ID: 1161717780

View in Genome Browser
Species Human (GRCh38)
Location 19:5886526-5886548
Sequence AAAGAGATACACAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1732
Summary {0: 1, 1: 1, 2: 8, 3: 117, 4: 1605}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161717770_1161717780 23 Left 1161717770 19:5886480-5886502 CCACGCTCTGAGGAGGACCACAG 0: 1
1: 0
2: 2
3: 19
4: 168
Right 1161717780 19:5886526-5886548 AAAGAGATACACAGGGAGGAAGG 0: 1
1: 1
2: 8
3: 117
4: 1605
1161717775_1161717780 6 Left 1161717775 19:5886497-5886519 CCACAGCAAGTGGAGGGAGGCTG 0: 1
1: 2
2: 3
3: 30
4: 281
Right 1161717780 19:5886526-5886548 AAAGAGATACACAGGGAGGAAGG 0: 1
1: 1
2: 8
3: 117
4: 1605
1161717769_1161717780 24 Left 1161717769 19:5886479-5886501 CCCACGCTCTGAGGAGGACCACA 0: 1
1: 0
2: 0
3: 15
4: 69
Right 1161717780 19:5886526-5886548 AAAGAGATACACAGGGAGGAAGG 0: 1
1: 1
2: 8
3: 117
4: 1605

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161717780 Original CRISPR AAAGAGATACACAGGGAGGA AGG Intronic
900011123 1:109695-109717 AAAAACACACATAGGGAGGAGGG + Intergenic
900875522 1:5340035-5340057 AAGGAGATTCAGAGGGAGCAGGG + Intergenic
900927240 1:5713307-5713329 AAGGAAATACACAGATAGGAGGG - Intergenic
901564985 1:10106558-10106580 GGAGAGATCCTCAGGGAGGAGGG - Exonic
901649341 1:10734675-10734697 AAAGAGAGAGAGAGGGAGAAGGG + Intronic
901678334 1:10899579-10899601 AGAGAGAGAGAAAGGGAGGAAGG + Intergenic
901741949 1:11347606-11347628 AAAGAGAGAGAAAGGGAGGGAGG - Intergenic
901787086 1:11631972-11631994 AAAGAAAGAGAAAGGGAGGAAGG + Intergenic
901902929 1:12382016-12382038 AAAGAGAAAGAAAGGAAGGAAGG - Intronic
902625365 1:17673287-17673309 GAAGAGACACACAGAGTGGAGGG - Intronic
902643423 1:17781174-17781196 ACACAGACACACAGAGAGGAAGG - Intronic
902732287 1:18377353-18377375 AAAGAGAACCAAAGGGTGGATGG - Intronic
902894454 1:19469185-19469207 ACAGAAAGACACAGGCAGGAGGG + Intronic
903089566 1:20899663-20899685 AAAGAGGTACATAGGAAGGCAGG + Intronic
903273696 1:22207884-22207906 ACAGAGACACACAGGGTGCAAGG - Intergenic
903298344 1:22360414-22360436 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
903303331 1:22394313-22394335 AAAGAAAGAAAAAGGGAGGAAGG + Intergenic
903365782 1:22804838-22804860 AGAGAGAGAAACAGAGAGGAGGG - Intronic
903555387 1:24189130-24189152 AAAGAGAGAGAAAGGAAGGAAGG - Intergenic
904504017 1:30936050-30936072 GAAGAGTTAGACAGGGAAGAAGG - Intronic
904505481 1:30949479-30949501 GAAGAGTTAGACAGGGAAGAAGG - Intronic
905681223 1:39872793-39872815 AAAGAGAGAGAAAGGAAGGAAGG + Intronic
905924262 1:41738811-41738833 AAAGAGGCAGACAGGGAGGCGGG - Intronic
905961666 1:42047793-42047815 AAAGAGAAGCACAGAGAGGTTGG + Intergenic
906275215 1:44510249-44510271 AAAGAGAGAGAGAGAGAGGAGGG + Intronic
907229215 1:52979907-52979929 AAAGGGAAAGAAAGGGAGGAAGG - Intronic
907387002 1:54132487-54132509 AAAGAGAGACAAAGGAAGGAAGG + Intergenic
907683751 1:56589933-56589955 AAAGAGAGAGAGAGGGAGGAAGG + Intronic
907940912 1:59086040-59086062 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
908252451 1:62275831-62275853 AAAGAGAGAGAGAGGGAGGGAGG + Intronic
908330503 1:63066216-63066238 AAAGAGAGAAAGAGGGAGGTGGG - Intergenic
908524330 1:64973300-64973322 AAAGAGAGAGAAAGGAAGGAAGG + Intergenic
908756412 1:67473042-67473064 AAAGAGAGAGAAAGGAAGGAAGG - Intergenic
908773406 1:67616561-67616583 AAAGAGAGAGAAAGGGAGAAAGG - Intergenic
909029842 1:70526426-70526448 AAAGAAATACTTTGGGAGGATGG - Intergenic
909436676 1:75650212-75650234 AAAGAGAGAAACTGGGAGGCTGG - Intergenic
909942218 1:81623984-81624006 AAAGACACACACAGGGAAGGAGG + Intronic
909954016 1:81754697-81754719 AAAGAGAGAGAGAGGAAGGAAGG - Intronic
910043397 1:82882305-82882327 AGAGAGAAACAGAGGGAAGAAGG + Intergenic
910072967 1:83242149-83242171 AAAGAGAGACAGAGAGAGAAAGG + Intergenic
910240880 1:85085047-85085069 ACAAAGAGACACAGGGAGAATGG + Intronic
910285184 1:85545775-85545797 GAGGAGATGCAGAGGGAGGAGGG + Intronic
910570681 1:88699077-88699099 AAAGAGAGAAACAGGAAAGAAGG - Intronic
910713067 1:90201968-90201990 AGAGAGAGAGACAGAGAGGAAGG + Intergenic
910735031 1:90444316-90444338 AAAGAGAGAGAAAGGAAGGAAGG + Intergenic
910820828 1:91344047-91344069 AAAGTGGCAAACAGGGAGGAGGG - Intronic
910841965 1:91569766-91569788 AAGGAGAGCCACAGGAAGGAAGG + Intergenic
911152394 1:94608158-94608180 AAAGAGATCCACAAAGAGGAAGG - Intergenic
911154278 1:94623609-94623631 CATGAGACACACAGGGAGGCTGG - Intergenic
911232254 1:95373734-95373756 AAAGAGATAGACAACGAGGGAGG - Intergenic
911519271 1:98909103-98909125 AAGGAGGGACAGAGGGAGGAAGG + Intronic
911720264 1:101183066-101183088 AAAGAGAAAGAAAGGAAGGAAGG + Intergenic
911857961 1:102905403-102905425 AAAGAGAGAGAAAGGAAGGAAGG + Intronic
911967670 1:104387850-104387872 AAAGAGAAGCACAGGGACCAGGG - Intergenic
912143176 1:106756857-106756879 ACAGACACACACAGGGAAGAAGG + Intergenic
912144889 1:106781540-106781562 AAAGAGAGAGAAAGGAAGGAAGG + Intergenic
912526925 1:110290386-110290408 ACACAGACACACAGGGAGGAAGG + Intergenic
912621666 1:111166081-111166103 AAAAAGCTACACAGGGAAGTTGG - Intronic
912763398 1:112387967-112387989 AAAGAGAAAGAAAGGAAGGAAGG + Intergenic
912806360 1:112759795-112759817 AAAGAGAAAGAGAGGAAGGAAGG + Intergenic
913076574 1:115345196-115345218 ATAGAAATAAACAGGAAGGAGGG - Intergenic
913090053 1:115470472-115470494 AAAGAGATAGGGAGGAAGGAGGG - Intergenic
913154410 1:116080790-116080812 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
913251755 1:116917623-116917645 AAAGAGAGAGACAGGGAACAAGG - Intronic
914197540 1:145455997-145456019 AAAGAGAAAGAGAGGAAGGAAGG - Intergenic
914259985 1:145990708-145990730 AAAGAGAGACAAAGAGAGGGAGG + Intergenic
914476645 1:148029099-148029121 AAAGAGAAAGAAAGAGAGGAAGG - Intergenic
914812410 1:151038551-151038573 AAGGAGATTCACAGGCAGGTAGG + Exonic
915155049 1:153868486-153868508 ACACAGATACACAGGAAGGTAGG + Intronic
915214508 1:154330852-154330874 AAAGAGGTTGACAGGCAGGAAGG - Exonic
915625374 1:157111241-157111263 AAGGAGCTGCACAGGGTGGAGGG + Intergenic
915720552 1:157982058-157982080 AGAGAGAGAGAGAGGGAGGAAGG + Intergenic
916017996 1:160767265-160767287 GAAGAGATACAGAGAGGGGAGGG + Intergenic
916050328 1:161031576-161031598 AAAGAGGGACACAGTGAGAAAGG + Intronic
916063998 1:161121432-161121454 ACACACATACACAGGGTGGATGG - Exonic
916189931 1:162168721-162168743 AAGGAGAAAGAAAGGGAGGAAGG - Intronic
917051902 1:170933539-170933561 AAAGAGAAAGAAAGGAAGGAAGG + Intergenic
917080178 1:171249718-171249740 AGAGAGAGACAGAGGGAGTAGGG + Intronic
917149921 1:171932115-171932137 AAAGAGAGAAAGAGAGAGGAAGG - Intronic
917506349 1:175630564-175630586 AAAGAGAAAGAAAGGGAGGAAGG - Intronic
917644846 1:177019712-177019734 ATAGAAATACAGAGGGAGGCTGG + Intronic
917646946 1:177038463-177038485 GAAGAAATAAAGAGGGAGGAAGG + Intronic
917804811 1:178604121-178604143 AGAGAGAGTCCCAGGGAGGAGGG - Intergenic
917809723 1:178646571-178646593 AAAGAGGGACAGAGGGAGGGAGG + Intergenic
918204341 1:182295900-182295922 CAAGAGAGACAGAGGAAGGAAGG - Intergenic
918212842 1:182366875-182366897 AGAGAGAGAGAAAGGGAGGAAGG + Intergenic
918398425 1:184139530-184139552 AAAGAGAGAGAAAGGAAGGAAGG + Intergenic
918604167 1:186401524-186401546 AAAGAGAAAGAGAGGAAGGAAGG - Intronic
918621099 1:186606781-186606803 AAAGAGAGAGGGAGGGAGGAAGG - Intergenic
918625646 1:186653399-186653421 AAAGGGATAGGTAGGGAGGATGG + Intergenic
919061622 1:192641384-192641406 AAAGAGGAAAGCAGGGAGGAAGG + Intronic
919174901 1:194007819-194007841 AAAGAGATTCAGAGAGGGGAAGG + Intergenic
919257556 1:195143173-195143195 AAAGAGAAAGAAAGGAAGGAAGG + Intergenic
919516741 1:198534289-198534311 GAGCAGACACACAGGGAGGAAGG + Intronic
919611034 1:199745798-199745820 AAAGATGCACACAGGGAGGCAGG + Intergenic
919613511 1:199776674-199776696 AAAGGAATAAAGAGGGAGGAAGG - Intergenic
919841078 1:201609850-201609872 ATAGAGAGAGAGAGGGAGGAGGG + Intergenic
919860627 1:201737533-201737555 GGTGAGACACACAGGGAGGAGGG + Intronic
919908042 1:202091773-202091795 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
919935137 1:202246101-202246123 AAAGAGGGACAGAGGGAGGGAGG - Intronic
920061635 1:203230819-203230841 ATACAGAGACACAGCGAGGAAGG - Intronic
920092420 1:203464111-203464133 AAAGAGCCAGAGAGGGAGGAAGG + Intergenic
920112333 1:203595933-203595955 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
920169756 1:204064566-204064588 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
920169760 1:204064617-204064639 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
920391202 1:205603661-205603683 AAAGAAACATACAGGGAGTATGG + Intronic
920537955 1:206752562-206752584 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
920566941 1:206981646-206981668 ACAGAGACACACGGGGAAGATGG - Intergenic
920689813 1:208137350-208137372 AAATCTATACACAGGGTGGATGG - Intronic
920936468 1:210439778-210439800 AAAGCCTTACACAGGGAGAAAGG + Intronic
921139174 1:212289262-212289284 CAGGAGATACACAGGGATTAAGG - Intronic
921367686 1:214389146-214389168 AAAGAAAAACACAGTGGGGAGGG + Intronic
921914094 1:220587304-220587326 AAAGAGAGAGAGAGGGAGGGAGG - Intronic
921993827 1:221396073-221396095 GAAGAGATGGACAAGGAGGAAGG - Intergenic
922259567 1:223925696-223925718 AAAAACACACATAGGGAGGAGGG + Intergenic
922953392 1:229578392-229578414 AAAGAGAAAAAGAGGGAGGGAGG - Intergenic
922964997 1:229682112-229682134 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
923324230 1:232866669-232866691 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
923363229 1:233233715-233233737 AAGGAGAGAGGCAGGGAGGATGG + Intronic
923369498 1:233295911-233295933 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
923426064 1:233871139-233871161 ACAGAGAGACAGAGGGAGGCAGG + Intergenic
923445481 1:234066726-234066748 AAAGAGAGAGAAAGGGAGGGAGG - Intronic
923718446 1:236447118-236447140 AAAGAGAGAGAGAGAGAGGAAGG - Intronic
923751820 1:236753822-236753844 AAGGAGAAACGAAGGGAGGAGGG - Intronic
923791179 1:237112414-237112436 AGAGAGATAAAAAGAGAGGAGGG - Intronic
923846303 1:237736488-237736510 TAAAAGATACAAAGGGAAGAAGG + Intronic
924015386 1:239715635-239715657 AAACAGATAAAGAGGGAGGAAGG + Intronic
924039679 1:239972059-239972081 AAAGAGAAAAGGAGGGAGGAAGG + Intergenic
924319347 1:242831832-242831854 AAAGAGAAACAAAGGAGGGAGGG + Intergenic
924340730 1:243028252-243028274 AAAAACACACATAGGGAGGAGGG + Intergenic
924380626 1:243460751-243460773 AAAAAGCTACACAGGGGAGAGGG - Intronic
924477822 1:244396824-244396846 AAAGAGAGAGAAAGGAAGGAAGG + Intergenic
924573805 1:245261122-245261144 AAAGAGAGAAAGAGGAAGGAAGG - Intronic
924612094 1:245581915-245581937 AAAGAGAGAAAGAGGAAGGAAGG + Intronic
924647085 1:245887871-245887893 AAGGAGAGAAACAGGGAGGGAGG + Intronic
924710776 1:246528356-246528378 AAAGAGAGAGACAGGGAGAGAGG + Intergenic
1062922844 10:1293036-1293058 GAAGAGATGCAGAGGGAGGGAGG + Intronic
1063010635 10:2019218-2019240 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1063199200 10:3771248-3771270 AAAGAAATTAACTGGGAGGAAGG - Intergenic
1063225644 10:4013058-4013080 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1063605370 10:7518752-7518774 AAAGAGAGAGGGAGGGAGGAAGG + Intergenic
1063674166 10:8125130-8125152 CAACAGAAACAAAGGGAGGAGGG + Intergenic
1063713135 10:8500166-8500188 AAAGAGAGAGGGAGGGAGGAAGG - Intergenic
1063750179 10:8935250-8935272 AAAGAGAGAGAAAGGAAGGAAGG - Intergenic
1063760348 10:9067583-9067605 AAAGAGAAAGAGAGGAAGGAAGG - Intergenic
1063907056 10:10792009-10792031 AAGGAGGGAGACAGGGAGGAAGG + Intergenic
1064072420 10:12242228-12242250 ACAGAGATGCCCTGGGAGGAGGG - Intronic
1064101861 10:12471038-12471060 AAAAAGACACAAAGGGAGGAAGG - Intronic
1064333240 10:14414365-14414387 AAAGAGAGAGAGAGGCAGGAAGG + Intronic
1064536350 10:16361350-16361372 ACAGAGATACACAGGGAAGAGGG + Intergenic
1064541750 10:16412734-16412756 AGAGAGAGAGAAAGGGAGGAAGG + Intergenic
1064769055 10:18705094-18705116 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
1064929213 10:20604901-20604923 AAAGAAAAAGAAAGGGAGGAAGG + Intergenic
1065061937 10:21911030-21911052 AAAGAGAGAGAAAGGAAGGAAGG + Intronic
1065223001 10:23515018-23515040 AAAGAGAGAGAGAGAGAGGATGG - Intergenic
1065497393 10:26343306-26343328 ACACACACACACAGGGAGGATGG + Intergenic
1065639810 10:27770329-27770351 AAAGAGAAAGAAAGGAAGGAGGG - Intergenic
1065709024 10:28497685-28497707 AGAGAGAAAGAGAGGGAGGAAGG + Intergenic
1065730858 10:28708361-28708383 AAAGACATACACAAAGAGGTCGG + Intergenic
1065809792 10:29430762-29430784 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
1065830847 10:29612317-29612339 AAGGAGATAAACAGAGAGCAGGG - Intronic
1065850139 10:29780931-29780953 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1065957556 10:30706452-30706474 AAAGAGAAAGAAAGAGAGGAGGG - Intergenic
1066043466 10:31576717-31576739 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1066332079 10:34434613-34434635 AGAGATGTAAACAGGGAGGAGGG + Intronic
1066413379 10:35195509-35195531 AAAGAGAGACACAGAGATGGAGG - Intronic
1066458833 10:35595545-35595567 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
1066533863 10:36369209-36369231 AAAGAGAAAGAAAGGAAGGAAGG + Intergenic
1066713909 10:38265867-38265889 AGAGAGAGAGACAAGGAGGAAGG - Intergenic
1066735747 10:38477154-38477176 AAAAACACACATAGGGAGGAGGG - Intergenic
1067263657 10:44716720-44716742 AAACAGGGACACAGGAAGGAAGG + Intergenic
1067280647 10:44869490-44869512 AAGGAGGTAGAAAGGGAGGAAGG + Intergenic
1067696369 10:48538246-48538268 ACAGAGACACAGAGGGAGGAAGG - Intronic
1068075581 10:52249096-52249118 AAAGAGAAAGAAAGAGAGGAAGG - Intronic
1068177631 10:53482321-53482343 ACACAGATGCACAGGGAAGAAGG + Intergenic
1068530475 10:58180365-58180387 GAAGAGAGAGAGAGGGAGGAAGG - Intergenic
1068635813 10:59347090-59347112 AAAGAGATAAACAAGCAGAAAGG + Intronic
1068643014 10:59432342-59432364 AGAGAGAGAGAAAGGGAGGAAGG + Intergenic
1068830647 10:61491158-61491180 AAAGAAAGAGAGAGGGAGGAAGG + Intergenic
1068934961 10:62626709-62626731 AAATAGATACATTGGGAGGGAGG + Intronic
1069003022 10:63286596-63286618 AAAGAGCTACATACTGAGGATGG - Intronic
1069593647 10:69656719-69656741 AAACAGAGAGACAGGGAGGGAGG + Intergenic
1069637745 10:69936026-69936048 AGAGAGAAAGAGAGGGAGGAGGG + Intronic
1069692526 10:70363321-70363343 AAAGAGAGAGGAAGGGAGGAAGG + Intronic
1069796421 10:71055046-71055068 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1069839110 10:71328091-71328113 ACCGAGGTACACAGGAAGGAAGG - Intronic
1069862883 10:71482270-71482292 AAAGAAATGCAAAGGGAGAAAGG - Intronic
1069881135 10:71594318-71594340 AAAGAAAGAAACAGGAAGGAAGG - Intronic
1070053247 10:72909413-72909435 AAAAAGAGACACAGGGAGCCTGG - Intronic
1070236454 10:74632580-74632602 AAAGATATACACAGGGAAGAAGG - Intronic
1070426305 10:76291214-76291236 ACAGTGAAAGACAGGGAGGAGGG - Intronic
1070660182 10:78300041-78300063 AGAGACAGACACAGAGAGGAAGG - Intergenic
1070852764 10:79581196-79581218 AAAGAGAGAGAAAGGAAGGAAGG + Intergenic
1071021175 10:81058943-81058965 AAAGAGACACACAGAGAAGAAGG - Intergenic
1071279724 10:84089643-84089665 AAAGAGATAAGAAGGTAGGATGG - Intergenic
1071746033 10:88420583-88420605 TAAGAGATACGCAGAGAAGAAGG - Intronic
1071807775 10:89142968-89142990 AAAGAGAAACCCAGGGAGGAAGG - Intergenic
1072510703 10:96121551-96121573 AGAGAGAGAGACAGGAAGGAAGG - Intergenic
1072511245 10:96128274-96128296 AAAAAGATACAAAGGGGAGAAGG - Intergenic
1072587046 10:96792038-96792060 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
1072612044 10:97023956-97023978 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
1072815784 10:98507739-98507761 AAGGAGGAACAAAGGGAGGAAGG - Intronic
1072870929 10:99119086-99119108 AAAGAGAGAGAGAGGGAGGGAGG + Intronic
1072907930 10:99472029-99472051 AAAGAGAGAAAGAGGAAGGAAGG + Intergenic
1072923098 10:99593251-99593273 AAAGAGAAAGAAAGGAAGGAAGG + Intergenic
1073055322 10:100696490-100696512 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
