ID: 1161718567

View in Genome Browser
Species Human (GRCh38)
Location 19:5891204-5891226
Sequence GCTTAGAGACCCCCGGCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 58}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161718556_1161718567 23 Left 1161718556 19:5891158-5891180 CCCCCCTTTTTTTTGTCTTGTGA 0: 1
1: 0
2: 16
3: 252
4: 1823
Right 1161718567 19:5891204-5891226 GCTTAGAGACCCCCGGCGGCGGG 0: 1
1: 0
2: 0
3: 6
4: 58
1161718557_1161718567 22 Left 1161718557 19:5891159-5891181 CCCCCTTTTTTTTGTCTTGTGAA 0: 1
1: 0
2: 6
3: 96
4: 1319
Right 1161718567 19:5891204-5891226 GCTTAGAGACCCCCGGCGGCGGG 0: 1
1: 0
2: 0
3: 6
4: 58
1161718554_1161718567 27 Left 1161718554 19:5891154-5891176 CCCACCCCCCTTTTTTTTGTCTT 0: 1
1: 3
2: 40
3: 490
4: 2963
Right 1161718567 19:5891204-5891226 GCTTAGAGACCCCCGGCGGCGGG 0: 1
1: 0
2: 0
3: 6
4: 58
1161718555_1161718567 26 Left 1161718555 19:5891155-5891177 CCACCCCCCTTTTTTTTGTCTTG 0: 1
1: 3
2: 69
3: 527
4: 2830
Right 1161718567 19:5891204-5891226 GCTTAGAGACCCCCGGCGGCGGG 0: 1
1: 0
2: 0
3: 6
4: 58
1161718559_1161718567 20 Left 1161718559 19:5891161-5891183 CCCTTTTTTTTGTCTTGTGAATG 0: 1
1: 0
2: 2
3: 109
4: 1291
Right 1161718567 19:5891204-5891226 GCTTAGAGACCCCCGGCGGCGGG 0: 1
1: 0
2: 0
3: 6
4: 58
1161718560_1161718567 19 Left 1161718560 19:5891162-5891184 CCTTTTTTTTGTCTTGTGAATGT 0: 1
1: 0
2: 2
3: 74
4: 899
Right 1161718567 19:5891204-5891226 GCTTAGAGACCCCCGGCGGCGGG 0: 1
1: 0
2: 0
3: 6
4: 58
1161718558_1161718567 21 Left 1161718558 19:5891160-5891182 CCCCTTTTTTTTGTCTTGTGAAT 0: 1
1: 0
2: 5
3: 91
4: 1128
Right 1161718567 19:5891204-5891226 GCTTAGAGACCCCCGGCGGCGGG 0: 1
1: 0
2: 0
3: 6
4: 58
1161718553_1161718567 28 Left 1161718553 19:5891153-5891175 CCCCACCCCCCTTTTTTTTGTCT 0: 1
1: 2
2: 38
3: 491
4: 4052
Right 1161718567 19:5891204-5891226 GCTTAGAGACCCCCGGCGGCGGG 0: 1
1: 0
2: 0
3: 6
4: 58
1161718552_1161718567 29 Left 1161718552 19:5891152-5891174 CCCCCACCCCCCTTTTTTTTGTC 0: 1
1: 4
2: 38
3: 379
4: 2052
Right 1161718567 19:5891204-5891226 GCTTAGAGACCCCCGGCGGCGGG 0: 1
1: 0
2: 0
3: 6
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161718567 Original CRISPR GCTTAGAGACCCCCGGCGGC GGG Intronic