168607327 19:57770295-57770317 TACAGGCATGCGCCACCACGGGG + Intronic
1168697630 19:58413774-58413796 TACAGGCGTGAGCCACCACCCGG + Intronic
925570279 2:5303172-5303194 TACAGGCATGTGCCACCACCAGG - Intergenic
926704835 2:15829651-15829673 TATAGGCATGAGCCACCACCAGG - Intergenic
927170250 2:20363243-20363265 TACAGGCATGAGCCACCCCCGGG - Intergenic
927661721 2:24998923-24998945 TACAGGCACCTGCCACCACCTGG - Intergenic
927808179 2:26166605-26166627 TATAGGCAGGTACCACCACCTGG + Intergenic
927977298 2:27348526-27348548 TACAGGCATGAGCCTGTACCTGG - Intronic
928582579 2:32723938-32723960 TAAAGGCATGAGCCACCAGCTGG + Intronic
928755177 2:34515955-34515977 TTTAGGCATGTACCAGTGCCAGG - Intergenic
929107918 2:38381972-38381994 TATTGCCATGTGCCAGCACTAGG - Intergenic
929157364 2:38800042-38800064 TACAGGCATACGCCACCACCCGG - Intronic
929214621 2:39398765-39398787 TATAGGCATGAGCCAATGCCTGG - Intronic
929741295 2:44603364-44603386 TACAGGCATGAGCCACCAACTGG + Intronic
930702580 2:54473860-54473882 TATAAGCTTGTGCCAGTACAAGG - Intronic
930809416 2:55525174-55525196 TATAGGCATGAGCCACTTCCTGG - Intronic
931017400 2:57999865-57999887 TATAGGCATGAGCCACTAACTGG - Intronic
931803031 2:65777321-65777343 TACAGGCGTGTGCTACCACCTGG + Intergenic
932668313 2:73715670-73715692 TACAGGCATGTGCCACCACCCGG + Intergenic
933263161 2:80152272-80152294 TATAGGCTTGTGGCAGATCCCGG + Intronic
935286073 2:101564693-101564715 TAAAGGCCTCTGCCAGCTCCTGG + Intergenic
936711966 2:115142047-115142069 CAGAGGCATGAGCCAGCACGTGG + Intronic
938829606 2:135037271-135037293 TACAGGCGTGAGCCATCACCTGG + Intronic
940889790 2:159024166-159024188 TATAGTCATGTGCCACAACATGG + Intronic
941321667 2:164063257-164063279 TACAGGCATGTGCCACCACACGG + Intergenic
941822710 2:169858456-169858478 TGTAGGTATGTGCCACCACACGG + Intronic
942267022 2:174238351-174238373 TATAGGCATGCGCCACCACCAGG - Intronic
943431561 2:187809268-187809290 TACAGGCATGAGTCTGCACCTGG - Intergenic
944260246 2:197668550-197668572 CAGAGGCATGTACCTGCACCTGG + Intronic
945303990 2:208241363-208241385 TATAGGCATGCGACCACACCTGG + Intronic
945324426 2:208465676-208465698 TATAGGCATGAGCCACCGCAGGG + Intronic
946446998 2:219748379-219748401 TATAGGCATGAGCCACTGCCTGG + Intergenic
946997219 2:225407561-225407583 TATAGTCATGTTCCAAAACCTGG - Intronic
947688154 2:232109168-232109190 TACAGGCATGAGCCACCGCCTGG - Intronic
947782965 2:232786510-232786532 TATAGGCGTGAGCCACCACGCGG + Intronic
948110734 2:235453556-235453578 TTTAGACATATGGCAGCACCAGG - Intergenic
1169184458 20:3602686-3602708 TACAGGCATGAGCCACCGCCCGG - Intronic
1169379245 20:5092573-5092595 TACAGGCATGTGCCACCACCTGG - Intronic
1170587025 20:17742553-17742575 TATAGGCATGAGCCGTCACCCGG - Intergenic