1073065718 10:100758095-100758117 AAAGAGATAGAAAGAGAGCAGGG + Intronic
1073349604 10:102810378-102810400 AAAGAGAGAAAGAGGGAGGGAGG - Intronic
1073567113 10:104544434-104544456 AGAGAGCAAGACAGGGAGGAAGG + Intergenic
1073645516 10:105298041-105298063 AAAGAAAGAGAAAGGGAGGAAGG + Intergenic
1073682183 10:105716617-105716639 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
1073753031 10:106551194-106551216 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
1073940003 10:108686093-108686115 AGAGAGAGAGAGAGGGAGGAGGG + Intergenic
1073988807 10:109240535-109240557 AAGGAGGGAGACAGGGAGGAAGG + Intergenic
1074391388 10:113061066-113061088 TAACAGATTCAAAGGGAGGAGGG - Intronic
1074500968 10:114024447-114024469 AAAGAGAGAAAAAGGAAGGAAGG + Intergenic
1074708076 10:116153314-116153336 AAAGATGTATAAAGGGAGGAAGG - Intronic
1074730779 10:116372753-116372775 AAAGAGAAACTCAGGAAGGAAGG + Intronic
1074816573 10:117146077-117146099 AAAGAGAAAGAAAGGAAGGAAGG + Intergenic
1075524956 10:123176257-123176279 AAAGAGAGACGAAGGGATGAAGG - Intergenic
1075611520 10:123858588-123858610 AAAAACAGACACAGGGAGCATGG - Intronic
1075935228 10:126334842-126334864 TAAGACATACACAGTGAAGAGGG + Intronic
1077163223 11:1122947-1122969 AGAGAGATAGAGAGAGAGGAAGG - Intergenic
1077715522 11:4576275-4576297 AAAGAAAGACACAGAGAGAAAGG + Intronic
1078156388 11:8803576-8803598 AGAGAAATTCACAGGAAGGATGG + Intronic
1078246159 11:9574324-9574346 AAAGAGCTACCCAGGAAGTAGGG - Exonic
1078678613 11:13452095-13452117 AAAGAGATTCAGAGACAGGAGGG + Intronic
1079072900 11:17363559-17363581 AAAGAGAGAAAGAGGAAGGAAGG - Intronic
1079418919 11:20267942-20267964 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
1079968528 11:27007596-27007618 ATGGAAATACACAGGGAAGATGG + Intergenic
1080038555 11:27734899-27734921 AAAGAGCTACAGATGAAGGAAGG - Intergenic
1080264739 11:30388778-30388800 AGAGAGGCACACAGGAAGGAAGG - Intronic
1081000929 11:37669928-37669950 AAAGAGAGACAGAGAGAGAATGG - Intergenic
1081091664 11:38876651-38876673 AAATAGATACGCATGAAGGAAGG + Intergenic
1081443484 11:43106495-43106517 ACACAGATAAAGAGGGAGGATGG + Intergenic
1081593794 11:44445585-44445607 AAAGAGAGAGAAAGGGAGGGAGG + Intergenic
1081785427 11:45743434-45743456 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1081952026 11:47052574-47052596 AAAGAGAGAGAGAGGAAGGAAGG - Intronic
1082040816 11:47683374-47683396 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
1083001789 11:59298953-59298975 AAAGAGAAAGAGAGGAAGGAAGG + Intergenic
1083309068 11:61775333-61775355 AAAGGGAGCCACAGGGTGGAGGG - Intronic
1083655528 11:64227373-64227395 AAGGAGATACACAGGGGGCAGGG - Intronic
1083716362 11:64579363-64579385 ATAGAGACACACAGGCAGGTGGG - Intergenic
1084242959 11:67835197-67835219 ACAGAGACACACAGGGGAGAAGG - Intergenic
1084585810 11:70061509-70061531 AGAGAGAGAGAAAGGGAGGAGGG - Intergenic
1084596967 11:70122757-70122779 ACAGAGAGACAGAGGGAGGAAGG - Intronic
1084729308 11:71063082-71063104 AAAGAGAAAGACAGGGAGGGAGG + Intronic
1084772633 11:71353804-71353826 AAAGAGAAAGAGAGGAAGGAAGG + Intergenic
1084830032 11:71761778-71761800 ACAGAGACACACAGGGGAGAAGG + Intergenic
1085569543 11:77547329-77547351 AAAGAGAGAGAGAGGAAGGAAGG - Intronic
1085790390 11:79492731-79492753 AAACAGTTACAGAGGGAGGATGG + Intergenic
1086140499 11:83493383-83493405 AAAGAGAGAGAAAGGAAGGAAGG - Intronic
1086163275 11:83747355-83747377 AGAGAGAGAGACAGGAAGGAAGG - Intronic
1086536189 11:87849614-87849636 AAAGATATTCACAGGAAGGAGGG - Intergenic
1086843521 11:91718940-91718962 AAACAGACACACAGGAAGAAAGG + Intergenic
1087237357 11:95734832-95734854 AAAGAAAGAAAGAGGGAGGAAGG + Intergenic
1087583544 11:100090440-100090462 AAAGAGAAAGAGAGGAAGGAAGG - Intronic
1087774309 11:102243537-102243559 AGAGAGAGAGACAGGGAGGAGGG + Intergenic
1087908883 11:103729876-103729898 GGAGAGAGACAGAGGGAGGAAGG + Intergenic
1088358588 11:108968386-108968408 ACACAGACACACAGGGAAGATGG + Intergenic
1088372871 11:109110682-109110704 ACAGAGACACACAGGGGAGAAGG + Intergenic
1088457851 11:110050911-110050933 GGAGAGATAGAGAGGGAGGAGGG - Intergenic
1088575177 11:111264728-111264750 AAAGAGAAAGAAAGGAAGGAGGG + Intronic
1088738344 11:112746842-112746864 AAACAGAAAGACAGAGAGGAAGG + Intergenic
1088904991 11:114148416-114148438 AAAGAGAGAGAGAGGGAGGGAGG - Intronic
1088907868 11:114168636-114168658 AAAGCAAGACACAGGGTGGAAGG - Intronic
1089134820 11:116240611-116240633 AAAGAGAGAGAAAGAGAGGAAGG + Intergenic
1089391483 11:118104881-118104903 AAAGAGAGAAGAAGGGAGGAAGG - Intronic
1089558533 11:119330575-119330597 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
1089711643 11:120319130-120319152 AAAGAGAAACACAGGGAGGAAGG - Exonic
1089825623 11:121273724-121273746 AGAGAGAGAGACAGGAAGGAAGG - Intergenic
1089826046 11:121278834-121278856 AAAGAGACAAAGAAGGAGGAAGG - Intergenic
1089894802 11:121919347-121919369 AAAGAGATGCACTGAGGGGAGGG + Intergenic
1089916166 11:122159078-122159100 GTAGAGATAGAAAGGGAGGAGGG + Intergenic
1089960767 11:122615474-122615496 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1090018351 11:123105396-123105418 AAAGAGAGAGAGAGGAAGGAAGG - Intronic
1090347585 11:126083600-126083622 AGAGAGAGACAGAGGTAGGAAGG - Intergenic
1090385028 11:126352886-126352908 AAAGAGAGAGAAAGGAAGGAAGG + Intergenic
1090385049 11:126353138-126353160 AAAGAGAGAGAAAGGAAGGAAGG + Intergenic
1090385057 11:126353226-126353248 AAAGAGAGAGAAAGGAAGGAAGG + Intergenic
1090471251 11:126983232-126983254 CAATAGATACACACGGGGGAAGG + Intronic
1090528303 11:127561588-127561610 AAAGAGGTTAACAGGGGGGAAGG + Intergenic
1090534758 11:127628525-127628547 AAAGACACACACAGGCAGAACGG + Intergenic
1090601997 11:128382180-128382202 AAAGAGACACACAGAGAGAGAGG - Intergenic
1090716509 11:129436616-129436638 AAGGAGGTACAGATGGAGGAAGG - Intronic
1090833720 11:130438630-130438652 AAAGAGAGAGAGAGGGAGAAAGG - Intergenic
1091113810 11:132995462-132995484 AAGGAGAGACAGAGGGAAGAAGG - Intronic
1091180065 11:133596320-133596342 AAAGAGCTAAACAGGGAAGCCGG - Intergenic
1091301818 11:134512772-134512794 GAAGAGGTACAGATGGAGGAGGG - Intergenic
1091323453 11:134667489-134667511 AAAGAGAAAGAAGGGGAGGAAGG - Intergenic
1091396045 12:154765-154787 AAAAACAGAGACAGGGAGGAAGG - Intronic
1091416848 12:295365-295387 AAAGAAAGAAAGAGGGAGGAAGG + Intronic
1091564159 12:1635724-1635746 AAAGAGCCTCTCAGGGAGGAGGG - Intronic
1091637234 12:2206230-2206252 AAGGAGATCCAGAGGGAAGAAGG + Intronic
1092092308 12:5812919-5812941 AAAGAGAGAGAAAGAGAGGAAGG + Intronic
1092162017 12:6320532-6320554 ACAGAGACATACAGAGAGGAAGG - Intronic
1092413200 12:8269910-8269932 ACAGAGACACACAGGGGAGAAGG - Intergenic
1092815603 12:12310108-12310130 AAAGTGAAACAGATGGAGGAAGG + Intergenic
1092893703 12:12993162-12993184 AAAGAGAGAGAGAGAGAGGAAGG - Intronic
1093017579 12:14170585-14170607 AAAGAGAGAAAGAGGAAGGAAGG + Intergenic
1093141281 12:15513030-15513052 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
1093176627 12:15920013-15920035 AAAGAGAGAGAGAGGGAGGGAGG + Intronic
1093267447 12:17020312-17020334 AGGGAGAGACACAGGGAGGAAGG - Intergenic
1093396214 12:18685804-18685826 AGAGAGATACAGGAGGAGGATGG - Intronic
1093524353 12:20090455-20090477 TAAGGGATACACAGGAAGGTGGG + Intergenic
1093755914 12:22851671-22851693 AAAGAGAGAGATAGGAAGGAAGG - Intergenic
1093844363 12:23950645-23950667 AAAGAGATCCACAGCCAGGGGGG - Intronic
1093912773 12:24766347-24766369 AAAGAGAGAGAAAGGAAGGAAGG - Intergenic
1094192091 12:27708290-27708312 AAGGAAATACACTGGGAAGAGGG - Intergenic
1094707509 12:32928563-32928585 AAAGAAATTCACAGGTGGGAAGG + Intergenic
1095138760 12:38637779-38637801 AAAGAGATAAAGAGAGAGAAGGG + Intergenic
1095257690 12:40059369-40059391 AAACAGATACACATTGAGTATGG + Intronic
1095319767 12:40813078-40813100 AAAGAGAAAGAAAGGAAGGAAGG - Intronic
1095373337 12:41496290-41496312 CAAGAGTTACCCAGGAAGGAAGG + Intronic
1095409079 12:41902669-41902691 ACAGAGACATACAGGGAAGAAGG - Intergenic
1095908681 12:47403841-47403863 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
1096011705 12:48222708-48222730 AAAGAAAGAAAGAGGGAGGAAGG - Intergenic
1096016365 12:48279516-48279538 AAAGAGAGGCAGAGGGAGGATGG - Intergenic
1096078296 12:48818270-48818292 AGAGAGAGGCAGAGGGAGGACGG - Intronic
1096245855 12:49985737-49985759 CAAGAGTTACAGAGGGAGAAAGG + Intronic
1096368074 12:51045472-51045494 AAAGAGAAAGAAAGAGAGGAAGG + Intergenic
1096478033 12:51920665-51920687 AGAGAGATGCAGAGGGAGGTGGG - Intronic
1096820484 12:54230003-54230025 AAAGAGATCGAAAGGGAAGAGGG + Intergenic
1096875273 12:54625016-54625038 AAAGAGAAAGAGAGGAAGGAAGG - Intergenic
1097589932 12:61562310-61562332 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1097997913 12:65910042-65910064 AAAGAGGTAGAGAGGAAGGAAGG + Intronic
1098285540 12:68903789-68903811 AAGGAGAGACAGAGGGAGGGAGG - Intronic
1098403035 12:70093773-70093795 AAAGAGAAAGAAAGGAAGGAAGG + Intergenic
1098460766 12:70730810-70730832 AGAGAGAGACAGAGAGAGGAAGG + Intronic
1098505647 12:71247481-71247503 GAAGTGATACACACGGAGGCTGG + Intronic
1098526935 12:71497331-71497353 AAAGAGAGAAAGAGGAAGGAAGG + Intronic
1098900986 12:76111541-76111563 AAAAAGAAAGACAGGAAGGAAGG + Intergenic
1098959631 12:76726450-76726472 AAAGAGATAGATAGGCAGGTAGG - Intergenic
1098993310 12:77090256-77090278 AAAGAGAGAAAGAAGGAGGAAGG - Intergenic
1099230254 12:80014920-80014942 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
1099337237 12:81378007-81378029 ACAGAGATATACCGGGAAGAAGG + Intronic
1099345771 12:81497980-81498002 AAAGACACAGACAAGGAGGAGGG + Intronic
1099446849 12:82762693-82762715 AAATAAAAACACAGGGAGAATGG + Intronic
1099626285 12:85078934-85078956 AAAGAGTTATACTGGGAAGAAGG + Intronic
1100101153 12:91107370-91107392 AAAGAGAGAGAGAGGGAGGGAGG + Intronic
1100175616 12:92027465-92027487 AAAGAGAAAGAGAGGGAGGGAGG + Intronic
1100243930 12:92737647-92737669 AAAGAGAAAGAAAGGAAGGAAGG + Intronic
1100262866 12:92949462-92949484 AAAGAGGGAGAGAGGGAGGAAGG + Intergenic
1100521261 12:95378403-95378425 AAAGAGAGAGAGAGGGAGGGAGG - Intronic
1100616782 12:96237009-96237031 AAAGACACACACAGGGAAGGTGG - Intronic
1100643340 12:96503440-96503462 AGAGAGAAACAAAGGAAGGAAGG - Intronic
1100749755 12:97685605-97685627 AAAGAGAAAGAAAGGGAGGAAGG + Intergenic
1101040065 12:100746738-100746760 CAAGAAACACCCAGGGAGGAAGG - Intronic
1101225283 12:102682058-102682080 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
1101356181 12:103979446-103979468 AAATAGAGAAACAGGAAGGAAGG - Intronic
1101425624 12:104585916-104585938 AGAGACACACACAGGGAAGAGGG - Intronic
1101558189 12:105830638-105830660 AAAGACACACACAGGGAAGAAGG - Intergenic
1101640514 12:106583237-106583259 CTAGAGATGCCCAGGGAGGAAGG - Intronic
1101677061 12:106926808-106926830 AAAGAGAAAGAGAGGAAGGAAGG - Intergenic
1101736884 12:107469828-107469850 AAAGAGAGAGAAAGGAAGGACGG - Intronic
1101852665 12:108416767-108416789 AAAGAGAGAGAAAGGAAGGAAGG + Intergenic
1102194898 12:111018160-111018182 AAAGAGAAAGAGAGGAAGGAAGG + Intergenic
1102219643 12:111185922-111185944 AAACAGAAAGACAGGGAGGGAGG - Intronic
1102249500 12:111376589-111376611 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1102360698 12:112285220-112285242 AAAGAGAGAGACAGGAAGGAGGG - Intronic
1102413195 12:112738134-112738156 AGAGATATACACAAGGAAGAAGG - Intronic
1102501045 12:113352577-113352599 AAAGAGAAAGAAAGAGAGGAAGG - Intronic
1102521879 12:113482696-113482718 AAGAAAATAGACAGGGAGGAGGG - Intergenic
1102564671 12:113788030-113788052 AAAGAGAGAGAAAGGAAGGAAGG + Intergenic
1102564685 12:113788198-113788220 AAAGAGAAAGAAAGGAAGGAAGG + Intergenic
1102631819 12:114287575-114287597 AGAGAGAGAGAAAGGGAGGAAGG + Intergenic
1102784474 12:115593044-115593066 GGAGAGATACACGTGGAGGAAGG - Intergenic
1102881020 12:116485059-116485081 AAACAGATGCACAGAGAGTAAGG - Intergenic
1102890052 12:116551769-116551791 ACAGAGGCACACAGGGAGAAAGG - Intergenic
1102902308 12:116647871-116647893 AGAGAGATAAACAGGGAGAAAGG - Intergenic
1103033978 12:117641521-117641543 ACAGAGATGCACAGGGAGAAAGG - Intronic
1103241162 12:119414342-119414364 AGGGAGACACACAGTGAGGATGG - Intronic
1103245774 12:119455936-119455958 AAAGAGAGAGAAAGGAAGGAAGG + Intronic
1103453368 12:121045561-121045583 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
1103495291 12:121357434-121357456 AAAGAGAAAGAAAGGGAGGGAGG + Intronic
1103520992 12:121537094-121537116 AATGAGGGACACCGGGAGGAGGG - Intronic
1103547245 12:121711081-121711103 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
1103609949 12:122117231-122117253 CAAGAGATCCACGAGGAGGATGG + Intronic
1103800981 12:123537000-123537022 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1103920036 12:124394582-124394604 ACAGAGACACGCAGGGAGAAAGG + Intronic
1104074988 12:125381023-125381045 CAAGAGATACAGAGAGAGAAAGG + Intronic
1104373318 12:128243275-128243297 AAAGGGATACCCAGGGATGTGGG - Intergenic
1104493641 12:129216443-129216465 AGACAGACACACAGGGAGGATGG + Intronic
1104560913 12:129843613-129843635 AAACAGGGACACAGGCAGGAAGG + Intronic
1104590515 12:130081004-130081026 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1105379126 13:19870506-19870528 AAAGAGAGAAAGAGGGAGGGAGG - Intergenic
1105508682 13:21033243-21033265 AGAAAGAGAAACAGGGAGGATGG + Intronic
1105588325 13:21765562-21765584 AAACAAATATACAGAGAGGAAGG + Intergenic
1105624831 13:22102733-22102755 AAAGAGAGAGAAAGGAAGGAAGG - Intergenic
1105678276 13:22699173-22699195 ACAAAGACACACAGGGAAGAAGG - Intergenic
1105742168 13:23338152-23338174 AAACAGATACAAAAGGACGATGG - Exonic
1106001868 13:25731231-25731253 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
1106254698 13:28011686-28011708 AAAGAGAAAGAAAGGAAGGAAGG - Intronic
1106262128 13:28077028-28077050 AAAGAGAGAGAGAGAGAGGAAGG + Intronic
1106753237 13:32796211-32796233 AAAGAAAGCCACAGGGAAGAAGG - Intergenic
1106924232 13:34596564-34596586 AAAGAGATACAAAGGGAGAAAGG + Intergenic
1106951200 13:34885694-34885716 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1106951220 13:34885839-34885861 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
1107453107 13:40529810-40529832 AAAGAGATAGAGAAGGAGGGAGG + Intergenic
1107527291 13:41245880-41245902 ACAGGGATAAAGAGGGAGGAAGG - Intronic
1107608329 13:42085342-42085364 AGAGAGGTTCACAGGCAGGACGG - Intronic
1107784448 13:43940870-43940892 AAAAAGACAAACAGGAAGGAAGG + Intergenic
1108083130 13:46757766-46757788 GAAGAGAGGGACAGGGAGGAAGG + Intergenic
1108246334 13:48517955-48517977 ACAGTGATGCACAGGGAAGAAGG + Intronic
1108277953 13:48830417-48830439 ATACAGCTACACAGGGAGAAGGG - Intergenic
1108639828 13:52372692-52372714 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1108731752 13:53242587-53242609 AAAAAGAGACACAGCTAGGAAGG - Intergenic
1108954368 13:56134201-56134223 AAAGAGATTGAAAGGGAGGGAGG + Intergenic
1108966224 13:56306001-56306023 AAAGAGATAGAAAGGGAGCCTGG - Intergenic
1108986127 13:56590025-56590047 AGAGAGAGAGACAGAGAGGAAGG + Intergenic
1109377108 13:61510623-61510645 TAAGAGTGAGACAGGGAGGAGGG - Intergenic
1109473053 13:62835979-62836001 AAAAAGAAAGAGAGGGAGGAAGG - Intergenic
1109613413 13:64796396-64796418 AAAGAGATATGCAGGAAGGATGG + Intergenic
1110113113 13:71776132-71776154 TGAGAAATACACAGGAAGGAAGG - Intronic
1110237569 13:73232489-73232511 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1110290161 13:73796469-73796491 AAAGAGACAGACAGGGAGAGAGG - Intronic
1110602953 13:77397022-77397044 AAAGAGAAAGAGAGGAAGGAAGG - Intergenic
1110704018 13:78584424-78584446 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1110879372 13:80552579-80552601 AAAGAGAAAGAAAGGAAGGAGGG + Intergenic
1110937985 13:81317063-81317085 AATGAGCTTCACAGGTAGGAGGG + Intergenic
1110940408 13:81341630-81341652 AAAGAGAGAGAAAGGGAGGAAGG + Intergenic
1111027146 13:82542866-82542888 AAAGAGAAAGAGAGAGAGGAGGG + Intergenic
1111079346 13:83281426-83281448 AAAAAGATAAAGAGGGAGAAAGG + Intergenic
