ID: 1161718735

View in Genome Browser
Species Human (GRCh38)
Location 19:5891954-5891976
Sequence CACACAAGAGGGCCCCCGTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 55}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161718735_1161718747 26 Left 1161718735 19:5891954-5891976 CCAGACGGGGGCCCTCTTGTGTG 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1161718747 19:5892003-5892025 ACAACCTAGTAAATGTTTATGGG 0: 1
1: 0
2: 0
3: 14
4: 207
1161718735_1161718746 25 Left 1161718735 19:5891954-5891976 CCAGACGGGGGCCCTCTTGTGTG 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1161718746 19:5892002-5892024 CACAACCTAGTAAATGTTTATGG 0: 1
1: 0
2: 1
3: 12
4: 177
1161718735_1161718749 30 Left 1161718735 19:5891954-5891976 CCAGACGGGGGCCCTCTTGTGTG 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1161718749 19:5892007-5892029 CCTAGTAAATGTTTATGGGCCGG 0: 1
1: 1
2: 1
3: 10
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161718735 Original CRISPR CACACAAGAGGGCCCCCGTC TGG (reversed) Exonic
905262913 1:36731818-36731840 CACACAGAAGGCCCCACGTCAGG - Intergenic
1067303563 10:45036674-45036696 CACCCTAGAGGGCCCCTTTCTGG - Intergenic
1068732307 10:60373250-60373272 CACACAAGAGGCCCCTGGCCTGG - Intronic
1070417621 10:76205265-76205287 CACAGAAGAGGCACCCCATCTGG - Intronic
1072252761 10:93594649-93594671 GACACAAGAGGCCCACCATCTGG + Intronic
1076733046 10:132447629-132447651 CACACAAGAAGGGGCCCGACTGG - Intronic
1088573227 11:111243250-111243272 CACACAGTAGGGCCCCAGTGAGG - Intergenic
1091108205 11:132942786-132942808 CACGCAAGCGGGCGCCCCTCGGG + Intronic
1091737864 12:2938172-2938194 TGCACAACAAGGCCCCCGTCTGG + Exonic
1092072093 12:5639701-5639723 CACACTACAGGGCCCCCTCCTGG - Intronic
1099610062 12:84857118-84857140 CAGAAAAGTGGGCTCCCGTCTGG + Intergenic
1100676905 12:96878306-96878328 CACTCAAGAGGGCAGCCTTCTGG - Intergenic
1104797240 12:131528273-131528295 GACACACGAGGGGCCACGTCTGG - Intergenic
1117582537 14:57166954-57166976 CAAGCAAGAAGGCCCCCATCTGG + Intergenic
1122267013 14:100551273-100551295 CAACCAAGAGGGCACTCGTCTGG - Intronic
1127919461 15:63481825-63481847 CCCACAAGAGGCTCCCTGTCTGG - Intergenic
1131617039 15:94027179-94027201 CACATAAGAGAGCCCAAGTCTGG + Intergenic
1132844568 16:1993872-1993894 CCCACAAGATGGCCCCTGTGTGG + Exonic
1140350874 16:74261007-74261029 CACCCATGAGGCCCCACGTCGGG + Intergenic
1147452280 17:40513081-40513103 CACACCAGAGGACCACCGTAAGG - Intergenic
1152260023 17:79261796-79261818 CACACAAGAGGCCCCCAGAGCGG + Intronic
1161718735 19:5891954-5891976 CACACAAGAGGGCCCCCGTCTGG - Exonic
926396279 2:12445965-12445987 CATACAAAAGGGCTCCCTTCAGG + Intergenic
928168947 2:28991224-28991246 TACACAAGAGGGCCCGGGGCAGG + Intronic
941181480 2:162264599-162264621 CACAGAACAGGTACCCCGTCTGG - Intergenic
942145005 2:173018253-173018275 CACACAGGAGGGCTTCCGCCTGG - Intronic
944096728 2:195976182-195976204 CACAAAAGTGGGCTCCCCTCTGG - Intronic
1169016690 20:2298345-2298367 CACAGAGGAGGGCCCCAGTGTGG + Intronic
1178568544 21:33712669-33712691 CCCACAGGTGGGCCCCAGTCAGG - Intronic
1183180737 22:36258070-36258092 CACACAATAGGGCCTCCCTAAGG + Intronic
1183627900 22:39015831-39015853 CACACAGGAGAGCCCACGCCGGG - Intronic
1183642350 22:39100350-39100372 AACACAAGAGGGCCTTCCTCGGG - Exonic
949552438 3:5122383-5122405 CACACGAGCGGGCCTCCGCCCGG - Exonic
953742085 3:45546822-45546844 CACACTAGAGCGCCCCCTTCTGG + Intronic
956669478 3:71672835-71672857 AACAAAAGAGGGCCCCAGCCAGG - Intergenic
957171707 3:76745601-76745623 CACACAAAAGGGCCACAATCAGG - Intronic
959919988 3:111859491-111859513 CACACCGTCGGGCCCCCGTCGGG - Exonic
962367467 3:134795862-134795884 CCCACCAGAGCGCCCCCGGCTGG + Intronic
962575338 3:136751517-136751539 TTCACAAGGAGGCCCCCGTCGGG + Intronic
968975120 4:3818087-3818109 CTCACTTGAGGGCCCCCCTCTGG - Intergenic
975767301 4:77682216-77682238 AGCAGAAGAGGGCCCCCATCAGG - Intergenic
984024037 4:174522133-174522155 CACACAAGAGGCTCCCCTCCTGG + Intronic
996060997 5:119033296-119033318 CACACAAAAGGGCTCCTGCCTGG + Intergenic
1006236645 6:32639139-32639161 CACACCAGAGTGCCCTGGTCAGG + Intronic
1006246613 6:32742714-32742736 CACACCAGAGTGCCCCGGTCAGG + Intronic
1019132078 6:169884327-169884349 CACACAGGAGGGCACTCATCTGG + Intergenic
1019418212 7:936996-937018 CACCCAAGTGAGCCCCCGGCCGG + Intronic
1019652295 7:2166668-2166690 CACACAAGCAGGCCCGCTTCCGG + Intronic
1020006899 7:4788087-4788109 CACTCAAGGGCACCCCCGTCAGG - Intronic
1021092645 7:16501718-16501740 GGCAGAAGAGGGCCCCCGCCAGG + Intronic
1031721949 7:125187558-125187580 CACTGAAGAGGGCTCCCCTCTGG - Intergenic
1035384585 7:158462105-158462127 CACACACCAGGGCCCCTCTCTGG + Intronic
1036138969 8:6188796-6188818 CACACACCAGGGCCGCCATCTGG + Intergenic
1049191055 8:141287853-141287875 CACACAGGAGGGCCCGGGCCAGG + Intronic
1060838825 9:126778379-126778401 CACACCAGAGGACCCACGTGTGG - Intergenic
1060895812 9:127216489-127216511 CACACAATAGGGTCCCCCTAAGG - Intronic
1062346113 9:136116066-136116088 CAGCCAGGAGGGCCCCCCTCCGG + Exonic
1192145010 X:68676183-68676205 AACAGAAGAGGGCCCCAGCCAGG - Intronic