1170777165 20:19385910-19385932 TACAGGCATGAGCCACCACCTGG + Intronic
1171523054 20:25790092-25790114 TACAGGCATGAGCCAGAGCCTGG + Intronic
1171530792 20:25852069-25852091 TACAGGCATGAGCCAGAGCCTGG + Intronic
1171544998 20:25993330-25993352 TACAGGCATGATCCAGCACCTGG - Intergenic
1171553773 20:26065791-26065813 TACAGGCATGAGCCAGAGCCTGG - Intergenic
1171967193 20:31539518-31539540 TACAGGCATGAGCCACCACCTGG - Intronic
1172289457 20:33765653-33765675 TATAGGAATGAGCCATCACACGG + Intronic
1172723923 20:37021716-37021738 TACAGGCATGAGCCTGCGCCCGG + Intronic
1173791689 20:45832167-45832189 TACAGGCATGTGCCACCATGCGG - Intronic
1173808150 20:45939432-45939454 TATCTGCAGGTGCCAGCACAGGG - Intronic
1175829460 20:61954090-61954112 TACAGGCATGCACCACCACCTGG - Intronic
1178444318 21:32624750-32624772 TATAGGCGTGAGCCACCACCTGG + Intergenic
1178813632 21:35907207-35907229 TATAGGCATGAGCCACTGCCTGG - Intronic
1178879059 21:36434177-36434199 TACAGGCATGAGCCACCACCCGG + Intergenic
1179207174 21:39292226-39292248 TATAGGCATGAGCCATCGCTAGG + Intronic
1180682778 22:17639993-17640015 TACAGGCATGCGCCACCACGCGG + Intronic
1180729401 22:17970310-17970332 TCTAAGCATGGGCCAGCAGCTGG - Intronic
1181160265 22:20956074-20956096 TACAGGCATGAGCCACCACCTGG + Intergenic
1181949838 22:26545934-26545956 TATAGGCAGGTACCATCACCTGG - Intronic
1182307789 22:29383106-29383128 TATCAGCATAGGCCAGCACCAGG + Intronic
1182375708 22:29846190-29846212 TAGAGGCATGAGCCACTACCTGG - Intergenic
1183662950 22:39232129-39232151 AATAGTCATGTGCCAGCAGAGGG - Intronic
1184042109 22:41950420-41950442 TACAGGCGTGAGCCACCACCTGG - Intergenic
1184566648 22:45296016-45296038 TACAGGCATGTGCCACTGCCTGG - Intergenic
1185367322 22:50442688-50442710 TACAGGCATCCGCCACCACCAGG + Intronic
1185396195 22:50590833-50590855 TACAGGTGTGTGCCACCACCTGG + Intronic
949188937 3:1227917-1227939 TATTGGCATGTACCAGTGCCTGG + Exonic
949410462 3:3757746-3757768 TACAGGCATGAGCCACCACGTGG + Intronic
950029300 3:9841611-9841633 TATAGGCATGAGCCACCACGCGG + Intronic
951245183 3:20332272-20332294 TACAGGCATGAGCCACCGCCTGG + Intergenic
953043960 3:39279015-39279037 TATAGGCATGTACCACCGCCCGG - Intronic
955376367 3:58400633-58400655 TATAGGCATGAGCCACTGCCCGG - Intronic
955742959 3:62111722-62111744 TATAGGCGTGAGCCACCACCGGG + Intronic
957281551 3:78156405-78156427 TATAGGCGTGAGCCCGTACCCGG - Intergenic
958734709 3:97995117-97995139 TACAGGCATGCACCACCACCTGG + Intronic
959383569 3:105673342-105673364 TACAGGCATGAGCCTGTACCTGG + Intronic
959527319 3:107391602-107391624 TACAGGCATGAGCCACCACCAGG + Intergenic
960134387 3:114090892-114090914 TATAGGCATGAGCCAGCGCACGG - Intergenic