1111856231 13:93640871-93640893 AAAAAGATAAAGAGGGAAGAAGG - Intronic
1111955217 13:94749839-94749861 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1112184313 13:97113420-97113442 AAAGAGAGAGAGAGGGAGGAAGG - Intergenic
1112643186 13:101300402-101300424 AAAGAGAAAGAAAGGAAGGAAGG - Intronic
1112998855 13:105607991-105608013 AAAGAGAAAGAAAGGAAGGAAGG + Intergenic
1113058079 13:106290840-106290862 AAAGAGAGAAAGAGAGAGGAAGG + Intergenic
1113069723 13:106408882-106408904 AAAGAGAGAGACAGGGGTGAGGG - Intergenic
1113509491 13:110841610-110841632 ACAGAGACACACAGGGAAGATGG - Intergenic
1113733479 13:112658611-112658633 AGAGAGACAGACAGAGAGGAAGG + Intronic
1113873311 13:113578262-113578284 AAAGAGAAAGAGAGGAAGGAAGG - Intergenic
1114041863 14:18686268-18686290 AGAGAGAGACAGAGGGAGGGAGG - Intergenic
1114155920 14:20103646-20103668 AAAGAGATATACAGCCAAGATGG + Intergenic
1114181131 14:20368991-20369013 AAAGAAATACTAAGGGAGGAGGG - Intronic
1114428617 14:22641308-22641330 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
1114738198 14:25064964-25064986 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1115146746 14:30235623-30235645 AAAGAGAGAGAAAGGAAGGAAGG - Intergenic
1115261765 14:31461690-31461712 AAAGAGAGAGAAAGAGAGGAAGG + Intergenic
1115305727 14:31931652-31931674 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
1115435156 14:33363522-33363544 GAAGAGAAATACAGGGAGAAGGG - Intronic
1115502440 14:34061190-34061212 AAAGAGATACATGGGGAAGGGGG + Intronic
1115648400 14:35385700-35385722 AAAGAGAAAGAGAGGGAGGGAGG + Intergenic
1115804958 14:37040221-37040243 AAAGAAAAAGAAAGGGAGGAAGG + Intronic
1116002930 14:39263614-39263636 AAAGAGAGAGAGAGAGAGGAAGG - Intronic
1116088992 14:40279811-40279833 CAAGAGATAAACAAGGAGCAAGG - Intergenic
1116324050 14:43508826-43508848 ACAGAGAGAGACAGGAAGGAAGG + Intergenic
1116864303 14:50018878-50018900 AAAGACAGAGACAGGCAGGAAGG - Intergenic
1116890082 14:50259504-50259526 AAAGAAATACACATTGAGGCCGG - Intronic
1116903392 14:50382573-50382595 AGAGAGAAAGAGAGGGAGGAAGG - Intronic
1116974125 14:51096268-51096290 AAAGAGGGAGAGAGGGAGGAAGG + Intergenic
1117206155 14:53445810-53445832 ATAGAGAAACACAGGAAGAAGGG + Intergenic
1117224979 14:53647282-53647304 AGAAAAATACAGAGGGAGGAAGG - Intergenic
1117356492 14:54928722-54928744 AAAGAGAGACAGAGAGAGAAAGG + Intergenic
1117479548 14:56129282-56129304 GAAGAGAGACAAAGGTAGGAGGG - Intronic
1117667003 14:58066606-58066628 AAAAAAATAAACAGGGAGAAGGG + Intronic
1118422330 14:65620678-65620700 AGAGAGAGACAGAGAGAGGAAGG + Intronic
1118549149 14:66930226-66930248 AAAAAGAAAGACAGGAAGGAAGG - Intronic
1118620638 14:67611240-67611262 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1119065871 14:71525917-71525939 AACGCAATACAGAGGGAGGAAGG - Intronic
1119162900 14:72467956-72467978 GAAGAGACACACAGGAGGGAGGG - Intronic
1119593870 14:75916131-75916153 AGAGAGATAGAGAGGGATGAGGG + Intronic
1119737166 14:76990310-76990332 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
1120187352 14:81407497-81407519 AAAGAGGTAGACAGGGAAGATGG - Intronic
1120251637 14:82066166-82066188 AAAGAGAGAGAAAGAGAGGAAGG - Intergenic
1120647603 14:87092077-87092099 ACAGAGACACACAGTGAAGAAGG + Intergenic
1120677915 14:87443436-87443458 AGAGAGAGAAAGAGGGAGGAAGG + Intergenic
1120722530 14:87904387-87904409 AAAGAGAAACACAGGGTGGGAGG + Intronic
1121171160 14:91855496-91855518 ACAAAGATACACAGAGAAGAGGG - Intronic
1121233135 14:92372908-92372930 AAAGAGAAAGAAAGGAAGGAAGG - Intronic
1121544606 14:94754260-94754282 AGAGAGAGACACAGGGAAGAAGG + Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1121874133 14:97435328-97435350 GAGGAGAGACGCAGGGAGGAAGG - Intergenic
1121935443 14:98014116-98014138 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
1121962307 14:98272787-98272809 TAAAAGATACACAGCTAGGAAGG + Intergenic
1121975582 14:98401006-98401028 AAAGAGAGAGGCAGGGAGGGAGG + Intergenic
1122546512 14:102525717-102525739 AAAGAGAAAAAGAGGAAGGAAGG - Intergenic
1122546527 14:102525854-102525876 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
1122868496 14:104621878-104621900 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1123046825 14:105521506-105521528 AAAGAGAGAGGAAGGGAGGAAGG - Intergenic
1123189838 14:106558608-106558630 TAACAGATAAACATGGAGGATGG + Intergenic
1202933252 14_KI270725v1_random:59325-59347 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1123490607 15:20777377-20777399 AAAGAGAGACAGAGGGAGGGAGG - Intergenic
1123547109 15:21346464-21346486 AAAGAGAGACAGAGGGAGGGAGG - Intergenic
1123626707 15:22232147-22232169 ACAGAGACACACAGAGGGGAAGG + Intergenic
1124078455 15:26469102-26469124 AAAGAGAAAGAAAGGAAGGAAGG + Intergenic
1124611436 15:31212203-31212225 AAAGAGAGAGAAAGGGAGGGAGG + Intergenic
1124611454 15:31212325-31212347 AAAGAGAAAGAAAGGAAGGAAGG + Intergenic
1124623205 15:31291414-31291436 AAAGAGAGAGAAAGGAAGGAAGG - Intergenic
1124966932 15:34439437-34439459 AAAGAGCTACACAGAGAAAAGGG - Intergenic
1125025203 15:35022738-35022760 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
1125124912 15:36208846-36208868 AAAGAGATACACAGTAAAGGTGG + Intergenic
1125138065 15:36367256-36367278 AAAGAGAAATGAAGGGAGGAAGG - Intergenic
1125269907 15:37927361-37927383 TAAGAGATACACACTGAAGAGGG + Intronic
1125561590 15:40638197-40638219 AAAGAGAGAGAGAGGGAGGGAGG + Intronic
1125747045 15:42004367-42004389 AAAGGGAGAAAAAGGGAGGAAGG + Intronic
1126224157 15:46250460-46250482 AGAGAGAGACAGAGAGAGGAGGG + Intergenic
1126375044 15:47989104-47989126 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
1126401966 15:48281162-48281184 AAAGTGAAACACAGAGAGGATGG - Intronic
1126556011 15:49988442-49988464 AGAGAGGGACAGAGGGAGGAAGG + Intronic
1127121785 15:55778178-55778200 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
1127125250 15:55805413-55805435 AAAGAGATATCCAGGGAAAACGG + Intergenic
1127287331 15:57543250-57543272 AAACACGTACACAGGGAAGACGG - Intronic
1127496689 15:59519487-59519509 AAAGAGAGAAGGAGGGAGGAAGG - Intronic
1127559911 15:60125862-60125884 AAAGAGAGACAGAGAGAGGTTGG + Intergenic
1127707281 15:61559774-61559796 AAAGAGATAGAAGGGGAGGCAGG - Intergenic
1127818215 15:62631622-62631644 AAAGAGAAAGAAAGGGAGGGAGG - Intronic
1127878364 15:63132195-63132217 AAAGGGGGACGCAGGGAGGAGGG - Intronic
1128050115 15:64656744-64656766 AAAGAGGGAGAGAGGGAGGAGGG - Intronic
1128480641 15:68034934-68034956 AAAGAGAGAGGGAGGGAGGAAGG - Intergenic
1128567939 15:68713657-68713679 ACAGAGACACACAGGGGAGAAGG - Intronic
1128607912 15:69051061-69051083 AAGGAGAGATGCAGGGAGGAGGG - Intronic
1128610418 15:69068493-69068515 ATAGAGGAAGACAGGGAGGAAGG - Intergenic
1128676155 15:69610186-69610208 AAAGAGAGAGATAGAGAGGATGG - Intergenic
1128683215 15:69666290-69666312 AAAGGCACACACTGGGAGGAAGG + Intergenic
1128716809 15:69914521-69914543 AGAGAGAGACAGAAGGAGGAGGG - Intergenic
1129044993 15:72726014-72726036 AAAGAGAGAAAAAGGAAGGAAGG - Intronic
1129151001 15:73687698-73687720 AAAGAGAAAGAAAGGGAGAAAGG - Intronic
1129641371 15:77382114-77382136 ATAGAGATAGATAGAGAGGAGGG - Intronic
1129905250 15:79182650-79182672 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
1129905253 15:79182688-79182710 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
1129905256 15:79182726-79182748 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
1129905662 15:79185544-79185566 AAAGAGAGAAACAGGTAGGGAGG - Intergenic
1129907568 15:79199711-79199733 AAAGAGAGAGACAGAGAGAAAGG - Intergenic
1130042555 15:80417577-80417599 AGAGAGAGAAAGAGGGAGGAAGG - Intronic
1131017011 15:89066365-89066387 GGAGAGATACACAGGGAAGAGGG - Intergenic
1131159023 15:90092398-90092420 AGAGAGAGAGAAAGGGAGGAAGG - Intronic
1131166957 15:90149031-90149053 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
1131714190 15:95090671-95090693 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
1131835276 15:96384100-96384122 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
1132209743 15:100011248-100011270 AAAGAGACAGAAAGGAAGGAAGG + Intronic
1202955439 15_KI270727v1_random:73680-73702 AAAGAGAGACAGAGGGAGGGAGG - Intergenic
1132799929 16:1747004-1747026 AAGGCCAAACACAGGGAGGAGGG - Intronic
1133355113 16:5130472-5130494 AAAGAGAGAGACAGGGAGGGAGG - Intergenic
1133421492 16:5650694-5650716 AGAGAGAGACAGAGAGAGGAAGG - Intergenic
1133475621 16:6118817-6118839 AAAGAGAGAAAGAGGAAGGAGGG - Intronic
1133552654 16:6872332-6872354 AAAGAGAGAAACAGAGAGAAGGG - Intronic
1133677621 16:8089863-8089885 AGAGAGAGACACAGAGAGCAAGG + Intergenic
1133944030 16:10333737-10333759 AAGGAGACACCCTGGGAGGAAGG + Intronic
1134019464 16:10911399-10911421 AGAGAGATAGGGAGGGAGGAAGG - Intronic
1134019465 16:10911403-10911425 AAAGAGAGAGATAGGGAGGGAGG - Intronic
1134212441 16:12289075-12289097 GAAGAGATAAGGAGGGAGGATGG + Intronic
1134315170 16:13112371-13112393 AAAGAGGGAGGCAGGGAGGAAGG + Intronic
1134328141 16:13225815-13225837 AGAGAGAGACAGATGGAGGAAGG + Intronic
1134357897 16:13501366-13501388 AAAGAGAGAAAAAGGGAGGATGG + Intergenic
1134648789 16:15891756-15891778 AAAGAGAGAAAGAGGGAGGGAGG - Intergenic
1134851310 16:17481222-17481244 AAAGAAATAAATAAGGAGGAAGG - Intergenic
1134853795 16:17503103-17503125 AAAGAGAGACAGAGAGAGAAAGG + Intergenic
1135529090 16:23237270-23237292 AAAGAGAGAGAAAGGAAGGAAGG - Intergenic
1135533638 16:23275851-23275873 AAACAGATAAACAAGGATGAGGG + Intergenic
1135545785 16:23365319-23365341 AAAGAGAGAAAAAGGGAGGAAGG + Intronic
1135556389 16:23440403-23440425 AATGAGATACAAAGGGAGGTTGG + Intronic
1135606578 16:23831174-23831196 AAAGAGATAGAGGGGAAGGAAGG - Intergenic
1135683674 16:24480205-24480227 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
1135694693 16:24575754-24575776 AAAGAGAGGGAGAGGGAGGAGGG + Intergenic
1135769891 16:25209621-25209643 AAAGAGATAGAAAAGGAAGACGG + Intergenic
1136006690 16:27335359-27335381 AAATAAATAAACAGGGAAGAAGG - Intronic
1137368771 16:47885088-47885110 AAAGAAATAAAAAGAGAGGATGG + Intergenic
1137689753 16:50414687-50414709 AAAGAGACAGAGAGAGAGGAAGG - Intergenic
1137758794 16:50923963-50923985 AAGGAGAAAAAGAGGGAGGATGG + Intergenic
1137902292 16:52281684-52281706 AAAGAGATGCCCAGGGATGCAGG + Intergenic
1137926223 16:52545605-52545627 AAAGAAAAAGAGAGGGAGGAGGG + Intronic
1138210546 16:55159567-55159589 ATACAGAGACACAGGGAAGATGG + Intergenic
1138458791 16:57135916-57135938 AAAGAGAGAGACAGAGAGAAAGG + Intronic
1138813756 16:60180591-60180613 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1139265174 16:65631684-65631706 AACGATATGCACTGGGAGGATGG - Intergenic
1139427068 16:66888049-66888071 AAAGAGAGAGAGAGGAAGGAAGG - Exonic
1139711571 16:68780272-68780294 AATAAAATAAACAGGGAGGAAGG - Intronic
1139966192 16:70746685-70746707 GAAGAAAGACACAGGGCGGAGGG + Intronic
1140049369 16:71466002-71466024 AAAGAGAAAGAAAGGAAGGAAGG + Intronic
1140088281 16:71815807-71815829 AGAGAGAAACAAAAGGAGGAGGG + Intergenic
1140209681 16:72960318-72960340 ACACAGAGACACAGGGCGGAGGG + Intronic
1140328236 16:74026885-74026907 AAAGGGAGAGAGAGGGAGGAAGG + Intergenic
1141064294 16:80901424-80901446 ACAAAGACACACAGGGAAGAAGG + Intergenic
1141086158 16:81096674-81096696 AAAGAGATACACATGTGGAAAGG - Intergenic
1141109316 16:81258936-81258958 AAAGAGAGAGAGAGAGAGGAGGG + Intronic
1141149254 16:81552808-81552830 AAAGAGAGAGGGAGGGAGGAAGG - Intronic
1141161081 16:81629545-81629567 AAGGAGACAGAGAGGGAGGAAGG - Intronic
1141177178 16:81728682-81728704 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
1141315898 16:82962216-82962238 AAACAGATACACAGGGGAGAGGG + Intronic
1141331774 16:83117476-83117498 AAAAAGATCAGCAGGGAGGAGGG - Intronic
1141773015 16:86102296-86102318 AAAGAGAGAGGGAGGGAGGAAGG - Intergenic
1141813067 16:86389460-86389482 AAATAGAAACACAGTGGGGAAGG - Intergenic
1141977279 16:87525269-87525291 ACAGAGACACACAGAGGGGAAGG - Intergenic
1142453226 16:90197210-90197232 AAAAACACACATAGGGAGGAGGG - Intergenic
1142520087 17:498490-498512 AAAGAGAGAGAAAGGGAGGGAGG + Intergenic
1142541443 17:662824-662846 AAAGAGAAAGAAAGGAAGGAAGG + Intronic
1143661241 17:8325813-8325835 AACGAAAGACAAAGGGAGGACGG + Intergenic
1143762336 17:9114455-9114477 AAAAAGATAAACATGGAGGCCGG + Intronic
1143964183 17:10744910-10744932 AGGGAGAGAGACAGGGAGGAGGG + Intergenic
1144132917 17:12265559-12265581 AGACAGAAACACAGGGAAGATGG - Intergenic
1144134151 17:12277225-12277247 ACTGTGATCCACAGGGAGGAGGG + Intergenic
1144232173 17:13218777-13218799 AAAAAGAGAGAAAGGGAGGAAGG - Intergenic
1144267377 17:13584440-13584462 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
1144352921 17:14415882-14415904 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1144455894 17:15418062-15418084 AAAGAGAGACACAGAGGGCAAGG + Intergenic
1144556628 17:16288192-16288214 AAAGAGAAAGAAAGGAAGGAAGG - Intronic
1144870995 17:18370924-18370946 AAAGAGAAAGACAGGAAGAAAGG + Intergenic
1145040566 17:19575072-19575094 AAAGAGAGAAAAAGGGAGGGAGG - Intronic
1145763350 17:27440728-27440750 AAAGAGAGAGAAAGAGAGGAGGG - Intergenic
1146410683 17:32581532-32581554 AAAGAGAGAGAGAGAGAGGAAGG - Intronic
1146587993 17:34099463-34099485 AAAGAGAGAGAAAGGAAGGAAGG + Intronic
1146766827 17:35530352-35530374 AAAGAGAAAGAAAGGAAGGAAGG + Intronic
1146834044 17:36095480-36095502 AAAGAGAGAGAAAGGAAGGAGGG - Intergenic
1146925025 17:36738552-36738574 AGACAGAAAGACAGGGAGGAAGG + Intergenic
1147380106 17:40049851-40049873 AAAGAGATACACATTCAGGCTGG + Intronic
1147864515 17:43543975-43543997 AATTAGATACCCAGGGTGGAGGG + Intronic
1148233503 17:45951917-45951939 AGAGAGAGAGAGAGGGAGGAAGG + Intronic
1148333799 17:46828156-46828178 AAAGAGAGAGACAGAGAGAAAGG - Intronic
1148378672 17:47175028-47175050 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
1148481685 17:47963740-47963762 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1148492537 17:48032603-48032625 CAGGAGAAAAACAGGGAGGAAGG + Intronic
1148548064 17:48531709-48531731 AAAGAGAGAGAGAGGGAAGATGG - Intergenic
1148647615 17:49228229-49228251 AAGGAGAGAGACAGGAAGGAAGG - Intronic
1148679879 17:49467453-49467475 ACAGACATACACTGAGAGGATGG - Intronic
1148716648 17:49720532-49720554 GAAGATATATACAAGGAGGATGG + Intronic
1148733676 17:49852503-49852525 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
1148785787 17:50145633-50145655 AAAGACAGACACAGAGAGGAAGG + Intronic
1148996450 17:51714469-51714491 AAAGAGCTCCAGAGGGAGGAAGG - Intronic
1149382196 17:56105477-56105499 AAAAAGATACAAAGGAAGGATGG - Intergenic
1150078309 17:62213262-62213284 AAAGAGAGAGAGAGGGAGGAAGG - Intergenic
1150296802 17:64014410-64014432 AAAGAGAAAGAAAGGAAGGAAGG + Intronic
1150495409 17:65604317-65604339 CATGAGATCCACTGGGAGGAAGG + Intronic
1150501108 17:65651636-65651658 AAAGAGAAAGAAAGAGAGGAAGG - Intronic
1150624302 17:66831847-66831869 AAAAAGAGACCCAGGGTGGAAGG + Intergenic
1150655084 17:67033912-67033934 CAAGAGATACACAGATGGGAAGG + Intergenic
1150902609 17:69298305-69298327 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
1150918491 17:69459917-69459939 AAAGAGGAACGAAGGGAGGAAGG - Intronic
1151133647 17:71924383-71924405 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
1151188031 17:72378397-72378419 AAAGAGAGAAAGAGAGAGGAAGG + Intergenic
1151264001 17:72939613-72939635 ACAGACACACACAGGGACGAAGG + Intronic
1151443626 17:74149525-74149547 ACAGAGATTCCCAGGGAGGCCGG - Intergenic
1151557380 17:74853337-74853359 AAAGAGAGACAGACAGAGGAGGG + Intronic
1152003242 17:77660460-77660482 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1152456044 17:80416739-80416761 AAAGAGAGACAGAGAGAGGAAGG - Intronic
1153015114 18:576431-576453 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1153498144 18:5721315-5721337 AATGAGGTAGAGAGGGAGGAAGG + Intergenic
1153574243 18:6504738-6504760 AAGGAGAGAAACAGGAAGGAAGG + Intergenic
