ID: 1161720117

View in Genome Browser
Species Human (GRCh38)
Location 19:5897789-5897811
Sequence ACCGTCCCTGCTGGGTGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161720109_1161720117 15 Left 1161720109 19:5897751-5897773 CCAGGTAGGTGGTGGGGACGGAG No data
Right 1161720117 19:5897789-5897811 ACCGTCCCTGCTGGGTGCCTAGG No data
1161720103_1161720117 28 Left 1161720103 19:5897738-5897760 CCAGAACTCAGGGCCAGGTAGGT No data
Right 1161720117 19:5897789-5897811 ACCGTCCCTGCTGGGTGCCTAGG No data
1161720101_1161720117 29 Left 1161720101 19:5897737-5897759 CCCAGAACTCAGGGCCAGGTAGG No data
Right 1161720117 19:5897789-5897811 ACCGTCCCTGCTGGGTGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161720117 Original CRISPR ACCGTCCCTGCTGGGTGCCT AGG Intronic