960727728 3:120687421-120687443 TATAGGCGTGAGCCAGCACCTGG + Exonic
961642330 3:128372405-128372427 TAAATACATGTGCCAGCAGCAGG + Intronic
962584320 3:136826310-136826332 TACAGGCATGAGCCACCACGAGG + Intronic
963005973 3:140726519-140726541 TATAGACATGAGCCAGAACTGGG + Intergenic
963238111 3:142975122-142975144 TACAGGCAAGTGCCACCACCTGG - Intronic
965030475 3:163359170-163359192 TACAGGCACGTGCCACCACCTGG - Intergenic
965295715 3:166943128-166943150 TACAGGCATGCGCCACCAGCAGG - Intergenic
965527662 3:169738773-169738795 TACAGGCGTGAGCCACCACCTGG + Intergenic
965558002 3:170037600-170037622 TACAGGCATGAGCCACCGCCTGG + Intergenic
965952812 3:174331447-174331469 TACAGGCACATGCCACCACCTGG + Intergenic
965996775 3:174892779-174892801 TACAGGCACATGCCACCACCTGG - Intronic
966088764 3:176104480-176104502 TACAGGCACGTGCCACCACGCGG + Intergenic
966568240 3:181408009-181408031 TACAGGCATGAGCCACCGCCAGG - Intergenic
966893547 3:184425834-184425856 TACAGGCACGTGCCACCACACGG + Intronic
968748805 4:2375498-2375520 AGTGGGCATGAGCCAGCACCTGG - Intronic
968841408 4:3009145-3009167 TATAGGCGTGAGCCACCACCCGG - Intronic
969057495 4:4410996-4411018 TATAGGTGTGCGCCACCACCCGG + Intronic
969381895 4:6806457-6806479 TACAGGCATGAGCCACCGCCAGG - Intronic
971421809 4:26480782-26480804 TACAGGCATGTGCTACCATCTGG - Intergenic
971688860 4:29806668-29806690 AATAGGCATGTAGCAACACCAGG - Intergenic
972045779 4:34663619-34663641 TTTAGGCCTATGCCAGCACCAGG - Intergenic
972454463 4:39239896-39239918 TACAGGCATGAGCCACCACTGGG - Intronic
973220047 4:47715462-47715484 TACAGGCATCTGCCACCACACGG - Intronic
973325029 4:48851531-48851553 TACAGGCATGCGCCACCACTTGG - Intronic
974073282 4:57145254-57145276 TATAGGCATGCACCACCACATGG + Intergenic
975542438 4:75528771-75528793 TACAGGTATGAGCCACCACCCGG - Exonic
977924146 4:102681024-102681046 TATAGGCATGAGCCACTGCCTGG - Intronic
978515493 4:109564270-109564292 TACAGGCATGTGCCACCATGGGG + Intronic
979258399 4:118627419-118627441 TAGAGGTATGTGCCACCACAAGG + Intergenic
979329952 4:119413140-119413162 TAGAGGTATGTGCCACCACAAGG - Intergenic
980041466 4:127945456-127945478 TACAGGCATGTGCCACCACGTGG + Intronic
980812182 4:137896212-137896234 TACAGGCATGAGCCATCACGCGG - Intergenic
980886061 4:138763974-138763996 AAGAGGCATGTCCCAGCACAGGG + Intergenic
981542236 4:145858198-145858220 TATAGGCATGTACCATTGCCAGG - Intronic
982010052 4:151097882-151097904 TACAGGCATGAGCCACCACCTGG + Intergenic
982528620 4:156509694-156509716 TACAGGCATGTGCCACCACACGG - Intergenic
982671321 4:158323414-158323436 TATAGGCATATGCCACCACGCGG + Intronic
983083710 4:163417773-163417795 TACAGGCATGTGACCACACCTGG - Intergenic