1153903125 18:9636670-9636692 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
1153987797 18:10368627-10368649 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
1154013406 18:10594883-10594905 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1154111699 18:11574640-11574662 AAAGAGAAAGAAAGGAAGGAAGG + Intergenic
1154152579 18:11918146-11918168 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1154352217 18:13593765-13593787 AAACAAATAAAGAGGGAGGAGGG - Intronic
1154448214 18:14452131-14452153 AAAGAGAGAGGGAGGGAGGAAGG - Intergenic
1155041851 18:22071453-22071475 AAAGAGAGAGAGAGGGAAGAAGG - Intergenic
1155058209 18:22204173-22204195 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1155058233 18:22204271-22204293 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
1155180514 18:23341485-23341507 TAAAAAATACACAGGGAGGGAGG - Intronic
1155524492 18:26702710-26702732 AAAGAGAGAGAGAGGGAGGAAGG - Intergenic
1155557975 18:27042790-27042812 AAAGAGAGAGAGAGGGAGGGAGG - Intronic
1155903745 18:31424126-31424148 AAGGAGAGAAACAGGGAAGATGG + Intergenic
1155945150 18:31840364-31840386 ATAGAGAGACAGAGGGAGGGAGG + Intronic
1156222971 18:35072426-35072448 AAAAAGAGACATAGGAAGGAAGG + Intronic
1156633816 18:39002848-39002870 AAACAGACACACAGAGAAGAGGG - Intergenic
1156829854 18:41478666-41478688 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1156854406 18:41765282-41765304 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
1156898747 18:42276283-42276305 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
1157102448 18:44743064-44743086 AGAGAGAGAGAAAGGGAGGAAGG - Intronic
1157180663 18:45495194-45495216 AAAGACAGACAGAGGAAGGAGGG + Intronic
1157470116 18:47982509-47982531 AAAGAGAGAGAAAGGGAGGGAGG + Intergenic
1158123148 18:54072583-54072605 AAAGAGGTAGAGAGGAAGGAAGG + Intergenic
1158176262 18:54659972-54659994 AAAGAGGTAAAAAGGCAGGAGGG + Intergenic
1158273202 18:55738716-55738738 AGAGAGACAGACAGGGAGGGAGG + Intergenic
1158346178 18:56519228-56519250 AGAGAGAGACAGAGGGAGGGAGG + Intergenic
1158565755 18:58553009-58553031 ACAGAGACACAGAGGGAAGAAGG + Intronic
1158630757 18:59112102-59112124 GAAGGGATGCACAGGGAGGGGGG - Intergenic
1158710226 18:59830897-59830919 CCAGAGAAAGACAGGGAGGAAGG + Intergenic
1158736885 18:60092495-60092517 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1158795277 18:60838488-60838510 CAAAACATACACAGGGAGGGGGG - Intergenic
1158878494 18:61754387-61754409 AGACAGATGCACAGGGAAGAAGG - Intergenic
1159134293 18:64318919-64318941 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
1159236797 18:65685299-65685321 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
1159464627 18:68765243-68765265 AAAGAGCTAAAGAAGGAGGAAGG + Intronic
1159464647 18:68765458-68765480 AAAGAGAGAGAAAGGAAGGAAGG + Intronic
1159950683 18:74480523-74480545 ACAGAGACACACAGGGACAAAGG + Intergenic
1160496822 18:79380785-79380807 AAAGAGACACACAGGCCTGAGGG - Intergenic
1160521128 18:79508758-79508780 ACAGAGAAACAGAGCGAGGAAGG - Intronic
1160724357 19:611027-611049 ACAGAGACACACAGGGGAGAAGG - Intronic
1161117641 19:2507601-2507623 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1161172837 19:2821636-2821658 AGAAAGAGACACAGGGAAGAAGG - Intronic
1161319291 19:3633576-3633598 CAAGAGAGGCAGAGGGAGGAAGG + Intronic
1161501424 19:4618183-4618205 AAAGAGAAACGGAGGGAGAAAGG - Intergenic
1161696100 19:5769161-5769183 AAAGAGAGAGAGAGAGAGGAGGG + Intronic
1161717780 19:5886526-5886548 AAAGAGATACACAGGGAGGAAGG + Intronic
1161995844 19:7710760-7710782 AGAGAGATAGAAAGGAAGGAAGG - Intergenic
1162051606 19:8037333-8037355 AAAGAGAGAGAAAGGAAGGAAGG - Intronic
1162104709 19:8363440-8363462 AAAGAGAGAAAGAGGAAGGAAGG - Intronic
1162157769 19:8691280-8691302 AAAGAAAGAGACAGGGAGAAAGG - Intergenic
1162414690 19:10528334-10528356 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
1162483117 19:10941049-10941071 AGAGAGAGACAGAGGGAGGCAGG + Intergenic
1162504687 19:11076302-11076324 AAAAAGAAAAAAAGGGAGGAAGG - Intergenic
1162877780 19:13633646-13633668 AGAGAGAGAGACAGAGAGGAAGG - Intergenic
1162877783 19:13633678-13633700 AGAGAGAGACAGAGGAAGGAAGG - Intergenic
1162877797 19:13633794-13633816 AGAGAGAGACAGAGGAAGGAAGG - Intergenic
1162877816 19:13633927-13633949 AGAGAGAGACAGAGGAAGGAAGG - Intergenic
1163015808 19:14453538-14453560 AAAGAGAGAGAGAGGGAGGGAGG + Intronic
1163067289 19:14807461-14807483 AAAGAGATGAACAGAGGGGAAGG - Intronic
1163109072 19:15147324-15147346 AAAGAAAGACAAAGGAAGGAAGG + Intergenic
1163124483 19:15237645-15237667 AAACAGAAACACAGGTGGGAAGG + Exonic
1163499895 19:17669912-17669934 AAAGAGAGAGAAAGGAAGGAAGG - Intronic
1163676641 19:18658652-18658674 AAAGAGACACCCAGGGAGAGAGG - Intronic
1163703195 19:18797132-18797154 AGAGAGAGAGACAGGGAGGAGGG - Intergenic
1163726028 19:18923600-18923622 AAAGAGGGGCACAGGGAGAAAGG - Intronic
1163731411 19:18951636-18951658 AAACAGAGGCTCAGGGAGGAAGG - Intergenic
1163755292 19:19103041-19103063 AAACAGACACACAGGGGAGAAGG - Intronic
1164037927 19:21470151-21470173 AAAGAGAGAGAAAGGAAGGAAGG + Intronic
1164186496 19:22874074-22874096 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
1164573430 19:29390564-29390586 AAAGAGAAAGAGAGGAAGGAAGG + Intergenic
1164573457 19:29390833-29390855 AAAGAGAAAGAAAGGAAGGAAGG + Intergenic
1164578423 19:29419399-29419421 AAAGAGAGAGACACGGAGCAGGG + Intergenic
1164582683 19:29444366-29444388 AGAGAGAGAGACAGGGAGGGAGG - Intergenic
1164656558 19:29926078-29926100 AAAGAGAGAAAGAGGAAGGAAGG - Intronic
1164757360 19:30700113-30700135 AAAGAAAGAGACAGGGAGGGAGG - Intronic
1164976536 19:32577034-32577056 AGAGAGAGACAGAGGGAGGGAGG - Intergenic
1165021532 19:32928368-32928390 AAAGAGAGAGAGAGAGAGGAGGG - Intronic
1165278946 19:34780573-34780595 AAAGAAAGAGACAGGGAGGAGGG + Intergenic
1165357806 19:35314544-35314566 AGAGAGAGAGAGAGGGAGGAAGG - Intergenic
1165387513 19:35519510-35519532 AGGGAGAAACACAGAGAGGAAGG - Intergenic
1165476906 19:36035912-36035934 AAAGAGAGACACAGGGAGGTGGG + Intronic
1165850507 19:38847789-38847811 AAGGAGATACACTGGCAGCAAGG + Intronic
1166112873 19:40633717-40633739 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1166548572 19:43649632-43649654 AAAGAGAGAGAGAGGGAGGAAGG + Intronic
1166966015 19:46529621-46529643 AAAGGGAAAGAAAGGGAGGAAGG + Intronic
1167126180 19:47550336-47550358 AAAGAGAAAGAAAGGAAGGAAGG + Intronic
1167248491 19:48388794-48388816 AAAGAGAAAGAAAGGAAGGAAGG + Intronic
1167386022 19:49164315-49164337 AGAGAGACAGAGAGGGAGGAAGG - Intronic
1167530605 19:50013862-50013884 AAAGAAATACACAGCAAGGAAGG + Intronic
1167614962 19:50527717-50527739 AAAGAGAGAAAGAGGGAGGGAGG - Intronic
1167684144 19:50945085-50945107 AAAAAGAGACGAAGGGAGGAAGG - Intronic
1167690240 19:50980594-50980616 ACAGAGACACAGAGAGAGGAGGG + Intronic
1167690281 19:50980762-50980784 ACAGAGACACAGAGAGAGGAGGG + Intronic
1167723124 19:51192525-51192547 CAAGACACACATAGGGAGGAAGG + Intergenic
1167761084 19:51449737-51449759 CAAGACACACATAGGGAGGAAGG - Intergenic
1167763658 19:51464470-51464492 AAAGAGAGACAGAGAGAGAAAGG + Intergenic
1167873450 19:52392281-52392303 AGAGAGAGAGAAAGGGAGGAAGG - Intergenic
1168072084 19:53958995-53959017 AAAGAGAGAGACTGAGAGGATGG - Intergenic
1168090528 19:54080082-54080104 AAAGAGAAAGAAAGGAAGGAAGG + Intronic
1168090588 19:54080473-54080495 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
1168092806 19:54096767-54096789 AAAGAGAGACAGAGCGAGGCGGG - Intronic
1168158295 19:54490992-54491014 AGAGAGAGAGAAAGGGAGGAAGG - Intergenic
1168522297 19:57062002-57062024 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1168690027 19:58370917-58370939 AAAGAGAGAGAGAGGGAGGGAGG + Intronic
1168710114 19:58494725-58494747 CAACAGAAACAAAGGGAGGAGGG - Intronic
925430566 2:3788862-3788884 AAAGAGAGAGAGAGGGAGGGAGG - Intronic
925550205 2:5065535-5065557 AGTGATCTACACAGGGAGGAGGG - Intergenic
925697488 2:6596325-6596347 AAAAAGTTTCACAGAGAGGACGG - Intergenic
925790994 2:7488468-7488490 AAAGAGAAAGGAAGGGAGGAAGG + Intergenic
925791004 2:7488503-7488525 AAAGAGAAAGGAAGGGAGGAAGG + Intergenic
925791015 2:7488538-7488560 AAGGAGATAGGAAGGGAGGAAGG + Intergenic
925791025 2:7488573-7488595 AAAGAGAAAGGAAGGGAGGAAGG + Intergenic
925791059 2:7488689-7488711 AAAGAGAAAGGAAGGGAGGAAGG + Intergenic
925791069 2:7488724-7488746 AAAGAGAAAGGAAGGGAGGAAGG + Intergenic
925791103 2:7488840-7488862 AAAGAGAAAGGAAGGGAGGAAGG + Intergenic
925791124 2:7488910-7488932 AAAGAGAAAGGAAGGGAGGAAGG + Intergenic
925791134 2:7488945-7488967 AAAGAGAAAGGAAGGGAGGAAGG + Intergenic
925791144 2:7488980-7489002 AAAGAGAAAGGAAGGGAGGAAGG + Intergenic
925791175 2:7489088-7489110 AAAGAGAAAGGAAGGGAGGAAGG + Intergenic
925791210 2:7489204-7489226 AAAGAGAAAGGAAGGGAGGAAGG + Intergenic
925913703 2:8589560-8589582 ATAGAGAGAGAGAGGGAGGAGGG + Intergenic
925965689 2:9063088-9063110 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
926110184 2:10177718-10177740 AAAGAGAGAGAGAGGGAGGGAGG - Intronic
926159908 2:10480381-10480403 AAAGAGAGAGAAAGGAAGGAAGG - Intergenic
926184635 2:10679599-10679621 AAAGAGAGAGAAAGAGAGGAAGG - Intronic
926260731 2:11258325-11258347 AAAGAAATACGCAGGTAGTAAGG - Intronic
926536615 2:14121127-14121149 AAAGAAAGACAAAGGAAGGAAGG - Intergenic
926728681 2:16018176-16018198 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
926731571 2:16039452-16039474 AGAGAGGAAGACAGGGAGGAGGG - Intergenic
926746338 2:16161435-16161457 CTGGAAATACACAGGGAGGATGG + Intergenic
926824053 2:16884665-16884687 AAAGAGAGACAGAGGAAGGGAGG - Intergenic
926842272 2:17094327-17094349 GAAGAGGGACACAGGCAGGAGGG - Intergenic
926930277 2:18031039-18031061 AAGAACATACACAGGGAGAAAGG + Intronic
927099108 2:19774260-19774282 AGAGAGAGAGAGAGGGAGGAAGG - Intergenic
927120071 2:19951116-19951138 AAAGAGATAGACAGATGGGAAGG + Intronic
927350362 2:22105503-22105525 ACAGAGACACAGAGGAAGGAAGG + Intergenic
927515141 2:23667876-23667898 AAAGAGGAACAGAGGGAGGACGG - Intronic
928426627 2:31183846-31183868 AAAGAGAGAGAGAGGGAGGGAGG - Intronic
928512439 2:32014023-32014045 AAAGAGAGAGACAGAGAGGGAGG + Intronic
928602076 2:32913585-32913607 GAAGAGAGACACAGGAAGCAGGG - Intergenic
929111454 2:38408487-38408509 AAAGAGAAATACATGGAGGCAGG + Intergenic
929376598 2:41294482-41294504 AGAAAGACACACAGGGAAGAAGG + Intergenic
929452010 2:42044195-42044217 AAAGAGACAGAGAGAGAGGAAGG + Intergenic
929685147 2:44027000-44027022 AGAGAGAGACAGAGGGAGGGAGG + Intergenic
929949682 2:46397493-46397515 AAAAAGAAACACAGGGAGGTTGG + Intergenic
930012947 2:46951544-46951566 AAAGAGAGAGACAGAGGGGAAGG - Intronic
930124787 2:47787027-47787049 TAAGAAATCCACAGGGAGGCTGG + Intronic
930246592 2:48989969-48989991 AAGGAGATAAGCAGGGAGGGAGG - Intronic
930335378 2:50038810-50038832 AAAAAGAAAGAAAGGGAGGAGGG - Intronic
930535689 2:52643500-52643522 AAGGAGACACACAGAGAAGACGG - Intergenic
930616341 2:53598568-53598590 AGAGAGACAGAGAGGGAGGAAGG + Intronic
930793990 2:55368450-55368472 AAAGAGAGAGAGAGGGAGGGGGG - Intronic
931002274 2:57799741-57799763 AAAGAGCTACACAGTGAAGAAGG + Intergenic
931264966 2:60652579-60652601 AGAGACACACACAGGGAAGAAGG + Intergenic
931449180 2:62353294-62353316 AAAGAGAGAGACAGAGAGTAGGG + Intergenic
931584994 2:63816477-63816499 ACACAGAGACACAGGGAGAAAGG + Intronic
932108162 2:68968031-68968053 AAAGAGAGAAAGAGGAAGGAAGG + Intergenic
932154407 2:69403016-69403038 AAAGAGAGAGGGAGGGAGGAAGG - Intronic
932517244 2:72364758-72364780 TAAGAGATAAACAGGGATGAAGG - Intronic
932751509 2:74374403-74374425 ATAGACAAACACACGGAGGAAGG + Intronic
932817975 2:74876908-74876930 AATGAAACACACAGGGAGTATGG - Intronic
933071862 2:77869244-77869266 AAGGAGACATACAGGGAAGAAGG + Intergenic
933233897 2:79842955-79842977 AAAGAGATCCACACAGAGTATGG + Intronic
933234498 2:79850216-79850238 AGAGAGATACAGAGGGAGCGAGG - Intronic
933592862 2:84251805-84251827 AAAGAGAGAGAAAGGAAGGAAGG + Intergenic
933607157 2:84395307-84395329 TAAGAGAGACACAGGCAGGTGGG - Intergenic
933806789 2:86004032-86004054 GAAGAGTTACACAGGCATGAGGG + Intergenic
934012344 2:87836304-87836326 AAAAAGAGAGAGAGGGAGGACGG + Intergenic
934035859 2:88088098-88088120 GAGGAGACAGACAGGGAGGATGG - Intronic
934070943 2:88383337-88383359 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
934135626 2:88993772-88993794 AAAGATGTTAACAGGGAGGATGG - Intergenic
934147038 2:89105058-89105080 ACACAGAGACAGAGGGAGGAGGG - Intergenic
934222228 2:90095537-90095559 ACACAGAGACAGAGGGAGGAGGG + Intergenic
934325230 2:92007685-92007707 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
934579104 2:95424277-95424299 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
934600341 2:95652430-95652452 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
934605721 2:95693793-95693815 AAAGGGAGCGACAGGGAGGACGG - Intergenic
934731888 2:96664136-96664158 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
935201603 2:100861471-100861493 AAAGAAACACAAGGGGAGGAGGG + Intronic
935224719 2:101043491-101043513 AAAGAGATGCCCAGCTAGGAAGG - Intronic
935358447 2:102226659-102226681 AAAGAGAGAGAGAGGGAGGAAGG + Intronic
935602710 2:104939217-104939239 AAAAATATACTCAGGGAGGGTGG - Intergenic
935717238 2:105950115-105950137 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
936539185 2:113336319-113336341 AAAGGGAGCGACAGGGAGGATGG - Intergenic
936673191 2:114683563-114683585 AAAGAGAGAGAGAGGGAGGGAGG - Intronic
936888480 2:117341180-117341202 AGAGACACACAGAGGGAGGAAGG - Intergenic
937061883 2:118986535-118986557 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
937476653 2:122221245-122221267 AAGGAGAGAGAAAGGGAGGAAGG - Intergenic
937683565 2:124670172-124670194 AAAGAGAAAGAGAGGGAGGAAGG - Intronic
937693906 2:124786588-124786610 AAAGAGAAAGAAAGGTAGGAAGG + Intronic
938166723 2:129035552-129035574 AAAGAGAAAGAAAGGAAGGAAGG + Intergenic
938449642 2:131405843-131405865 AAAAAGATACTGAGGGGGGAGGG - Intergenic
938580117 2:132638120-132638142 AAAAAGAGACAGAGGGAGAAAGG + Intronic
938645887 2:133329559-133329581 AAAGAAACAGAAAGGGAGGATGG + Intronic
938869704 2:135462574-135462596 AAAGAGAGAGAGAGGGAGGGAGG - Intronic
939138660 2:138326406-138326428 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
939276089 2:139998251-139998273 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
939827759 2:147035458-147035480 AAAGAGAAAGAAAGGAAGGAAGG + Intergenic
940111194 2:150156126-150156148 GAAGAAATACACAGGGCTGAGGG + Intergenic
940119645 2:150249868-150249890 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
940121121 2:150267372-150267394 AATGAGACAGAGAGGGAGGAAGG - Intergenic
940307864 2:152245760-152245782 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
940563728 2:155334147-155334169 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
940614245 2:156030022-156030044 AAAGAAAGAAAGAGGGAGGAAGG + Intergenic
940739124 2:157486777-157486799 AAAGAGAAAGAGAGGGAGGGAGG - Intronic
940852604 2:158702835-158702857 AGAGAGGTTCACAGGGAGGAAGG - Intergenic
940894189 2:159064598-159064620 AAACAGAGACCCAGGGAGGCTGG - Intronic
940968836 2:159871786-159871808 ACATATATACACAGAGAGGAAGG - Intronic
941021197 2:160408668-160408690 AAAAAGAGACAAAGGGAGGAGGG + Intronic
941099049 2:161277227-161277249 AAAGAGAAAGAGAGGGAGGGAGG - Intergenic
941408771 2:165126430-165126452 AAAGAGAAAGAAAGGAAGGAAGG - Intronic
941421759 2:165291411-165291433 AGAAAGACAGACAGGGAGGAAGG - Intronic
941451547 2:165666253-165666275 AAAGAAAGACAGAGAGAGGAAGG + Intronic
941451582 2:165666515-165666537 AAAGAAAGACAGAGAGAGGAAGG + Intronic
941451589 2:165666564-165666586 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
941451618 2:165666813-165666835 AAAGAGAGAGAAAGGAAGGACGG + Intronic
941451642 2:165666992-165667014 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
941695809 2:168550132-168550154 AGAGAGAGACTGAGGGAGGAAGG - Intronic
941929627 2:170927003-170927025 AAAGAGAGAGAAAGGAAGGAAGG + Intergenic
941999714 2:171633794-171633816 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
942034348 2:171996281-171996303 AAAGAGAGAGAGAGGGAGGGAGG - Intronic
942241656 2:173967798-173967820 TAAGAGATACATATGGAGGTAGG + Intergenic
942305005 2:174598776-174598798 ATAGAGATAAAGAGGGTGGAAGG + Intronic
942365619 2:175223183-175223205 AAAGAGAGAAAGAGGAAGGATGG - Intergenic
942479889 2:176373713-176373735 AAAGAGAGAGAAAGGAAGGAAGG - Intergenic
942671363 2:178379300-178379322 AAAGAAAGAAACAGGAAGGAAGG + Intronic
942890729 2:180983689-180983711 AATGAGACAAAAAGGGAGGAGGG - Intronic
942953896 2:181751715-181751737 AAAGAGAAAGAAAGGAAGGAAGG + Intergenic
942971945 2:181967683-181967705 AAAGAGAAAGAAAGGAAGGAAGG - Intronic
943060933 2:183040715-183040737 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
943479498 2:188400225-188400247 ATAGAGAAACACAGGGAAGAAGG - Intronic
943786558 2:191883948-191883970 AAACAGAGACACAGGGAACACGG - Intergenic
943822174 2:192339283-192339305 AAAGAGATAGAAAGGGAGCTGGG - Intergenic
943997179 2:194784720-194784742 AAGGAGAGACAAAGGGAGGAAGG + Intergenic
944015011 2:195025747-195025769 ACATAGACACACAGGGAAGAAGG + Intergenic
945111679 2:206366225-206366247 AAAGAAAAAGAAAGGGAGGAAGG - Intergenic
945188603 2:207164866-207164888 CAAAAGATACTCAAGGAGGACGG - Intronic
945332006 2:208550932-208550954 AAAGAGAGAGAGAGGGAGGGAGG - Intronic
945456150 2:210054732-210054754 AAAGAAATAAAAAGGGAAGAAGG + Intronic
945529355 2:210931277-210931299 AAGCTTATACACAGGGAGGAGGG - Intergenic
945744645 2:213705261-213705283 AAAGAGAGAGAGAGGGAGGGAGG + Intronic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
945947084 2:216004816-216004838 AAAGAAATACATAGTGAGTAAGG + Intronic
946242546 2:218365792-218365814 AAAGAGAGAAAGAGGAAGGAAGG - Intronic
946517228 2:220425945-220425967 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
946789241 2:223284083-223284105 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
946797338 2:223369802-223369824 AAAGATAAACACAGGGATTATGG - Intergenic
946983788 2:225248807-225248829 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947101543 2:226626452-226626474 AAAGAGATATGCTGGGAGAAGGG - Intergenic
947361834 2:229353299-229353321 ACAGAGATACACAATGATGAAGG + Intergenic
947501977 2:230677471-230677493 AAAGAGAGAGACAGAGAGGGAGG + Intergenic
947805218 2:232961916-232961938 GCAGAGAGAAACAGGGAGGAGGG + Intronic
947926724 2:233927843-233927865 AAAGAGAAAGAAAGGAAGGAAGG - Intronic
948243089 2:236454985-236455007 AAAGAGAAAAAGATGGAGGAGGG - Intronic
948254305 2:236554778-236554800 AGAGAGATACAGCAGGAGGAAGG - Intergenic
948265879 2:236635054-236635076 AAAGAGAGACACAGAGAAGGGGG + Intergenic
948516567 2:238507647-238507669 AAAGAGACACACAGAGTGGCCGG - Intergenic
948829862 2:240593373-240593395 AAAGAGCCAAACAGAGAGGAAGG - Intronic
949084665 2:242141868-242141890 AAAAACACACATAGGGAGGAGGG - Intergenic
1168826785 20:819398-819420 AAAGAGACAGAGAGGGAGGAAGG - Intergenic
1168841324 20:911895-911917 ACAGAGATAGACAGGGAGATAGG + Intronic
1169259441 20:4125019-4125041 AAAGAGAGAGAGAGGAAGGAAGG - Intronic
1169395114 20:5222271-5222293 AAACAGGTACACTGAGAGGAGGG + Intergenic
1169502911 20:6178177-6178199 ACAGAGACACAGAAGGAGGATGG + Intergenic
1169546514 20:6656300-6656322 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1169647004 20:7823082-7823104 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1169817391 20:9672054-9672076 AGAGAGATAATCAGCGAGGAAGG + Intronic
1170327367 20:15171378-15171400 AAAGAGAGACACAAGGAGAAAGG - Intronic
1170466294 20:16625468-16625490 AAAAAGAAAGACAGGGAGGGAGG - Intergenic
1170481942 20:16774722-16774744 AAAGAAATAAAGAGAGAGGAAGG + Intergenic
1170709079 20:18774073-18774095 AAAGAGAGAAAGAGAGAGGAAGG + Intergenic
1170830471 20:19835101-19835123 AAAGAAAGAAAGAGGGAGGAAGG + Intergenic
1170951407 20:20939614-20939636 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
1170988291 20:21278569-21278591 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1170990556 20:21298148-21298170 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
1171069116 20:22049090-22049112 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
1171154552 20:22860165-22860187 AGAGAGAGAGATAGGGAGGAAGG - Intergenic
1171248510 20:23632154-23632176 AAGCAGACACACAGGGAGGCTGG + Intronic
1172072420 20:32268005-32268027 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
1172112609 20:32556173-32556195 ATAGAGACACAGAGGGAGGCAGG - Intronic
1172171745 20:32939637-32939659 AAAGAGAGACAGAGAGAGAAAGG - Intronic
1172425296 20:34851762-34851784 AAAGAGGGACCCAAGGAGGAAGG - Intronic
1172608691 20:36233111-36233133 AAGGAAATACACCGGGAGAAGGG + Intergenic
1172620828 20:36317320-36317342 AAAGAGAGAAAGAGGAAGGAAGG - Intronic
1172635699 20:36408239-36408261 AAAGGGAAGAACAGGGAGGAGGG + Intronic
1172638890 20:36429057-36429079 AAATAAATAAACAGGCAGGAAGG - Intronic
1172855223 20:37996637-37996659 AAGGAGGTACACAGAGGGGAGGG + Intronic
1172865984 20:38097764-38097786 ACACAGAAACACAGGGAAGATGG - Intronic
1172999437 20:39094939-39094961 GAAGAGACACAGGGGGAGGACGG - Intergenic
1173115167 20:40234991-40235013 AAAGAAATAGAGAGAGAGGAAGG + Intergenic
1173145422 20:40520401-40520423 AGAGAGGGACAGAGGGAGGAAGG - Intergenic
1173278417 20:41604748-41604770 AAAGAGGTAAGCAGGGAAGAAGG + Intronic
1173483922 20:43426540-43426562 AAAGAGATGCACATGAAGGCTGG + Intergenic
1173572206 20:44084743-44084765 ACAGATACACACAGGGACGAAGG + Intergenic
1173589632 20:44214445-44214467 AAAGGGATACACAGTGAAGGGGG - Intergenic
1173644255 20:44623706-44623728 AAAGAGAAAGAAAGAGAGGAAGG - Intronic
1173667206 20:44771443-44771465 GAAGAGAGACACAGGTGGGAGGG + Intronic
1173728143 20:45311141-45311163 AAAGAAAGAAACAGGAAGGAAGG + Intronic
1173761552 20:45565011-45565033 AAAGAGAAAGAAAGGAAGGAAGG + Intronic
1173950056 20:46985196-46985218 GGAGAGAGAGACAGGGAGGAAGG - Intronic
1174790031 20:53469607-53469629 AGATAGATAGAGAGGGAGGAAGG + Intronic
1174790067 20:53469751-53469773 AGAAAGATAGAGAGGGAGGAAGG + Intronic
1174790389 20:53472627-53472649 AAAGAGCTCCTCAGGGGGGAGGG + Intronic
1174797388 20:53533642-53533664 AAAGAGAGAGGGAGGGAGGAAGG - Intergenic
1174988129 20:55478940-55478962 AACAAGATTCAGAGGGAGGAGGG + Intergenic
1175070385 20:56328307-56328329 AAAGAGAAAGAAAGGAAGGAAGG + Intergenic
1175162078 20:57016044-57016066 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
1175398912 20:58688272-58688294 TAAGAGATACACAATGAGGTAGG + Intronic
1175413352 20:58785731-58785753 AAAGAGAGAGACAGAGGGGAAGG + Intergenic
1175577960 20:60076784-60076806 ATGCAGCTACACAGGGAGGAAGG - Intergenic
1175979963 20:62733736-62733758 AGAGAGAGACACAGAGAGAAAGG + Intronic
1176017108 20:62939894-62939916 AAAGAGAAAGACAGAGTGGACGG + Intronic
1176221467 20:63971018-63971040 AAAGAGAGAGAAAGGAAGGAAGG - Intronic
1176281242 20:64314369-64314391 AAAAACACACATAGGGAGGAGGG - Intergenic
1176552172 21:8230320-8230342 AAACAGACAGACAGGGAGGGAGG - Intergenic
1176552567 21:8234709-8234731 AAACAGACAGACAGGGAGGGAGG - Intergenic
1176571075 21:8412900-8412922 AAACAGACAGACAGGGAGGGAGG - Intergenic
1176571465 21:8417112-8417134 AAACAGACAGACAGGGAGGGAGG - Intergenic
1176578989 21:8457462-8457484 AAACAGACAGACAGGGAGGGAGG - Intergenic
1176579377 21:8461667-8461689 AAACAGACAGACAGGGAGGGAGG - Intergenic
1176594655 21:8681498-8681520 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1176892272 21:14332429-14332451 AAAGAGAGAAAGAGGAAGGAAGG + Intergenic
1176961413 21:15163270-15163292 ACACAGATAGGCAGGGAGGAGGG - Intergenic
1177269425 21:18827466-18827488 AAAGGAATGGACAGGGAGGAAGG + Intergenic
1177353019 21:19970303-19970325 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
1177580193 21:23011951-23011973 AAAGAGAGACAGAGAGAGGAGGG + Intergenic
1177657810 21:24041861-24041883 AAAGAGATCAAGAGAGAGGATGG - Intergenic
1177783155 21:25640783-25640805 AAAGAGAAAGGAAGGGAGGAAGG - Intronic
1177783706 21:25646595-25646617 AGAGAGAGAGAGAGGGAGGATGG + Intronic
1177851778 21:26357798-26357820 AGAGACACACACAGGGAAGACGG + Intergenic
1178006628 21:28227721-28227743 AAAGAGAAAAAAAGGGAGGGAGG + Intergenic
1178063538 21:28877620-28877642 AAAGAGAGAAATAGGAAGGAAGG + Intronic
1178142277 21:29698072-29698094 AAAGAAGTAAAAAGGGAGGAAGG - Intronic
1178182575 21:30179780-30179802 AAAGTGATAGACAGGGATGGAGG - Intergenic
1178307198 21:31500661-31500683 ACAGAGACACACAGGGATGATGG + Intronic
1178321303 21:31607963-31607985 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1178377976 21:32084059-32084081 AAAGAGAAAGAGAGGGAGGGAGG - Intergenic
1178408049 21:32340778-32340800 AAAGAGAAAAACAGAGAGGGAGG + Intronic
1178899242 21:36585913-36585935 AAAGAGAGAGGGAGGGAGGAAGG - Intergenic
1179112986 21:38463374-38463396 GAAGAAATACACTGGGAGAAAGG + Intronic
1179137212 21:38690125-38690147 AAAGAGAGACAGAGAGAGAAAGG - Intergenic
1179188557 21:39104253-39104275 AGAGAGAGAGAAAGGGAGGAAGG + Intergenic
1179194772 21:39154778-39154800 AAAGAGAGAAAGAGGGAGAAGGG + Intergenic
1179208914 21:39309526-39309548 AAAAAGACACCCAGGGAGGCCGG + Intronic
1179244752 21:39623142-39623164 AAAGAAAGAGAAAGGGAGGAAGG - Intronic
1179244793 21:39623282-39623304 AAAGAGAAACAGAGGAAGGAAGG - Intronic
1179409746 21:41153607-41153629 AAAGAGAAAGAAAGGAAGGAAGG + Intergenic
1180109161 21:45639954-45639976 AAAGAGACACCCAGGACGGACGG - Intergenic
1180277507 22:10658627-10658649 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1181413479 22:22742961-22742983 AGAGAGAAACACATGGAGGTTGG + Intronic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181860867 22:25817189-25817211 AAAGAAAGAAAAAGGGAGGAAGG - Intronic
1181998579 22:26902608-26902630 AGAGAGAAAGACAGGAAGGAAGG - Intergenic
1182083189 22:27543543-27543565 GAAGAGGGAGACAGGGAGGAGGG - Intergenic
1182083194 22:27543558-27543580 AAAGAGAGATATAGGGAAGAGGG - Intergenic
1182129041 22:27837388-27837410 AAAGAGAAAGAAAGGAAGGAAGG + Intergenic
1182129048 22:27837423-27837445 AAAGAGAAAGAGAGGAAGGAAGG + Intergenic
1182332527 22:29561206-29561228 AAAGAGAACCAAAGGGATGATGG + Intronic
1182503621 22:30766373-30766395 AAAGTCATAGCCAGGGAGGAAGG - Intronic
1182507981 22:30799104-30799126 AAAGAGAAAGAAAGGAAGGAAGG - Intronic
1182536642 22:31008669-31008691 TTAGAGATACACAGAGAGGAAGG + Intergenic
1182725336 22:32440897-32440919 AAAAAAATAGACAGGAAGGAAGG - Intronic
1182741718 22:32572499-32572521 AAAGAGAAAGGGAGGGAGGAAGG - Intronic
1182819300 22:33201353-33201375 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
1183038142 22:35155740-35155762 AAATAAATAAACAGGGAGGAGGG + Intergenic
1183102638 22:35593336-35593358 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1183103622 22:35599142-35599164 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1183109443 22:35638199-35638221 ACAGAGACACACAGGGAGGAGGG - Intergenic
1183196219 22:36355399-36355421 AAAGAGAAACGGAGGGAGGGAGG - Intronic
1183232337 22:36590831-36590853 GCAGAGATGCACAGGGAGGGAGG - Intronic
1183275775 22:36896639-36896661 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
1184024886 22:41848246-41848268 AAAAAAATACAGGGGGAGGAGGG - Intronic
1184345434 22:43909980-43910002 AAAGAGAGAGGGAGGGAGGAAGG + Intergenic
1185006800 22:48282815-48282837 AAAGAAATAGAAAGGAAGGAAGG + Intergenic
1185036912 22:48484277-48484299 CAAAAGACGCACAGGGAGGAGGG - Intergenic
1185147925 22:49149497-49149519 AAAGAAAGAAAGAGGGAGGAAGG + Intergenic
1185230024 22:49674574-49674596 AGAGAGACACAAAGAGAGGAAGG + Intergenic
1185359962 22:50400200-50400222 CAAGGGAAACACTGGGAGGAAGG + Intronic
1203257176 22_KI270733v1_random:147134-147156 AAACAGACAGACAGGGAGGGAGG - Intergenic
1203257552 22_KI270733v1_random:151205-151227 AAACAGACAGACAGGGAGGGAGG - Intergenic
1203257945 22_KI270733v1_random:154584-154606 AAAGAGAGAAACAGACAGGAAGG - Intergenic
950156395 3:10724597-10724619 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
950344069 3:12276205-12276227 AAAGAGACAAAGAGGGAGGGAGG + Intergenic
950611517 3:14130048-14130070 AGAGAGAGACAAAGGAAGGAAGG - Intronic
950639396 3:14338999-14339021 AAAAAGATAAACAGCGAGGAAGG - Intergenic
951234034 3:20213619-20213641 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
951253088 3:20416972-20416994 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
951483380 3:23185525-23185547 AAAGAGATACAAAGGGATTGGGG - Intergenic
951752079 3:26047734-26047756 AAAAAGATACACAAGTAAGAGGG + Intergenic
952230526 3:31424905-31424927 AAAGAGAAAGGGAGGGAGGAAGG + Intergenic
952274933 3:31867740-31867762 AAAGAGAAAGGAAGGGAGGAAGG + Intronic
952449124 3:33414271-33414293 AAAAAGAAAGAGAGGGAGGAGGG + Intronic
952652977 3:35748192-35748214 AAAGAGAGAGAGAGGGAGGGAGG + Intronic
952707877 3:36398647-36398669 AAAGAGAAAGAAAGGAAGGAAGG + Intronic
952732125 3:36649599-36649621 GAAGAGATGAAGAGGGAGGATGG - Intergenic
953038003 3:39229677-39229699 AAAGAGATGTAAAGGGAGCAAGG - Intergenic
953082316 3:39632187-39632209 AGAGAGAGAAAGAGGGAGGAAGG - Intergenic
953386438 3:42508890-42508912 AAAAAGAGACACAGGGGGAATGG - Intronic
953640309 3:44700995-44701017 AAAGAGATAGAGAGGAAAGAAGG + Intergenic
953700958 3:45195407-45195429 AAAGAGAAGGAAAGGGAGGAAGG - Intergenic
953853377 3:46482713-46482735 AAAGAGAAAGAAAGGAAGGAAGG + Intronic
953853387 3:46482816-46482838 AAAGAAAGAGAAAGGGAGGAAGG + Intronic
954365116 3:50141509-50141531 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
954953812 3:54500544-54500566 AAAGAGAGAGAAAGGAAGGAAGG - Intronic
954989949 3:54831980-54832002 AGAGAGATAAAGAGGGAGGGAGG - Intronic
955043715 3:55340166-55340188 AAGGAGCCACACAGGGAGGTGGG + Intergenic
955184051 3:56698282-56698304 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
955355778 3:58231151-58231173 AAAGAGAGAGAAAGAGAGGAAGG + Intergenic
955465697 3:59235077-59235099 CTAGAGAAACACAGGAAGGAGGG - Intergenic
955901849 3:63764364-63764386 AAGGAGAGAGACAGGGAGGGAGG + Intergenic
955901857 3:63764402-63764424 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901861 3:63764421-63764443 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901865 3:63764440-63764462 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901871 3:63764474-63764496 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
956119825 3:65955141-65955163 AAACACAGAGACAGGGAGGAGGG + Intronic
956466881 3:69528298-69528320 AAAGAGAGAGAAAGGAAGGAAGG - Intronic
956486018 3:69722693-69722715 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
956677855 3:71752928-71752950 AAATAGATATCCTGGGAGGAAGG + Intronic
956796373 3:72722238-72722260 AAAGAGAGAGGAAGGGAGGAAGG + Intergenic
956821317 3:72956903-72956925 AAACAAAAACACAGGAAGGAAGG + Intronic
957058301 3:75461094-75461116 ACAGAGACACACAGGGGAGAAGG - Intergenic
957119204 3:76068039-76068061 GAAGAAATACACATGGAGGGTGG + Intronic
957467852 3:80618729-80618751 AAAGAAAAACAAAGGAAGGAGGG - Intergenic
957556538 3:81769285-81769307 AGAGAGAGAGAGAGGGAGGAAGG - Intergenic
957587949 3:82156945-82156967 AGAGAGAGACAAAAGGAGGAAGG - Intergenic
957834410 3:85568388-85568410 AAAGAAAGAAAGAGGGAGGAAGG - Intronic
959987532 3:112592327-112592349 AAAGACATACATAGGCAGAATGG - Intergenic
960034805 3:113091729-113091751 AAAGAGAGAGGGAGGGAGGAAGG + Intergenic
960312806 3:116137126-116137148 ACAGAGAGACACTGGGAAGAAGG - Intronic
960446713 3:117758193-117758215 AAAGAGAGAAAGAGGAAGGAAGG - Intergenic
960803719 3:121563150-121563172 AAAGAGATTTAGAGAGAGGAAGG + Intergenic
960840563 3:121954563-121954585 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
960875955 3:122295561-122295583 AAACTGGGACACAGGGAGGAAGG + Intergenic
960879906 3:122333595-122333617 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
961004593 3:123396408-123396430 AAAGAGAGAGAGAGGGAGGGAGG + Intronic
961072754 3:123950609-123950631 AAATGGTTACACAGGGATGAGGG + Intronic