983114972 4:163803446-163803468 TATAGGCATGAGCCACTGCCCGG + Intronic
983670932 4:170237088-170237110 TATAGGCACGTGCCACCACCCGG - Intergenic
983813694 4:172096368-172096390 TATAGGCATGAGCCACTGCCGGG + Intronic
983894484 4:173067738-173067760 TACAGACATTTGCCAGCACCAGG - Intergenic
986433647 5:7706429-7706451 TGCAGACATGTGCCAGCACATGG + Intronic
987368194 5:17168886-17168908 TATAGGTGTGAGCCTGCACCTGG + Intronic
988307320 5:29509348-29509370 GAGAGGCATGTGCCAACTCCGGG - Intergenic
988758207 5:34282768-34282790 TACAGGCGTGAGCCACCACCCGG + Intergenic
989180076 5:38567802-38567824 TATAGGCATGAGCCACCACCTGG + Intronic
989657328 5:43759046-43759068 TATAGGCATGAGCCAGTGCCCGG + Intergenic
992635876 5:78725690-78725712 TATAGGCACGTGCCGTCACACGG + Intronic
992906782 5:81354965-81354987 TATAGGCATAAGCCACCGCCAGG + Intronic
997338142 5:133122162-133122184 TTTAGGCCTGCGGCAGCACCAGG + Intergenic
997543339 5:134683161-134683183 TATAGGCGCGAGCCAACACCTGG + Intronic
998282534 5:140825563-140825585 TACAGGCATGTGCCCACACCTGG + Intronic
998948087 5:147362804-147362826 TACAGGCATGAGCCAGTGCCTGG - Intronic
999188799 5:149731475-149731497 CCCAGGCGTGTGCCAGCACCCGG - Intronic
999199273 5:149804529-149804551 TACAGGCATGCTCCACCACCTGG - Intronic
999457617 5:151730844-151730866 TACAGGCAGGTGCCACCACCTGG + Intergenic
999481058 5:151948564-151948586 TGTAGTCATGGGCCACCACCAGG - Intergenic
1000298580 5:159934523-159934545 TATAGGAGTGAGCCACCACCTGG - Intronic
1000771252 5:165357837-165357859 TACAGGCGTGTGCTACCACCCGG + Intergenic
1000791250 5:165609971-165609993 TATAGGCATGAGCCACCGCACGG + Intergenic
1000924785 5:167180248-167180270 TACAGGCATGTGCCACCACACGG + Intergenic
1001387349 5:171350790-171350812 TACAGGCGTGAGCCACCACCTGG + Intergenic
1001502165 5:172245569-172245591 TACAGGCATGCGCCACCACGTGG - Intronic
1002498334 5:179631334-179631356 TATAGGCATGAGCCACCACACGG - Intronic
1002728965 5:181321027-181321049 TCGAGGCATGTGCCACCACAAGG + Intergenic
1003334193 6:5155220-5155242 TACAGGCATGCGCCACCGCCTGG + Intronic
1004411939 6:15389298-15389320 TATAGGCACGTGTCACCGCCTGG + Intronic
1004834104 6:19511495-19511517 TGTTTGCATGTGCCAGCAGCAGG + Intergenic
1005045998 6:21643080-21643102 TATAGGCATGAGCCACCGCCTGG - Intergenic
1005384799 6:25275253-25275275 TATAGGTGTGTGCCACCACATGG - Intergenic
1005620475 6:27615320-27615342 TACAGGCATGAGCCACCACCCGG + Intergenic
1005645480 6:27833865-27833887 TACAGGCATGTGACACCACCTGG - Intergenic
1006401935 6:33822769-33822791 CACAGGGATGTGCCAGCGCCGGG - Intergenic
1006625077 6:35392131-35392153 CATGGGCCAGTGCCAGCACCAGG + Intronic
1006651638 6:35556571-35556593 TATAGGCATATGCCACCACACGG + Intergenic
1006686521 6:35839289-35839311 TACAGGCCTGAGCCACCACCTGG + Intronic