961158956 3:124705864-124705886 AGAGAGAGAAAGAGGGAGGAAGG - Intronic
961180508 3:124872744-124872766 AAAGAGAGAGGGAGGGAGGAAGG - Intronic
961295141 3:125878603-125878625 ACAGAGACACACAGGGGAGAAGG + Intergenic
961879414 3:130050328-130050350 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
961890759 3:130128559-130128581 ACAGAGACACACAGGGGAGAAGG - Intergenic
962079704 3:132124779-132124801 GAAGAGCTACCCAGTGAGGACGG + Intronic
962256590 3:133874087-133874109 AAAGAGGTGGACAGGGAGGCAGG + Intronic
962340059 3:134575167-134575189 AGAGAGAGAGACAGGGAGGGAGG - Intergenic
962391295 3:134974959-134974981 AAAAAGAGACACAGAGAGGATGG - Intronic
962735193 3:138319267-138319289 CAAGAGGGACACAGGGAGGTGGG + Intronic
962794541 3:138838972-138838994 ACAGAGAAACATAGAGAGGAGGG + Intergenic
963196956 3:142543355-142543377 AAAGAGGGACGGAGGGAGGAAGG - Intronic
963197020 3:142543615-142543637 AAAGAAATAGAAAGGAAGGAAGG - Intronic
963235255 3:142949302-142949324 AAACAGATAGACAGTGAGGTAGG + Intronic
963316572 3:143765185-143765207 AGAGAGAGAGAAAGGGAGGAAGG - Intronic
963359222 3:144249061-144249083 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
963473698 3:145776564-145776586 AGGGAGAGAAACAGGGAGGAAGG - Intergenic
963564291 3:146907885-146907907 AGAGAGATAGAGAGGGAGGGAGG + Intergenic
963809829 3:149764623-149764645 AAAGAGAGAGGAAGGGAGGAAGG - Intronic
964526938 3:157625060-157625082 ATAGAGGTACACGGGGAAGAAGG + Intronic
964646246 3:158961061-158961083 AGAGAGAGAGAAAGGGAGGATGG - Intergenic
965280651 3:166747904-166747926 AAAGAGAGAAAGAGGGAGGGAGG - Intergenic
965636392 3:170785734-170785756 AAAGAGAGAGAGAGGGAGGGAGG + Intronic
965655928 3:170984869-170984891 AAAGACATACTGTGGGAGGATGG - Intergenic
965686923 3:171313960-171313982 AGAGAAACACACAGGCAGGAAGG + Intronic
965730358 3:171765056-171765078 AAAGAGAGAGGTAGGGAGGATGG + Intronic
965991323 3:174822158-174822180 AAACACACACACAGGGCGGAGGG + Intronic
966017467 3:175159812-175159834 AAAGAGAGAGAGAGGAAGGAAGG - Intronic
966140728 3:176752746-176752768 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
966272660 3:178126357-178126379 AAAGAGAGAGTGAGGGAGGAAGG + Intergenic
966543740 3:181120558-181120580 AAAGAGAGAGAAAGGAAGGAAGG - Intergenic
966616465 3:181918789-181918811 AAAGAGAGAAAGAGAGAGGAAGG + Intergenic
966647543 3:182263265-182263287 AAAGAGAAAGAAAGGAAGGAAGG + Intergenic
966782646 3:183597108-183597130 AGAGAGAGAGAAAGGGAGGAAGG + Intergenic
966833513 3:184031204-184031226 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
967205113 3:187112548-187112570 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
967232672 3:187355155-187355177 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
967283522 3:187846031-187846053 AAAGAAAGAGAGAGGGAGGAAGG - Intergenic
967507035 3:190264063-190264085 AAAGAGAAAGAAAGGAAGGAAGG + Intergenic
967664821 3:192158555-192158577 AAAGAGAAAGAAAGGGAGGGAGG - Intronic
967802560 3:193679300-193679322 AAAGAGAAAGAGAGGGAGGGAGG + Intronic
968150276 3:196332402-196332424 AAAGAGAGAGAGAGAGAGGAGGG + Intronic
968187355 3:196642419-196642441 AAAGAGGCCCACAGAGAGGAAGG - Intronic
968387676 4:156447-156469 GAAGAGATACAGAGGTATGATGG - Intronic
968738023 4:2308754-2308776 AAAGAGAGAAAGAGGGAGGGAGG + Intronic
968973203 4:3807100-3807122 AGAGAGAGAGAGAGGGAGGAGGG - Intergenic
968985547 4:3872563-3872585 GCAGAGAGACAGAGGGAGGATGG + Intergenic
969002144 4:3990974-3990996 ACAGAGACACACAGGGGAGAAGG - Intergenic
969269130 4:6086812-6086834 GAAGAGAGACACAGAGGGGAAGG + Intronic
969592185 4:8128175-8128197 GCAGAGACACACAGGGAAGACGG - Intronic
969644892 4:8422133-8422155 AAAGAGAAACAGAGAGAGAAAGG + Intronic
970401780 4:15724203-15724225 TAAGAGAAACACAAAGAGGAAGG - Intronic
970535757 4:17028331-17028353 ACAGAGACACACAGGGAAGAAGG + Intergenic
970672415 4:18412095-18412117 AAAGAGAGAGGGAGGGAGGAAGG - Intergenic
970683341 4:18536313-18536335 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
970745111 4:19284766-19284788 AAACAGACACTCAGGGAAGAAGG + Intergenic
970755670 4:19422895-19422917 AAAGAGAGAGAAAGGAAGGAAGG + Intergenic
970769372 4:19592145-19592167 AGAGAGAGAGAGAGGGAGGAAGG + Intergenic
970868675 4:20788007-20788029 AAAGAAAAAAATAGGGAGGAAGG - Intronic
970947693 4:21714466-21714488 AGAGTCAGACACAGGGAGGAAGG + Intronic
970978175 4:22065455-22065477 AAAGAGAGTAACAGGTAGGAGGG + Intergenic
971034173 4:22675142-22675164 AAAGAGAAAGAGAGGGAGGAAGG - Intergenic
971394360 4:26214821-26214843 AAAGAGAAAGAAAGGAAGGAAGG + Intronic
971414861 4:26415484-26415506 TAAGATATACACAAGGAGGTGGG - Exonic
971426578 4:26521848-26521870 ACACAGAGACACAGAGAGGAAGG + Intergenic
971573791 4:28248338-28248360 AAACACACACACACGGAGGAGGG - Intergenic
971726251 4:30316171-30316193 AGAGAGAGAGACAGGAAGGAAGG + Intergenic
971826694 4:31632363-31632385 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
972096353 4:35351457-35351479 AAAGAGAGAGAGAGAGAGGAGGG + Intergenic
972180116 4:36454168-36454190 AAAGACATACACATGGCTGATGG - Intergenic
972415770 4:38839069-38839091 AAAGAGAGAAAGAGGAAGGAAGG + Intronic
972684068 4:41334884-41334906 AGAGAGATACACAGGGTTGGTGG + Intergenic
973076880 4:45940317-45940339 AAAGAGAGAGAAAGGAAGGAAGG + Intergenic
973177815 4:47229726-47229748 AAAGAGACACACAGAGAAGATGG + Intronic
973260743 4:48160816-48160838 AGAGAGAGACAGAGGGAGGGAGG + Intronic
973835615 4:54806417-54806439 AAAGAGAAAGAAAGGAAGGAAGG + Intergenic
974164713 4:58186246-58186268 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
974435910 4:61857049-61857071 AAAGAGAGAGAGAGGGAGGGAGG - Intronic
974458255 4:62156095-62156117 AGAGAGACACACAGGAAGAAAGG + Intergenic
974493811 4:62602068-62602090 AAAGAGAGAGAAAGGAAGGAAGG - Intergenic
974660251 4:64879174-64879196 AAGGAGAGATAGAGGGAGGAGGG - Intergenic
975319157 4:72990456-72990478 AAAGAGAGAGAAAGGGAGGAAGG + Intergenic
975459443 4:74633474-74633496 AAAGAGACAGAAAGAGAGGAAGG - Intergenic
975499309 4:75067641-75067663 ACACAGATACACAGGGGAGAAGG + Intergenic
975504416 4:75122597-75122619 AAAGAGAGAGGGAGGGAGGAAGG + Intergenic
975678072 4:76847507-76847529 ACAGAGAGACATAGGGAAGAAGG - Intergenic
975845474 4:78520350-78520372 GAAGAGGAAAACAGGGAGGATGG - Intronic
975921965 4:79401915-79401937 AAAGAGAAACAAGGTGAGGAAGG - Intergenic
976022834 4:80651250-80651272 AAAGAGAAAGAAAGGAAGGAAGG - Intronic
976126079 4:81835053-81835075 AAGGAGGAACAGAGGGAGGAAGG + Intronic
976204004 4:82607292-82607314 ACAAAGAAACACAGGGAGAAAGG + Intergenic
976486146 4:85607349-85607371 AAAGAGAGAGAGAGGGAGGGAGG + Intronic
976697036 4:87927744-87927766 AAAAAGAGACAGAGGGAGGGAGG - Intergenic
977200239 4:94106697-94106719 ACAGAGACACAGAGGGAAGATGG - Intergenic
977420174 4:96789643-96789665 AGAGAGAGAGGCAGGGAGGAGGG - Intergenic
978251988 4:106641779-106641801 AATGAGAAAAACAGAGAGGAGGG - Intergenic
978673813 4:111285034-111285056 AAATAAATACACAGGGAAAAGGG - Intergenic
978760560 4:112352883-112352905 AAAGAGAAAGAAAGGAAGGAAGG - Intronic
978832325 4:113102931-113102953 AAAGTGTAACACAGGGAGGAGGG + Intronic
978900806 4:113947511-113947533 AAAGAGAGAGAGAGGGAGGGAGG + Intronic
979262096 4:118660109-118660131 AAAAACACACATAGGGAGGAGGG - Intergenic
979544381 4:121923052-121923074 AGAGAGAGAGACAGAGAGGAGGG + Intronic
979562739 4:122118787-122118809 AGATAGATACATAGAGAGGAAGG + Intergenic
979740809 4:124148298-124148320 GAAGAGAAAGAGAGGGAGGAAGG - Intergenic
980121327 4:128731299-128731321 AGAGAGAAAGAGAGGGAGGAAGG + Intergenic
980308362 4:131094876-131094898 AATGAGTTACACTGGAAGGATGG - Intergenic
980332313 4:131425951-131425973 AAAGAGAAAGAAAGGAAGGATGG + Intergenic
980521895 4:133946747-133946769 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
980568898 4:134584164-134584186 AGAGAGAGACAGAGAGAGGAAGG - Intergenic
980588009 4:134844566-134844588 AGAGAGAGAGACAGGGAGGGAGG - Intergenic
980838359 4:138225898-138225920 AAAGAGGCAGGCAGGGAGGAAGG + Intronic
980846255 4:138329119-138329141 AAAGAGAGAAAGAGGAAGGAAGG + Intergenic
980898381 4:138880990-138881012 AGAGAGATAGAGAGAGAGGAGGG - Intergenic
980928681 4:139164097-139164119 AGAGAGAGAAAGAGGGAGGAAGG + Intronic
981489947 4:145328464-145328486 AAAGAGAGAGGGAGGGAGGAAGG + Intergenic
981530415 4:145747717-145747739 AAAGAGAAAGAGAGAGAGGAAGG - Intronic
981809291 4:148755221-148755243 AGAGAGAGAGAAAGGGAGGAGGG - Intergenic
981826997 4:148954616-148954638 ACACAGAGACACAGAGAGGAAGG - Intergenic
982129031 4:152210431-152210453 AAAGAAAGAGAGAGGGAGGAAGG + Intergenic
982308833 4:153962722-153962744 ACAGAGAGACACAGAGAGGAAGG + Intergenic
982362393 4:154533995-154534017 TAATAGAAACAAAGGGAGGAGGG - Intergenic
982502360 4:156172923-156172945 AAAGGGATAAACAGGAAGGAAGG + Intergenic
983004783 4:162470650-162470672 AAAGCAATACATAGGGAGAAAGG + Intergenic
983149743 4:164263243-164263265 AAAAACACACATAGGGAGGAGGG + Intronic
983188551 4:164729092-164729114 AGAGAGATAGACAGGGAAAAGGG - Intergenic
983658767 4:170110753-170110775 AAAGAAAAAAAGAGGGAGGAAGG - Intergenic
983868169 4:172792845-172792867 ATATAGATAAAGAGGGAGGAAGG - Intronic
983906670 4:173190368-173190390 AATGAGATAGAAAGGGAGAAAGG + Intronic
983945737 4:173583780-173583802 AAAGAGAGAGGAAGGGAGGAAGG - Intergenic
984026004 4:174544287-174544309 AAAGAAAGAAACAGGGAGGAAGG + Intergenic
984359773 4:178713661-178713683 ACAGAGAGAAACAAGGAGGAAGG + Intergenic
984767070 4:183407947-183407969 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
984783887 4:183551198-183551220 AAAGAGAGAGAAAGGAAGGAAGG + Intergenic
984883853 4:184432731-184432753 ACACAGACACAGAGGGAGGATGG + Intronic
985024923 4:185731501-185731523 AGAGAGATAGGCAGGGAGGGAGG - Intronic
985024939 4:185731551-185731573 AGAGAGATAGGCAGGGAGGGAGG - Intronic
985024949 4:185731587-185731609 AGAGAGATAGGCAGGGAGGGAGG - Intronic
985025011 4:185731811-185731833 AAAGAGAGAGACAGGCAGGGAGG - Intronic
985219224 4:187685200-187685222 AAAGAGAGAGGGAGGGAGGAAGG - Intergenic
985263481 4:188136743-188136765 AAAGAGAAAGACTGGGAGGTAGG + Intergenic
985661636 5:1160131-1160153 AGAGAGAGACACAGAGAGGGAGG + Intergenic
985777685 5:1853360-1853382 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
985886214 5:2681615-2681637 AAAGAGAGAGAAAGGAAGGAAGG + Intergenic
985888377 5:2697546-2697568 AAAGAGTCACACACGGAAGAGGG - Intergenic
986055304 5:4130685-4130707 ACAGATACACTCAGGGAGGATGG - Intergenic
986102380 5:4625862-4625884 CAAGAGAGACAAAGAGAGGAAGG - Intergenic
986293939 5:6422116-6422138 TCAGAGACACACAGGGAAGAGGG + Intergenic
986673851 5:10166974-10166996 GAGGAGACACACAGGGAAGAAGG + Intergenic
986691504 5:10317361-10317383 AGAGAGAGAGAAAGGGAGGAAGG - Intergenic
986784185 5:11096766-11096788 AGAGAGAGACAGAGGGAGGGAGG + Intronic
986790495 5:11154893-11154915 AGAGAGACACACAGGGAAGAAGG - Intronic
987052248 5:14157406-14157428 AGAGGGAGACACAGGGAGGGAGG - Intronic
987094717 5:14538348-14538370 AAAGAGAGAGAAAGGAAGGAAGG - Intergenic
987163528 5:15170281-15170303 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
987220694 5:15788098-15788120 ACAGAGACACACCGGGAAGAAGG - Intronic
987468716 5:18304314-18304336 AAAGAGAGAGACAGAGAGGGTGG - Intergenic
987824582 5:23012581-23012603 AAGGAGAGAGAAAGGGAGGAAGG - Intergenic
987871489 5:23624216-23624238 AAAGAGAGGGACAGGGAGGATGG + Intergenic
987886832 5:23823978-23824000 AACAAGGTACACAGGGTGGATGG - Intergenic
988181419 5:27799070-27799092 AAAGAGAAAGAAAGGAAGGAAGG + Intergenic
989331356 5:40262784-40262806 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
989525382 5:42447712-42447734 AAAGAGAGAGAGAGGGAGGGAGG - Intronic
989665233 5:43846328-43846350 AAGGAGGGAGACAGGGAGGAAGG - Intergenic
989703884 5:44304373-44304395 AAAGAAATAGAAAGGGATGAAGG + Exonic
989814281 5:45717622-45717644 AAAGAGAAACAAAGGGTAGAAGG - Intergenic
989955267 5:50351700-50351722 AAAGAGAGAAGGAGGGAGGAAGG + Intergenic
990011313 5:51002462-51002484 AAAGAGAGAAAGAGAGAGGAAGG - Intergenic
990029544 5:51240346-51240368 AGAAAGATATACAGGCAGGAAGG + Intergenic
990616839 5:57517246-57517268 GAAGAGAAACACATGGAGTAAGG + Intergenic
990846014 5:60140518-60140540 AAAGAGAGAGAAAAGGAGGAAGG + Intronic
991255936 5:64614844-64614866 AAAGAGAGAGAAAGGAAGGAAGG + Intergenic
991548615 5:67811838-67811860 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
991597584 5:68321342-68321364 AAGGAAAGAGACAGGGAGGAAGG - Intergenic
992300695 5:75376477-75376499 AAAGAGACACACAGCGAAGCAGG + Intronic
992530016 5:77644769-77644791 AAAGAGAGAGAAAGGGAAGAGGG - Intergenic
992553662 5:77883086-77883108 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
992575591 5:78107430-78107452 AAAGAGAGAGAGAGGGAGCATGG - Intronic
992829371 5:80579326-80579348 AAAGAGAAAGAAAGGGAGAAAGG + Intergenic
993248003 5:85476756-85476778 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
993456566 5:88133767-88133789 AAAGAGAAAGAAAGGAAGGAAGG + Intergenic
993481181 5:88426305-88426327 AAAGAGAGAGAGAGGGAGGTGGG + Intergenic
993526663 5:88973678-88973700 AAAAAGAGAGACAGGGAGGTGGG + Intergenic
993875821 5:93305505-93305527 AAGGAGAAAAAGAGGGAGGAAGG + Intergenic
994132912 5:96250991-96251013 ACAGAGATACAAAGGTACGAAGG + Intergenic
994606824 5:101978355-101978377 ACAGAGCTAAACAGGGAGGGAGG + Intergenic
994799189 5:104349489-104349511 AAAGAGAACCACACGGAAGAAGG + Intergenic
995469968 5:112490955-112490977 ATAGAGACACAGAGGGAGGAAGG + Intergenic
995528122 5:113066981-113067003 AAAGAGAGACCCAAGGAGAAAGG - Intronic
995530631 5:113088597-113088619 ACAGAGAGACACAGGGAAGAAGG + Intronic
995837065 5:116409597-116409619 ACACAGATACACATGGGGGAAGG + Intronic
996408585 5:123130364-123130386 AAAGAGAGAAAAAAGGAGGAGGG - Intronic
996430568 5:123371602-123371624 AACTAGAACCACAGGGAGGATGG + Intronic
996537543 5:124594109-124594131 AGAGAGATAATCAGGGAAGAAGG + Intergenic
996837766 5:127812922-127812944 TTAGAGATAAACAGGTAGGAGGG - Intergenic
997577660 5:134995002-134995024 AAAGAGAGAGAGAGGGATGAAGG - Intronic
997872610 5:137518465-137518487 AAAGAGAAAGAAAGGAAGGAAGG + Intronic
998102561 5:139446390-139446412 AAAGAAAGAAAAAGGGAGGAAGG - Intergenic
998258186 5:140606145-140606167 AAAGAAAGAGAGAGGGAGGAAGG - Intergenic
998333172 5:141347118-141347140 AGAGAGAAACAGAGGAAGGAAGG - Intronic
998408698 5:141890639-141890661 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
998688796 5:144562895-144562917 AAAGACAAAGACAGGAAGGAAGG - Intergenic
998824059 5:146083332-146083354 ATAGAGACACAGAGGGAAGACGG - Intergenic
999030426 5:148284314-148284336 AAAGAGGGAGAGAGGGAGGAAGG - Intronic
999072779 5:148765218-148765240 AAAGAGAGAGAAAGGAAGGAAGG - Intergenic
999104932 5:149062815-149062837 AAACACTTACCCAGGGAGGAAGG + Intronic
999163438 5:149526114-149526136 AAATAGATAAATAAGGAGGAAGG - Intronic
999298584 5:150476108-150476130 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
999416955 5:151406564-151406586 AAAGAGAAACACAGGAAAAATGG + Intergenic
999683980 5:154085991-154086013 AAAGAGATACAGAGAGAGAAAGG - Intronic
999797406 5:155001467-155001489 ATAGAGACACAGAGGGAAGATGG + Intergenic
1000133214 5:158319905-158319927 ATAGAAAATCACAGGGAGGAGGG - Intergenic
1000182250 5:158822713-158822735 ACAGAGATACACCAGGAGGGTGG + Intronic
1000288300 5:159846765-159846787 AAAAAGATTCAGAGGCAGGATGG + Intergenic
1000398263 5:160798444-160798466 ACAGAGACAGACAGGGAAGAAGG + Intronic
1000428046 5:161115963-161115985 AAAGAGAGAAAGAGGAAGGAAGG + Intergenic
1000508106 5:162147338-162147360 AAAGAGAGACAGAGGAAGGAAGG - Intronic
1000693667 5:164353241-164353263 AAAGATCTACTCAGGGAGGGAGG - Intergenic
1000964031 5:167633669-167633691 AAAGAGGGAGAAAGGGAGGAAGG - Intronic
1001003763 5:168031665-168031687 AAAGAGGGAAAGAGGGAGGAAGG + Intronic
1001079308 5:168655360-168655382 ACACAGACACACAGGGAAGAAGG + Intergenic
1001329423 5:170751933-170751955 AGAGAGATACTCAAGGAGGAGGG + Intergenic
1001419904 5:171578582-171578604 AAAGAGAGATAGAGGAAGGAAGG + Intergenic
1001511071 5:172322374-172322396 AAGGAGAGAGATAGGGAGGAAGG - Intergenic
1001530998 5:172461650-172461672 AAGGAAATACACAGGGAGGTCGG - Intergenic
1001569920 5:172723874-172723896 AAGGAGAGAAAGAGGGAGGAAGG + Intergenic
1001588336 5:172848715-172848737 AAGTAGAGAGACAGGGAGGAAGG + Intronic
1001635014 5:173203426-173203448 AAAGAAAGAAAGAGGGAGGAGGG - Intergenic
1001690924 5:173631730-173631752 AGAGAGAAAGAGAGGGAGGAAGG - Intergenic
1001828968 5:174769143-174769165 AAAGAGAAAGAAAGGAAGGAAGG + Intergenic
1001991411 5:176118677-176118699 AAAGAGAGAAAAAGGGAGGGAGG - Intronic
1002171937 5:177379743-177379765 AAAGAGAAAGAAAGGAAGGAAGG - Intronic
1002225464 5:177719452-177719474 AAAGAGAGAAAAAGGGAGGGAGG + Intronic
1002268384 5:178051753-178051775 AAAGAGAGAAAAAGGGAGGGAGG - Intronic
1002650501 5:180688942-180688964 AAAAAGATACTGAGGGGGGAGGG + Intergenic
1003061109 6:2863435-2863457 AAAGAGCTATAGAGAGAGGAGGG - Intergenic
1003315853 6:5011350-5011372 AAAGAGACACAGCAGGAGGAAGG + Intergenic
1003514390 6:6805989-6806011 ACAGGGAGACACATGGAGGATGG + Intergenic
1003736743 6:8886301-8886323 AAAGAAAGACAGAGGAAGGAAGG - Intergenic
1003926888 6:10884529-10884551 AAAGAGAGAGAGAGAGAGGAAGG + Intronic
1003934060 6:10957471-10957493 ACAGTGATAGACAAGGAGGAGGG + Intronic
1004184356 6:13409212-13409234 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
1004355080 6:14923614-14923636 CAAGAGATACAAAGGGACTAAGG - Intergenic
1004402393 6:15300740-15300762 AGAGAGAGAGACAGAGAGGAGGG + Intronic
1004917364 6:20344499-20344521 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
1005329540 6:24736260-24736282 ACAGAGATACACAGAGAAGAAGG + Intergenic
1005497614 6:26402102-26402124 AAAGAGATAAACAGTAAGGGAGG + Intergenic
1005601819 6:27433887-27433909 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
1005704361 6:28436718-28436740 AAAGGGAAACAAATGGAGGATGG + Intronic
1005976619 6:30804978-30805000 GAAGAGATGCACAGGGAGAAGGG + Intergenic
1005989852 6:30896085-30896107 ACAGAGGCACACAGAGAGGAGGG - Intronic
1006165405 6:32061726-32061748 AAAAAGGGACACAGAGAGGATGG + Intronic
1006705199 6:36014210-36014232 TAAGTGACACACAGAGAGGAAGG - Intronic
1006755267 6:36410009-36410031 AAAGAGAAAGAAAGGAAGGAAGG + Intronic
1007046753 6:38783529-38783551 AAGGAGAGACACAGGAAGGAAGG - Intronic
1007514784 6:42402398-42402420 AAAGAGAAACACCGGGTGCAGGG + Intronic
1007522840 6:42465685-42465707 AGAGAGAGACAGAGGAAGGAAGG - Intergenic
1007530810 6:42540318-42540340 AAAGAGAGAGAAAGGAAGGAAGG + Intergenic
1007616647 6:43183729-43183751 AAAGAGAGAGAGAGGAAGGAAGG - Intronic
1007736254 6:43984099-43984121 ACAGAGAGACAGAGGGAAGAAGG - Intergenic
1008136482 6:47783389-47783411 AAAAAGAGAGAAAGGGAGGAAGG - Intronic
1008196000 6:48521605-48521627 AAAGAGAAAAACTGGGAGAATGG + Intergenic
1008209699 6:48705320-48705342 AAAGAGAAAGAAAGGAAGGAAGG + Intergenic
1008637292 6:53423716-53423738 AAAGAGAGAGAAAGAGAGGAAGG - Intergenic
1008684095 6:53904942-53904964 AAAGGCATACACATAGAGGAAGG + Intronic
1008869879 6:56260614-56260636 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
1009324670 6:62336344-62336366 AAATAGACAGACATGGAGGATGG + Intergenic
1009411863 6:63374693-63374715 AAATGGATCCACAGGGAGGCTGG + Intergenic
1009828334 6:68897395-68897417 AAAGAGAGAGAGAGGGAGGGAGG + Intronic
1010056352 6:71569960-71569982 AAATAGATACTTAGGGAAGAGGG - Intergenic
1010059273 6:71603926-71603948 AGAGAGAGAGAGAGGGAGGAGGG - Intergenic
1010063564 6:71653678-71653700 AAAGAGAAACTCATGCAGGAAGG - Intergenic
1010138230 6:72581169-72581191 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
1010772330 6:79845892-79845914 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1011069933 6:83369638-83369660 AAAGAGAGACAGAGAGAGGAAGG + Intronic
1011208283 6:84925390-84925412 AAAGAGATACAAATGGATTATGG - Intergenic
1011280302 6:85670833-85670855 AGAGAGAGAGAAAGGGAGGAAGG - Intergenic
1012064266 6:94529488-94529510 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
1012306887 6:97669443-97669465 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1012519986 6:100109876-100109898 AAGGAGAGAGAAAGGGAGGATGG - Intergenic
1012669493 6:102024232-102024254 AAAGAGAAACAGAGGTAGGCTGG + Intronic
1012734301 6:102919649-102919671 AAAGAAAAAGAGAGGGAGGAGGG + Intergenic
1013309604 6:108880841-108880863 AAAGAGAAAAAAAGGAAGGAAGG - Intronic
1013691773 6:112653131-112653153 AAAGAGGGAGAGAGGGAGGAAGG - Intergenic
1013916919 6:115351504-115351526 AAAGAGAGAGGCAGGGAGGGAGG + Intergenic
1014008919 6:116454167-116454189 AGAGAGAGAGACACGGAGGATGG + Intergenic
1014075264 6:117228183-117228205 ACAGAGAAACAAAGTGAGGAGGG - Intergenic
1014118676 6:117697351-117697373 AAAGACATACAGTGGGCGGATGG + Intronic
1014233008 6:118925047-118925069 AAAAAGAAAGACAGGGAGGGAGG + Intronic
1014332162 6:120082526-120082548 AAAGAGAGACAAAGGAAAGAGGG - Intergenic
1014616679 6:123610278-123610300 AAAGAAATTCACAGTGAGAATGG - Intronic
1014835100 6:126152006-126152028 AAAGAGAGAAAAAGGAAGGAAGG - Intergenic
1015049459 6:128821701-128821723 AAAGAAAAAAACAGGGAGTAGGG + Intergenic
1015085533 6:129286962-129286984 AAAGAAAGAAACAGAGAGGAAGG + Intronic
1015178951 6:130341128-130341150 AAAGAAACACAGAGGGAGGGAGG + Intronic
1015478413 6:133679564-133679586 AAAGAGAGACACAGATAAGAGGG + Intergenic
1015546990 6:134371380-134371402 ACACAGATGTACAGGGAGGAAGG - Intergenic
1015771204 6:136769927-136769949 AAAAAGAGACAGTGGGAGGAAGG + Intronic
1015848357 6:137546049-137546071 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1015949938 6:138542150-138542172 AGAGAAACACACAGGAAGGAAGG + Intronic
1016004635 6:139077042-139077064 ACAGACACACACAGGGAAGAAGG + Intergenic
1016287536 6:142489851-142489873 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
1016290324 6:142522044-142522066 AAAGAGAGAGACAGTGAAGAAGG + Intergenic
1016301692 6:142638804-142638826 AAAGAGAAAGAGAGGAAGGAAGG + Intergenic
1016446933 6:144143427-144143449 AAAGATATGGACAGGGTGGAGGG + Intergenic
1016681705 6:146837805-146837827 AAAGAGATAGAGAGAAAGGAAGG + Intergenic
1016793380 6:148090323-148090345 AGAGAGAGACACAGAAAGGAAGG + Intergenic
1016917093 6:149254044-149254066 AAAGAGGGAGAGAGGGAGGAAGG + Intronic
1017138832 6:151171960-151171982 AAAGAGAGAGGAAGGGAGGAAGG - Intergenic
1017447267 6:154518127-154518149 AAAGAGAGAGAGAGGAAGGAGGG + Intergenic
1017479316 6:154834447-154834469 AAAGAGATACACTGGTAGTTTGG + Intronic
1017552149 6:155520508-155520530 AAGGAGATACACAGGCAAGAAGG - Intergenic
1018003491 6:159599869-159599891 ACAGAGTTACACAGGAAAGATGG - Intergenic
1018285729 6:162235819-162235841 AAAGAGAGAGAGAGGGAGGGAGG + Intronic
1018308931 6:162488627-162488649 GAAGTGATACTCAGAGAGGACGG - Intronic
1018631480 6:165826440-165826462 ACAGAGAGACACAGGGACAAAGG - Intronic
1019066829 6:169309364-169309386 AATGATAGACACTGGGAGGAGGG + Intergenic
1019273973 7:166275-166297 AAAGAGGGAGAGAGGGAGGAAGG - Intergenic
1019425102 7:971338-971360 AAACAGACACACACGGAGGTTGG + Intronic
1019489250 7:1303737-1303759 AAAGAGAAAGAGAGGGAGGGAGG + Intergenic
1019667685 7:2260023-2260045 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
1019678807 7:2332813-2332835 AAAGAGAAAGAAAGGAAGGAAGG + Intronic
1019809281 7:3152706-3152728 AGAGAGAGAGAGAGGGAGGAAGG + Intronic
1019820995 7:3242592-3242614 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1019821000 7:3242661-3242683 AGAGAGAGACAGAGAGAGGAGGG - Intergenic
1020025775 7:4898912-4898934 AAAGAGAGACAGAGGAAGGAAGG + Intergenic
1020073489 7:5242552-5242574 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1020206034 7:6116993-6117015 AGAGAGAAAGAGAGGGAGGAAGG - Intronic
1020412863 7:7912415-7912437 AAAGAAAAACAAAGGGAAGAAGG - Intronic
1020460828 7:8427841-8427863 AAAGAGAGAGAAAGGAAGGAAGG + Intergenic
1020646102 7:10816133-10816155 ACAGAGAGACATAGGGAAGAAGG + Intergenic
1020731171 7:11882590-11882612 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
1021225633 7:18022617-18022639 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1021486295 7:21172136-21172158 AAAGAGAAAAAAAGGGAAGATGG - Intergenic
1021751677 7:23806920-23806942 AAAGAGAGATACAGGATGGACGG + Intronic
1021816128 7:24449251-24449273 AGAGAGAGACGCAGGGAAGAAGG - Intergenic
1021883619 7:25116976-25116998 GAAGAGATACACTGAGAGGCTGG + Intergenic
1021918347 7:25457585-25457607 AGAGAGAGAGAGAGGGAGGAAGG + Intergenic
1022212778 7:28227750-28227772 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
1022234774 7:28450686-28450708 GAAGAGAAACACAGGGTGGCAGG + Intronic
1022361384 7:29662872-29662894 AAAGAGAGACGAAGGAAGGAGGG - Intergenic
1022368899 7:29752053-29752075 AAAGTGAAACCAAGGGAGGAAGG + Intergenic
1022638640 7:32160836-32160858 AAAGAGAGAGAAAGGGAGGGAGG + Intronic
1022662516 7:32380213-32380235 AAAGAGAGAGAGAGAGAGGATGG - Intergenic
1022700055 7:32751166-32751188 AAAGAGAGACAAAGGAAGGAGGG + Intergenic
1023082861 7:36542146-36542168 ACAGACATACACCAGGAGGAAGG + Intronic
1023159303 7:37282196-37282218 CAGGAGGTCCACAGGGAGGAAGG + Intronic
1023176562 7:37441151-37441173 AAAAAGACACAAAGGGCGGAAGG + Intronic
1023601520 7:41885864-41885886 AGAGAGATAAACAGGGATGAAGG - Intergenic
1023759056 7:43446764-43446786 AAAAAGAAACACAGGCAGAAAGG + Intronic
1024304359 7:47914718-47914740 AGAGAGAAAGAGAGGGAGGAAGG - Intronic
1024538076 7:50454763-50454785 AAAGAGTCACAGAGGGAAGAAGG + Intronic
1024586840 7:50849529-50849551 AAGGACATGCACAGGGAGCAGGG - Intergenic
1025216163 7:57058396-57058418 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1025294824 7:57769111-57769133 AAGGTGAAACACAGAGAGGAAGG - Intergenic
1025655217 7:63512308-63512330 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1025737730 7:64166647-64166669 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
1025746419 7:64246749-64246771 AAAGAGAAAGAAAGGAAGGAAGG + Intronic
1025957460 7:66193721-66193743 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
1026099079 7:67369879-67369901 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
1026494119 7:70888062-70888084 AAAGAGAAAAAGAGAGAGGAAGG + Intergenic
1026521165 7:71119301-71119323 AAAGAGAAAGGAAGGGAGGAAGG - Intergenic
1026529563 7:71185176-71185198 AGAGAGAGACAGAGAGAGGAAGG - Intronic
1026615379 7:71897990-71898012 AAAGAGAGAGAGAGGGAGGGAGG + Intronic
1026655453 7:72252619-72252641 AAAGAAAGACAGAGGAAGGAAGG + Intronic
1026657125 7:72266547-72266569 AAATCCACACACAGGGAGGAAGG - Intronic
1026677154 7:72437686-72437708 AAAGAGAGAGGGAGGGAGGAAGG - Intronic
1026804051 7:73418495-73418517 AGAGAGAGAGACAGGGAGGGAGG - Intergenic
1026904038 7:74052604-74052626 AAAGAGAGAGACAGGAAGGAAGG + Intronic
1027290700 7:76707343-76707365 AAAGAGAGACAGAGAGAGAAAGG + Intergenic
1027303593 7:76868091-76868113 AAAAAGATAAAAAAGGAGGAAGG + Intergenic
1027416868 7:77983341-77983363 AAAGAGAGACAGAGGGAGGGAGG - Intergenic
1027722210 7:81758447-81758469 AAAAATAAACAGAGGGAGGAAGG + Intronic
1027769881 7:82393016-82393038 AAAGAGACAGAGAGAGAGGAAGG + Intronic
1027969510 7:85060661-85060683 AAAGAGTTTCATAGGGAGAAAGG - Intronic
1028066983 7:86398153-86398175 AAGGAGATAGTCAGGGAGCAGGG - Intergenic
1028210568 7:88069196-88069218 AAGGAGAAACATAGGGAGGAAGG - Intronic
1028233566 7:88333222-88333244 AAAGAGATACAGGGAAAGGAAGG - Intergenic
1028311182 7:89338522-89338544 AAAGAGAAAGAAAGGGTGGAGGG + Intergenic
1028369764 7:90077917-90077939 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1028519302 7:91712108-91712130 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
1028665640 7:93340858-93340880 AAAGGGATACCCAGGAAGCAGGG - Intronic
1028696374 7:93717712-93717734 AAAGAGAAAGAAAAGGAGGAAGG + Intronic
1028997241 7:97114802-97114824 AAAAAGAAACACATGAAGGAAGG + Intergenic
1029141579 7:98414619-98414641 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
1029162394 7:98561948-98561970 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1029401690 7:100351194-100351216 AAAGAGAGAGAGAGGGAGGGAGG - Intronic
1029580553 7:101434234-101434256 AAAGAGAGAGACAGGAGGGAGGG - Intronic
1029607798 7:101609509-101609531 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1029625556 7:101718393-101718415 AAAAGGCTACACAGGGTGGAGGG + Intergenic
1030062142 7:105630913-105630935 AAAGAGACACACAGGAAAGGTGG + Intronic
1030174409 7:106636433-106636455 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1030203413 7:106928741-106928763 AAAGAGAGAGAAAGGGAGGGAGG + Intergenic
1030206494 7:106957090-106957112 AGAGAGAGAGAAAGGGAGGAAGG + Intergenic
1030344523 7:108417389-108417411 CAAGAGAGACACAGGGAAGGGGG + Intronic
1030412845 7:109203499-109203521 ACCAAGAAACACAGGGAGGAAGG + Intergenic
1030633917 7:111926540-111926562 AAAGAGAAAGAAAGGAAGGAAGG + Intronic
1030802479 7:113869165-113869187 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
1030929584 7:115505580-115505602 AAAGAGACACATAGGGTGTAAGG - Intergenic
1030996889 7:116370530-116370552 ACACAGACACACAGGGAGGAAGG + Intronic
1031051571 7:116950660-116950682 AAAGAGAGAAAGAGAGAGGAAGG - Intergenic
1031166145 7:118229315-118229337 AAAGAGAAAAGCAGGGAAGAAGG - Intronic
1031630166 7:124034298-124034320 AAGGAGATAAAGAGGGAGGAAGG - Intergenic
1031682890 7:124695897-124695919 AAAGAGAGAGGGAGGGAGGAAGG + Intergenic
1031991144 7:128200117-128200139 AGAGAGGGACAAAGGGAGGAGGG - Intergenic
1032034032 7:128508479-128508501 AAAGAGAGAGAAAGGGAAGAAGG + Intergenic
1032088256 7:128894937-128894959 ACAGACACACACAGGGAGAATGG + Intronic
1032089558 7:128904419-128904441 AGAGAGAGAAAGAGGGAGGATGG - Intronic
1032305109 7:130725771-130725793 AGAGAGAGAAAGAGGGAGGAAGG - Intergenic
1032364124 7:131283392-131283414 AAAGAGAGAGAGAGGAAGGAAGG - Intronic
1032385178 7:131517729-131517751 AAAGAGTTACGCAAGGAGGAAGG - Intronic
1032426736 7:131828780-131828802 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
1032449997 7:132022444-132022466 AAAGAAAGAGAGAGGGAGGAAGG - Intergenic
1032473112 7:132192566-132192588 AAAGAGGGAGACAGAGAGGAAGG + Intronic
1033313371 7:140278665-140278687 ATATAGATACACAGGGTAGAAGG - Intergenic
1033374689 7:140746858-140746880 AAAAAGATACCCAGAGAGGTAGG + Intronic
1033412107 7:141127485-141127507 ACAGAGACACACAGAGGGGAGGG + Intronic
1033443222 7:141398508-141398530 AAAGAGAGAAACAGAGGGGATGG - Intronic
1033724454 7:144098951-144098973 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
1033874298 7:145795289-145795311 AAAGAGAAAGAAAGGAAGGAAGG + Intergenic
1034167891 7:149039634-149039656 ACAGACATACAGAGGGAAGATGG + Intergenic
1034310234 7:150081179-150081201 AGAGAGATAGGGAGGGAGGAAGG + Intergenic
1034511208 7:151536248-151536270 AAAGAGAGACAGAGAGAGGAAGG + Intergenic
1034511212 7:151536315-151536337 AAAGAGAGACAGAGAGAGGAAGG + Intergenic
1034527402 7:151674174-151674196 AAAGAAAGACAAAGGGAAGATGG + Intronic
1034574016 7:151981625-151981647 AGAGAGAGAGAAAGGGAGGAAGG - Intronic
1034796607 7:154019462-154019484 AGAGAGATAGGGAGGGAGGAAGG - Intronic
1035255371 7:157622512-157622534 AAAGAGACACAGAGGGAGGGAGG + Intronic
1035714944 8:1746942-1746964 AGAGAGACACACACAGAGGAAGG + Intergenic
1035791758 8:2312701-2312723 AAAGAGAGAGACAGGGGGCATGG + Intergenic
1035801047 8:2409004-2409026 AAAGAGAGAGACAGGGGGCATGG - Intergenic
1036207787 8:6818013-6818035 AAAGGGAGAAAAAGGGAGGAAGG - Intronic
1036375068 8:8192966-8192988 ACAGAGACACACAGGGGAGAAGG + Intergenic
1036385887 8:8281347-8281369 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1036400019 8:8399882-8399904 AAAGAGAAAGAGAGGGAGGGAGG - Intergenic
1036557092 8:9869688-9869710 AAAGAGAGATAGAGGAAGGAAGG + Intergenic
1036854474 8:12230182-12230204 ACAGAGACACACAGGGGAGAAGG - Intergenic
1036875833 8:12472682-12472704 ACAGAGACACACAGGGGAGAAGG - Intergenic
1037111595 8:15169262-15169284 AATGAGACAGCCAGGGAGGAGGG + Intronic
1037371301 8:18182107-18182129 GAAGAGATACACACTGAAGAAGG - Intronic
1037656166 8:20886024-20886046 AAAGAGAGACAGAGGGAGGGAGG + Intergenic