1006891766 6:37434749-37434771 TACAGGCATGTGCCACCACCCGG + Intronic
1007549340 6:42717080-42717102 TACAAGCATGAGCCCGCACCTGG + Intronic
1007643481 6:43362645-43362667 TACAGGCATGCGCCACCACTGGG + Intronic
1007781115 6:44255350-44255372 TAGAGGCCTTGGCCAGCACCTGG + Exonic
1007850961 6:44802421-44802443 TATAGGTGTGAGCCTGCACCTGG + Intergenic
1008330162 6:50235743-50235765 TACAGGCATGTGCCACCACACGG - Intergenic
1011255249 6:85414135-85414157 TATAGGCATGCGCCACCACCAGG + Intergenic
1011495415 6:87932527-87932549 GATAGGCAGCTGCAAGCACCTGG - Intergenic
1013061206 6:106635728-106635750 TACAGGCGTGTGCCACCACCTGG - Intronic
1013083800 6:106837611-106837633 TGCAGGCATGTACCACCACCTGG + Intergenic
1013129013 6:107213614-107213636 TACAGGCACCTGCCACCACCCGG - Intronic
1013298220 6:108779184-108779206 TACAGGCGTGAGCCACCACCTGG - Intergenic
1013398960 6:109772595-109772617 TACAAGCATGTGCCACCACCTGG + Intronic
1014043445 6:116855728-116855750 TACAGGCATGAGCCACCACACGG - Intergenic
1014287181 6:119513812-119513834 TAGAGTCATGTGCCACCACACGG - Intergenic
1015098633 6:129448142-129448164 TATAGGCATGTACCATGCCCAGG - Intronic
1015838682 6:137451833-137451855 TACAGGCATATGCCACCGCCTGG + Intergenic
1017345258 6:153372146-153372168 TATAGGCATGAGCCACCACCTGG - Intergenic
1017385595 6:153879141-153879163 AATAGGCAGGTGCCACCCCCAGG + Intergenic
1017713938 6:157194842-157194864 TACAGGCATGAGTCATCACCTGG - Intronic
1018249323 6:161852310-161852332 TATAGGCTTGCACCACCACCTGG - Intronic
1018273505 6:162105540-162105562 TACAGGCGTGTGCCACCACCTGG + Intronic
1019004012 6:168781034-168781056 TACAGGCATGAGCCACCAACTGG + Intergenic
1020202930 7:6094312-6094334 TACAGGCATGCACCAGCACCTGG + Intergenic
1020619317 7:10498691-10498713 TACAGGCATGAGCCAGCGCCGGG - Intergenic
1021075338 7:16297405-16297427 TATAAGCATGTGTCAGGAGCAGG + Intronic
1021705473 7:23363520-23363542 TACAGGCGTGACCCAGCACCTGG + Intronic
1023060208 7:36319468-36319490 TATAGGCGCATGCCACCACCCGG + Intergenic
1023400379 7:39788727-39788749 TAGAGGTATGTGCCACCACAAGG + Intergenic
1023872665 7:44271192-44271214 TACAGGCATGAGCCACCATCTGG + Intronic
1023922734 7:44642138-44642160 TATAGGCATGAGCCACCATCTGG - Intronic
1024073312 7:45804477-45804499 TAGAGGTATGTGCCATCACAAGG + Intergenic
1024386210 7:48754759-48754781 TATCGCCATGTGACAGCACATGG + Intergenic
1024650020 7:51395709-51395731 TAGAGGTATGTGCCACCACAAGG - Intergenic
1025051151 7:55736102-55736124 TATAGGCATGAGCCACCACTAGG + Intergenic
1025054166 7:55751376-55751398 TAGAGGTATGTGCCACCACAAGG - Intergenic
1025132217 7:56381537-56381559 TAGAGGTATGTGCCACCACAAGG - Intergenic
1025283489 7:57645012-57645034 TACAGGCATGAGCCAGAGCCTGG + Intergenic
1025296406 7:57778395-57778417 TACAGGCGTGAGCCAGCACCTGG - Intergenic
1025946021 7:66105212-66105234 TATAGGCACGTGCCAACAACCGG - Intronic
1026066359 7:67076913-67076935 TACAGGCTCGTGCCACCACCTGG + Intronic
1026182428 7:68053752-68053774 TGTATGCATGTGCTAGCACATGG - Intergenic
1026196513 7:68178131-68178153 TATAGGTGTGTGCCACCACATGG + Intergenic
1027364869 7:77446922-77446944 TACAGGCATGAGCCACCGCCTGG + Intergenic
1027762873 7:82302033-82302055 TATAGGCATGAGCCACCGCCTGG + Intronic
1028490265 7:91403683-91403705 TATAGACAGGTGCCAGCATGTGG + Intergenic
1028707700 7:93869692-93869714 TACAGGCTTGAGCCAGCGCCTGG + Intronic
1029422808 7:100479743-100479765 TACAGGCATGAGCCACCACCGGG - Intergenic
1029479560 7:100804274-100804296 TACAGGCGTGAGCCACCACCTGG + Intronic
1030142169 7:106316272-106316294 TACAGGCATGAGCCACCACCTGG - Intergenic
1031593961 7:123626329-123626351 TGCAGGCATGTGCCACCACAGGG - Intronic
1031611788 7:123836751-123836773 TACAGGCATGAGCCACCACCTGG - Intronic
1032050702 7:128648168-128648190 TCGAGGCATGTGCCACCACAAGG + Intergenic
1032052815 7:128659450-128659472 TATAGGTATGAGCCACCACTAGG - Intergenic
1032145342 7:129374664-129374686 TACAGGCATGTGCCACCACGCGG - Intronic
1032748129 7:134808381-134808403 TACAGGCATGAGCCACCACCTGG + Intronic
1034173884 7:149085315-149085337 TACAGGTATGAGCCAGTACCTGG - Intronic
1034592237 7:152151302-152151324 TATACGCTGGTGCCATCACCAGG + Intronic
1034631716 7:152536174-152536196 TACAGGCGTGAGCCACCACCCGG - Intergenic
1035245491 7:157559994-157560016 GATGGGCTGGTGCCAGCACCCGG + Intronic
1036751714 8:11447654-11447676 CACAGGCAGGTGCCAGCAGCTGG + Intronic
1036932309 8:12968158-12968180 TACAGACATGAGCCACCACCTGG + Intronic
1037099381 8:15024659-15024681 TACAGGCTTGAGCCACCACCCGG - Intronic
1037912156 8:22749945-22749967 TACAGGCATGTGCCACCATGTGG + Intronic
1037993210 8:23335336-23335358 TATAGGCATGCGTCAGTGCCTGG + Intronic
1038634853 8:29277508-29277530 TACAGGCATGAGCCACCACCTGG + Intergenic
1038942951 8:32325652-32325674 TATAGGCATGTGCCCACACCTGG + Intronic
1039016657 8:33156989-33157011 CACAGGCATGTGCCACCACCTGG - Intergenic
1039042910 8:33425058-33425080 TACAGGTGTGAGCCAGCACCCGG - Intronic
1039495484 8:37976929-37976951 TCTTGGTATGTTCCAGCACCTGG - Intergenic
1040593277 8:48815753-48815775 TACAGGCACGTGCCACCACGTGG - Intergenic
1042180278 8:66080587-66080609 CATAGGCCTGAGCAAGCACCAGG + Intronic
1042246561 8:66713841-66713863 TTTAGGCATGTTTTAGCACCGGG + Intronic
1042386174 8:68177422-68177444 TATAGGCATGTGCCCCCATGGGG - Intronic
1042395267 8:68284976-68284998 TACAAGCATGTGCCACCACGCGG - Intergenic
1042437986 8:68790122-68790144 TGTATACATGTCCCAGCACCTGG - Intronic