1037677566 8:21064894-21064916 AAAGAGAGAGACAGAGAGAATGG - Intergenic
1037680573 8:21093880-21093902 AAAGAGAAAGAAAGGAAGGAAGG + Intergenic
1038317810 8:26502432-26502454 AAAGAGAGAGAGAGGGAGGGAGG - Intronic
1038459073 8:27701562-27701584 AAAGAGAAAGAAAGAGAGGAAGG - Intergenic
1038688703 8:29742106-29742128 AAAGAGACACACAGAGATTAAGG + Intergenic
1038707522 8:29908771-29908793 AGAGAGAGAGACAGGAAGGAAGG + Intergenic
1038851041 8:31276596-31276618 ATAGAACTACACCGGGAGGATGG + Intergenic
1038937365 8:32267085-32267107 AAAGAGAGAGAAAGGAAGGAAGG + Intronic
1039176830 8:34818038-34818060 ACACAAAGACACAGGGAGGAAGG + Intergenic
1039498288 8:37997624-37997646 AAAGAGAGACAGAGGGAGAATGG - Intergenic
1039805617 8:40994977-40994999 AAAAAAAGACAGAGGGAGGAAGG + Intergenic
1040420206 8:47232386-47232408 AAAGAGAGAGAAAGGAAGGAAGG + Intergenic
1040639086 8:49310822-49310844 AAAGAGAAAAAGAGAGAGGAGGG + Intergenic
1040824643 8:51607960-51607982 AAAGAGAAAGAAAGGAAGGAAGG + Intronic
1040837127 8:51744259-51744281 AAAGAGAAAGAAAGGAAGGAAGG + Intronic
1041269033 8:56092806-56092828 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1041580634 8:59456061-59456083 AAAGAGAGAGAAAGGAAGGAAGG - Intergenic
1041788631 8:61664799-61664821 AAAGAGAAAAACAGGGAAGCAGG + Intronic
1042014466 8:64292749-64292771 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
1042460914 8:69067296-69067318 AGAGAGAGAGAGAGGGAGGAGGG - Intergenic
1042537739 8:69875725-69875747 AAAGAAAAAGAGAGGGAGGAAGG + Intergenic
1042553689 8:70016279-70016301 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1042608481 8:70571523-70571545 AAATATATACACAGGGAGCCAGG - Intergenic
1043248974 8:78045273-78045295 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1043267695 8:78286993-78287015 AAAGAGAGAGGGAGGGAGGAAGG + Intergenic
1043400867 8:79882947-79882969 AAAGAGAGAGAGAGGGAAGAGGG - Intergenic
1043438679 8:80258030-80258052 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
1043503411 8:80878243-80878265 AAAGAGAAAGAAAGGAAGGAAGG + Intergenic
1043832924 8:85011946-85011968 AAAGAGAAGAAAAGGGAGGAGGG - Intergenic
1043949883 8:86297174-86297196 AAAGGGATATAAAGGGAGGTAGG - Intronic
1043971467 8:86533885-86533907 GAATAGATACAAAGGAAGGAAGG - Intronic
1044204170 8:89472530-89472552 AAAAAGATACAATGGTAGGAAGG - Intergenic
1044429819 8:92095655-92095677 AAGGAGAGACACAGGCAGGAGGG + Intronic
1044969094 8:97602472-97602494 AAAGAGAGAGAAAGGAAGGAAGG + Intergenic
1045099331 8:98828603-98828625 AAAGAGAGAGAGAGGGAGGGAGG + Intronic
1045297836 8:100887895-100887917 AAAGAGAAAGAAAGGAAGGAAGG + Intergenic
1045316687 8:101049468-101049490 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1046089790 8:109487875-109487897 AAAGAGAGAGAGAGAGAGGAAGG + Intronic
1046289231 8:112135408-112135430 GAAAAGATACACAGAGAAGAAGG + Intergenic
1046483175 8:114850742-114850764 AAAGAGAGAGACAGAGAGGCAGG + Intergenic
1046558435 8:115806689-115806711 AAAGAAAAAGAAAGGGAGGAAGG + Intronic
1046630373 8:116617476-116617498 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1046892609 8:119439305-119439327 AAAGTGAGTCACAGGGAGAAAGG + Intergenic
1046987876 8:120410769-120410791 AAAGAGAGAGAAAGGAAGGAAGG - Intronic
1047509118 8:125502885-125502907 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
1047723521 8:127664919-127664941 AGACAGATACACAGGGAAGAGGG + Intergenic
1047873780 8:129113080-129113102 AAAGAATTAAACAGAGAGGAAGG + Intergenic
1048013486 8:130477417-130477439 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1048186298 8:132244365-132244387 AAAGAGAGACAGAGAGAGAAAGG + Intronic
1048253371 8:132885927-132885949 AAAGATGCACACAGGGAAGAAGG - Intronic
1048326028 8:133440118-133440140 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1048380085 8:133857878-133857900 TGAGAGACACACAGGGAAGATGG - Intergenic
1048581393 8:135732176-135732198 ACAAAGGGACACAGGGAGGAAGG - Intergenic
1048645375 8:136413950-136413972 AGAGAGAGAAACAGGAAGGAAGG - Intergenic
1049479548 8:142815062-142815084 AAAGAGATCAACAGTGAAGAGGG - Intergenic
1049516151 8:143057957-143057979 AGAGAGATGCAGAGGGAGGGAGG - Intronic
1049534783 8:143173877-143173899 AAAGAGAGACAGAGAGAGGGGGG + Intergenic
1049952041 9:654840-654862 AGAGAGAGATAAAGGGAGGAAGG + Intronic
1050277440 9:4014484-4014506 AAAGACATACAGAGGAAAGATGG + Intronic
1050357782 9:4799121-4799143 AAAGAGAAAGAGAGGAAGGAAGG - Intronic
1050579724 9:7040302-7040324 AAAGAGAGACAGAGGGAGGGAGG - Intronic
1050690603 9:8222718-8222740 AGAGAGAGAGAAAGGGAGGAGGG + Intergenic
1050857901 9:10385019-10385041 TGAGAGATACAGATGGAGGAAGG - Intronic
1050912231 9:11085810-11085832 AAAGAAATACAAATGGAGGAGGG + Intergenic
1051092432 9:13425403-13425425 AAAGAGAGAGAAAGGAAGGAAGG - Intergenic
1051327181 9:15985166-15985188 AAAGAGGCACACAGGAAGGGAGG + Intronic
1051499671 9:17763454-17763476 ACAGAGAAACACAGGAAAGAAGG + Intronic
1051783380 9:20714695-20714717 AAAGAGAGAAAGAGAGAGGAAGG - Intronic
1051861845 9:21633993-21634015 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1051862257 9:21639388-21639410 AAAGAGAGACGGAGGGAGGGAGG + Intergenic
1051880721 9:21837001-21837023 GATGAGTAACACAGGGAGGAGGG - Intronic
1052492252 9:29184732-29184754 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
1052779889 9:32770496-32770518 AAAGAGAAAGAAAGGAAGGAAGG + Intergenic
1053308410 9:37000145-37000167 AGAGAGATACAGAGAGAGGATGG + Intronic
1053580422 9:39398417-39398439 AGAGAGAGAGAGAGGGAGGAAGG - Intergenic
1053613587 9:39741009-39741031 TAAGATATACACAAGGGGGAGGG + Intergenic
1053871628 9:42498966-42498988 TAAGATATACACAAGGGGGAGGG + Intergenic
1054102009 9:60957222-60957244 AGAGAGAGAGAGAGGGAGGAAGG - Intergenic
1054239927 9:62601388-62601410 TAAGATATACACAAGGGGGAGGG - Intergenic
1054554060 9:66635914-66635936 TAAGATATACACAAGGGGGAGGG - Intergenic
1054584346 9:66949637-66949659 AGAGAGAGAGAGAGGGAGGAAGG + Intergenic
1055011320 9:71569200-71569222 ACAGAGAAACACAGACAGGAAGG + Intergenic
1055066605 9:72125343-72125365 AAAGAGAGAGAGAGAGAGGAAGG - Intronic
1055160802 9:73125564-73125586 AAAGAGGTAGACAGGTAGAAGGG + Intergenic
1055442610 9:76351676-76351698 AAAGAGGTAGGGAGGGAGGAAGG + Intronic
1055716394 9:79122626-79122648 AAAGAGAAAGAAAGAGAGGAAGG + Intergenic
1055804503 9:80077419-80077441 AGAGAGAGACAAAGGAAGGAAGG + Intergenic
1056388458 9:86118572-86118594 AAAGAGAGAGACAGAGAGGGAGG + Intergenic
1056545054 9:87606478-87606500 AGGGAGAGACAGAGGGAGGAAGG - Intronic
1056635572 9:88328646-88328668 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
1056691300 9:88810863-88810885 AAAGAAAAAAACAAGGAGGAAGG - Intergenic
1056970104 9:91194582-91194604 AAAGAGAGAGAGAGGAAGGAGGG - Intergenic
1057165475 9:92921784-92921806 AAGGAGGAAGACAGGGAGGAAGG - Intergenic
1057835141 9:98438368-98438390 TAATAGATACACAGGAAGGCTGG - Intronic
1058149501 9:101448768-101448790 AAAAAGATACAAAGGAAGGAAGG + Intergenic
1058726465 9:107809429-107809451 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
1058909340 9:109506567-109506589 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
1059117909 9:111615978-111616000 ACATAGACACACAGGGAGGTGGG + Intergenic
1059262892 9:112995505-112995527 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
1059354252 9:113687145-113687167 GAAGAGGAAGACAGGGAGGAGGG + Intergenic
1059378204 9:113902171-113902193 TCAGAGCCACACAGGGAGGAAGG - Intronic
1059414593 9:114155321-114155343 AAACAGATTCACAGAGAGGAAGG - Intergenic
1059608534 9:115864853-115864875 AAACAGAGAGACAGAGAGGAAGG + Intergenic
1059878362 9:118661095-118661117 AAAGAGAAAGAAAGGAAGGAAGG + Intergenic
1059965502 9:119609773-119609795 AAAGAGAGAGGGAGGGAGGAAGG - Intergenic
1060121702 9:120997481-120997503 AAAGAGAGACACAGAAAGGGGGG - Intronic
1060251834 9:121992723-121992745 AAAGAGATACACAGAGGAGGTGG + Intronic
1060473632 9:123969211-123969233 AAAGAGAGAAAGAGGAAGGAAGG - Intergenic
1060483730 9:124033883-124033905 AAAGACACACCCAGAGAGGAGGG + Intergenic
1060541463 9:124433350-124433372 AAAGAGAGAGAGATGGAGGAAGG + Intergenic
1060592741 9:124829202-124829224 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1060736247 9:126068124-126068146 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
1061055594 9:128221006-128221028 AAAGAGAAAGAAAGGAAGGAAGG - Intronic
1061156189 9:128863197-128863219 AAGTAGACACACAAGGAGGAGGG + Intronic
1061495371 9:130970967-130970989 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
1061709295 9:132476686-132476708 ACAGAGACACACAGGGGAGAAGG + Intronic
1061711919 9:132493902-132493924 AAAGAGAGAGAAAGGAAGGAAGG - Intronic
1062192941 9:135257046-135257068 ACAGAGATAGAGAGGGAGAAAGG - Intergenic
1062275196 9:135727168-135727190 AAAGAGAGAGAGAGGGAGAAAGG - Intronic
1203423957 Un_GL000195v1:20674-20696 AAAGAGAGAGAAAGGAAGGAAGG - Intergenic
1203473350 Un_GL000220v1:128920-128942 AAACAGACAGACAGGGAGGGAGG - Intergenic
1203473738 Un_GL000220v1:133125-133147 AAACAGACAGACAGGGAGGGAGG - Intergenic
1203654449 Un_KI270752v1:9595-9617 AAAGAGAGAGAGAGGGAGGAAGG - Intergenic
1185514094 X:685810-685832 AAAGAAAGACAAAGGAAGGAAGG - Intergenic
1185553778 X:1004306-1004328 AAAGAGAGAAAGAGGGAGGGAGG - Intergenic
1185556790 X:1028000-1028022 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
1185611044 X:1393815-1393837 AAAGGGAGAAACAGAGAGGAAGG - Intergenic
1185667367 X:1776620-1776642 AAAGAGAGAGAAAGGAAGGAAGG - Intergenic
1185683809 X:1910599-1910621 AGAAAGAGAGACAGGGAGGAAGG - Intergenic
1185683840 X:1910789-1910811 AGAGAGACAGAGAGGGAGGAAGG - Intergenic
1185711372 X:2306251-2306273 CAAGAGAAACACTGGTAGGAAGG + Intronic
1185770981 X:2765355-2765377 AAAGAGAGAAAGAGGGAGGGAGG + Intronic
1186110060 X:6246291-6246313 AGAGAGAGAAAGAGGGAGGAAGG - Intergenic
1186703201 X:12113572-12113594 AAAGAGAAAGGCAGGCAGGAAGG - Intergenic
1186780940 X:12911451-12911473 AAATAGACACACAGGAAAGAAGG - Intronic
1186829178 X:13373662-13373684 AAAGAAATACCCAGTGAGGGAGG + Intergenic
1186834340 X:13422499-13422521 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1186834349 X:13422552-13422574 AAAGAGAAAGAGAGGAAGGAAGG + Intergenic
1186834363 X:13422631-13422653 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1187034096 X:15519515-15519537 AGAGAGATACACAGAGGAGAAGG + Intronic
1187591353 X:20720728-20720750 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
1187602906 X:20851650-20851672 AAACAGACACACAGGGAGGAAGG + Intergenic
1187772394 X:22714662-22714684 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
1187853092 X:23610341-23610363 AAAGAGAGAAAGAGGAAGGAAGG + Intergenic
1188177065 X:27003866-27003888 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1188181937 X:27066972-27066994 AAAGAAAGAAAAAGGGAGGAAGG - Intergenic
1188606865 X:32041996-32042018 AGAGAGAGAGAGAGGGAGGAAGG - Intronic
1189073894 X:37895465-37895487 AAAGAGAGAGAGAGGGAGGGAGG - Intronic
1189093172 X:38109321-38109343 TAAGAAACACCCAGGGAGGATGG + Intronic
1189143771 X:38635117-38635139 AAAGAGAGAGAGAGAGAGGAAGG - Intronic
1189159267 X:38793918-38793940 AAAGACAGACAAAGGAAGGAAGG + Intergenic
1189160070 X:38802345-38802367 AAAGAAAAATACAGGGAGGCAGG - Intronic
1189511466 X:41666428-41666450 AGAGAGAGACAGAGGGAGGAAGG - Intronic
1189775147 X:44463945-44463967 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1189775839 X:44469710-44469732 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1190047533 X:47124681-47124703 AAAGAGAAAGAAAGGAAGGAAGG + Intergenic
1190176483 X:48154972-48154994 AAAGAGAGAGAAAGGAAGGAAGG - Intergenic
1190313500 X:49134150-49134172 AAAGAGAGAGGAAGGGAGGAAGG - Intergenic
1190439575 X:50463604-50463626 AGAGAGAAACAGAGAGAGGAAGG - Intronic
1190681484 X:52830408-52830430 AAAAAAACACACAGGGAGGATGG - Intergenic
1190739417 X:53279689-53279711 AGAGAGAGAGACAGGGAGGGAGG + Intronic
1191915336 X:66195040-66195062 AAAGGGATAAACAGGGAGGAAGG - Intronic
1192659093 X:73022788-73022810 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1192789937 X:74371482-74371504 AGAGAGTGAGACAGGGAGGAAGG + Intergenic
1193224428 X:78965502-78965524 AAAGAGAGAGGGAGGGAGGAAGG - Intergenic
1193611119 X:83632280-83632302 AAAGAGAGAAAGAGGAAGGAAGG + Intergenic
1194372890 X:93096211-93096233 CAAGAGATAGAGAGAGAGGAGGG + Intergenic
1194590235 X:95791527-95791549 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1194767263 X:97856209-97856231 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
1195574759 X:106437417-106437439 AAAGAGAGAGACAGAGAGGGAGG - Intergenic
1195661646 X:107384822-107384844 AAAGAGAAATAAATGGAGGAAGG - Intergenic
1195705626 X:107736115-107736137 AAAGAGGTACACTTGGAGAAGGG - Intronic
1195887517 X:109655556-109655578 AAACAGACACACAGGGTGGGGGG + Intronic
1196318319 X:114256107-114256129 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1196386219 X:115155078-115155100 AAAGAGAAAGAGAGGAAGGAAGG + Intronic
1196720047 X:118845476-118845498 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
1196740418 X:119020391-119020413 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1196813602 X:119647407-119647429 AAAGAAATAAAAAGGAAGGAAGG - Intronic
1196943361 X:120799424-120799446 AGAGAAAGAAACAGGGAGGAAGG - Intergenic
1196982977 X:121236340-121236362 AAAAAGAAAGACAGGAAGGAAGG - Intergenic
1197253307 X:124236955-124236977 AAAGAGAGAGAGAGGGAGGGAGG - Intronic
1197341387 X:125270386-125270408 AAAGAGATAAACAGATAGCAAGG - Intergenic
1197849694 X:130844405-130844427 AAAGAGAAAGAGAAGGAGGAAGG + Intronic
1198116466 X:133549629-133549651 AGAGAGATAAAGAGGGGGGAGGG - Intronic
1198116491 X:133549740-133549762 AAAGAGAGAGAGAGGGAGGATGG - Intronic
1198131587 X:133700995-133701017 AAAGAAGGAGACAGGGAGGAAGG - Intronic
1198179785 X:134195046-134195068 AAAGAGAAAGAAAGGAAGGAAGG + Intergenic
1198204031 X:134449206-134449228 AAATAAATACACGGGGAGAAGGG + Intergenic
1198466898 X:136911390-136911412 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1198493153 X:137163952-137163974 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
1198518662 X:137431174-137431196 ATAGAGATAGAGAGGGAGCAGGG - Intergenic
1198518728 X:137431662-137431684 AAATAGAAAGACAGGAAGGAGGG + Intergenic
1198655957 X:138913603-138913625 AAAGAGAGAGAGAGGGAGGGAGG + Intronic
1198995501 X:142569225-142569247 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1199033816 X:143029626-143029648 AGAGATATTAACAGGGAGGAGGG + Intronic
1199132138 X:144202211-144202233 AAAAAGAGAGAGAGGGAGGACGG - Intergenic
1199192947 X:144993556-144993578 AGAGAGAGAGAAAGGGAGGAAGG - Intergenic
1199683157 X:150241392-150241414 AGACAGATACACAGGGAGAGAGG + Intergenic
1199745216 X:150768174-150768196 AAACAGGGACACAGGGTGGAGGG + Exonic
1199849899 X:151718099-151718121 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
1200076280 X:153552883-153552905 ACACAGACACACAGGGAGAAGGG - Intronic
1200680928 Y:6210251-6210273 CAAGAGATAGAGAGAGAGGAGGG + Intergenic
1200802991 Y:7403321-7403343 AAAGAAAGACAAAGGAAGGAAGG - Intergenic
1200878072 Y:8180528-8180550 AGAGAGAGAGAGAGGGAGGATGG + Intergenic
1200941034 Y:8782064-8782086 AAAGAGAGAGGGAGGGAGGAGGG + Intergenic
1200978216 Y:9236359-9236381 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1201058035 Y:10015374-10015396 AAAGAGAAAGGAAGGGAGGAAGG + Intergenic
1201240711 Y:11954611-11954633 AGAGAGAGACAGAGGGATGAGGG - Intergenic
1201341151 Y:12935708-12935730 AAAGAGAGAAAGAGGGAGGGAGG - Intergenic
1201448374 Y:14083054-14083076 AAAGGGATTGACAGGGAAGATGG - Intergenic
1201690524 Y:16759861-16759883 AAAGAGAGAGAAAGGAAGGAAGG + Intergenic
1201864898 Y:18639769-18639791 AAAGAGAAAGAAAGGAAGGAAGG - Intergenic
1201868424 Y:18680597-18680619 AAAGAGAAAGAAAGGAAGGAAGG + Intergenic
1202374413 Y:24220521-24220543 AAAGAGAAAAAAAGGAAGGAAGG + Intergenic
1202496367 Y:25449599-25449621 AAAGAGAAAAAAAGGAAGGAAGG - Intergenic