1042511404 8:69616358-69616380 TATAGGCATGCGCCGCCACCTGG + Intronic
1042974014 8:74444262-74444284 AATAGCCATGTGTCAGCAGCAGG - Intronic
1043097191 8:75990099-75990121 TACAGGCATGAGCCACCACCTGG - Intergenic
1043443777 8:80299845-80299867 TACAGGCATGAGCCTGCGCCCGG + Intergenic
1044992426 8:97807961-97807983 TATAGGTATGTGCCATCACATGG + Intronic
1045225865 8:100245046-100245068 TACAGGCACCTGCCACCACCCGG + Intronic
1045530744 8:102982996-102983018 TACAGGCATGTACCACCATCTGG - Intergenic
1047323068 8:123807366-123807388 TACAGGCATGAGCCTGTACCTGG - Intronic
1047412950 8:124639059-124639081 TACAGGCATGAGCCACCACCTGG - Intronic
1048960729 8:139574629-139574651 CATAGGGAGGTGCCATCACCAGG - Intergenic
1050110203 9:2207612-2207634 TACAGGCATGCGCCACCACATGG + Intergenic
1050536081 9:6631923-6631945 TACAGGCATGTGCTACCACATGG - Intronic
1050760749 9:9067100-9067122 TACAGTCATGTGCCACCACGAGG - Intronic
1050767295 9:9150747-9150769 TACAGGCATGAGCCAACAACCGG + Intronic
1051274811 9:15388496-15388518 TACAGGCATGTGCCATTGCCTGG - Intergenic
1051290535 9:15541085-15541107 TACAGGCATGTGCTAGCATGCGG + Intergenic
1051463313 9:17348669-17348691 TATAGGCATGCGTCACCACGCGG + Intronic
1051679047 9:19588683-19588705 TACAGGCATGAGCCACCACGCGG - Intronic
1052814694 9:33092433-33092455 TATAGGCATGAGCCACCTCGTGG + Intergenic
1052828596 9:33196343-33196365 TACAGGCGTGAGCCAACACCTGG - Intergenic
1052905314 9:33828527-33828549 TACAGGCATGTGCCACCACCGGG + Intronic
1053292949 9:36894082-36894104 TATAGGCATGTACCAAAACCAGG - Intronic
1055036423 9:71823148-71823170 TATAGGCAAGAGTCACCACCTGG + Intergenic
1055067781 9:72135884-72135906 TACAGGCATGAGCCACCACGCGG + Intronic
1055092978 9:72381352-72381374 TACAGGCATGTACCACCACATGG - Intergenic
1055569224 9:77599620-77599642 GATAAGCATATGCCAGCCCCGGG + Intronic
1055771766 9:79724563-79724585 TACAGGCATGAGCCACCACGTGG - Intronic
1055990844 9:82103697-82103719 TATAGTCATCTTTCAGCACCTGG + Intergenic
1056132858 9:83602777-83602799 TTTAGAGATGGGCCAGCACCAGG + Intergenic
1056407603 9:86290564-86290586 TACAGGCATGAGCCACCGCCTGG - Intronic
1057210322 9:93197796-93197818 TATAGGCATGAGCCACTGCCCGG + Intronic
1057340306 9:94195234-94195256 TACAGGCATGAGCCACCACATGG - Intergenic
1057474520 9:95387348-95387370 TATAGGTGTGTGCCACCACTCGG + Intergenic
1057532905 9:95869796-95869818 TATAGGCATGAGCCAGTGTCCGG + Intergenic
1058099886 9:100907391-100907413 TATAGGCATGAGCCACTGCCAGG + Intergenic
1058378000 9:104347140-104347162 TACAGGCATGAGCCACCGCCCGG - Intergenic
1058587865 9:106530007-106530029 TACAGGTGTGTGCCACCACCAGG - Intergenic
1059181205 9:112214261-112214283 TACAGGCATGAGCCACCACCTGG - Intergenic
1059244527 9:112838163-112838185 TACAGGTATGAGCCACCACCAGG + Intronic
1059684267 9:116619662-116619684 TACAGGCATGTGCCACCACACGG + Intronic
1059834521 9:118136173-118136195 TTCAGGTATATGCCAGCACCAGG + Intergenic
1060296307 9:122345783-122345805 TACAGGCATTAGCCACCACCTGG - Intergenic
1060670548 9:125465777-125465799 TAGAGGCATGTGCAAACTCCTGG + Intronic
1060730895 9:126036355-126036377 TACAGGCATGAGCCCGCACCTGG - Intergenic
1061056969 9:128228448-128228470 TATAGGCATGAGCCACCATCTGG + Intronic
1061211261 9:129194736-129194758 GGTGGGCATGTGGCAGCACCAGG - Intergenic
1061328412 9:129877929-129877951 TACAGGTGTGTGCCACCACCTGG - Intronic
1061353214 9:130082618-130082640 TATAGGCACCTGCCACCACGTGG + Intronic
1061547808 9:131314933-131314955 TACAGGCATGAGCCCGCTCCAGG + Intergenic
1062337157 9:136076731-136076753 TACAGGCATGAGCCACCACCAGG - Intronic
1062624801 9:137437924-137437946 AACAGGCAGGTCCCAGCACCGGG + Intronic
1203576546 Un_KI270745v1:12905-12927 TCGAGGCATGTGCCACCACAAGG + Intergenic
1186083872 X:5964792-5964814 TACAGGCATATGCCACCACCTGG + Intronic
1186208976 X:7230161-7230183 TACAGACATGAGCCACCACCAGG + Intronic
1187323278 X:18261271-18261293 TATAGGCATGCGCCACTGCCTGG + Intronic
1187342032 X:18429911-18429933 TACAGGCATGAGCCACCGCCAGG + Intronic
1187469887 X:19560007-19560029 TATAGGCATGCTACTGCACCTGG - Intronic
1187951940 X:24479642-24479664 TACAGGCACGTGCCACCGCCTGG - Intronic
1188315619 X:28669476-28669498 TACAGGCATGCGCCACCACAAGG - Intronic
1190112330 X:47600330-47600352 TATAGGCGTGTGCCACCATGTGG + Intronic
1190311389 X:49119382-49119404 TACAGGCATGAGCCACTACCTGG + Intronic
1190314160 X:49138957-49138979 TATAGGCATGAGTCACCACGTGG + Intergenic
1190315935 X:49151020-49151042 TACAGGCGTGTGCCACCGCCCGG + Intergenic
1190486201 X:50927436-50927458 TCTAGGCTTGCCCCAGCACCAGG - Intergenic
1190715182 X:53096990-53097012 TACAGGCATGTGCCACCATGTGG - Intergenic
1192472514 X:71411355-71411377 TACAGGCATGAGCCACCACTAGG + Intronic
1196524861 X:116719999-116720021 TACAGGCATGAGCCACCACGTGG + Intergenic
1197123185 X:122914826-122914848 TTCAGGCCTATGCCAGCACCAGG - Intergenic
1197676124 X:129332542-129332564 TATAGGCACGTGCCACTACCCGG + Intergenic
1197742712 X:129907679-129907701 TACAGGCATGAGCCATCACCCGG - Intronic
1198041926 X:132861066-132861088 TACAGGCATGAGCCACCACCTGG + Intronic
1198940909 X:141953996-141954018 TATAGGCATGTGAAAGGGCCTGG + Intergenic
1200410264 Y:2853971-2853993 TACAGGCATGTGCCACCACCCGG + Intronic
1200769824 Y:7113307-7113329 TACAGGCATCTGCCGGCACCCGG - Intergenic
1201349523 Y:13024044-13024066 TATAGGCATGAGCCACTGCCAGG - Intergenic
1201390869 Y:13496120-13496142 TACAGGCATGCGCCACCACCTGG + Intergenic