ID: 1161723810

View in Genome Browser
Species Human (GRCh38)
Location 19:5917345-5917367
Sequence GTGCCATTTCAATTCAAAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 188}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161723807_1161723810 5 Left 1161723807 19:5917317-5917339 CCAGTGAGAAGCCGTGACAAGTC 0: 1
1: 0
2: 0
3: 2
4: 65
Right 1161723810 19:5917345-5917367 GTGCCATTTCAATTCAAAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 188
1161723806_1161723810 6 Left 1161723806 19:5917316-5917338 CCCAGTGAGAAGCCGTGACAAGT 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1161723810 19:5917345-5917367 GTGCCATTTCAATTCAAAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 188
1161723808_1161723810 -6 Left 1161723808 19:5917328-5917350 CCGTGACAAGTCTTAATGTGCCA 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1161723810 19:5917345-5917367 GTGCCATTTCAATTCAAAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 188
1161723805_1161723810 11 Left 1161723805 19:5917311-5917333 CCAGTCCCAGTGAGAAGCCGTGA 0: 1
1: 0
2: 1
3: 8
4: 135
Right 1161723810 19:5917345-5917367 GTGCCATTTCAATTCAAAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161723810 Original CRISPR GTGCCATTTCAATTCAAAGG AGG Exonic
900108197 1:994694-994716 GTGCCAAGACAATTCAATGGAGG + Intergenic
904217846 1:28937963-28937985 GTGCCAAGACAATTCAATGGAGG - Intronic
904574162 1:31492104-31492126 GTGCCATTTGAATTGAAAACTGG + Intergenic
904654805 1:32036761-32036783 GTGCCATTTGACTTCAGAGAAGG + Intronic
905160095 1:36025334-36025356 GTGACATTTCACTTGAAAGCAGG - Intronic
910347101 1:86251947-86251969 GTACCATTATAATTCAATGGGGG + Intergenic
913256165 1:116955933-116955955 GTGACATGTGAGTTCAAAGGAGG + Intronic
913369105 1:118077281-118077303 GAGCCATTCCATTTGAAAGGGGG - Intronic
914379008 1:147099690-147099712 GTGGCTTCTCAAATCAAAGGAGG + Intergenic
917180707 1:172294237-172294259 GAGTCATTTCAATTAAAAGAGGG - Intronic
919123025 1:193364437-193364459 GTGCCACTTAAATTCTAATGGGG + Intergenic
922207271 1:223459437-223459459 GTGCCACTGCAATTCTATGGGGG - Intergenic
922637414 1:227188293-227188315 GTACCATGTCATTTCAAAGTGGG + Intronic
923138224 1:231137380-231137402 GTGCCAAGACCATTCAAAGGGGG - Intergenic
923162622 1:231329677-231329699 GTGGCATTTCAAATCAGTGGGGG + Intergenic
923415398 1:233752741-233752763 GTGCCAAGACAATTCAATGGAGG - Intergenic
1064319574 10:14291311-14291333 GTGCTATTTCAATTAAAATCAGG + Intronic
1064588002 10:16858852-16858874 GTGCCAATGCAATTCAATGAAGG + Intronic
1064872630 10:19955749-19955771 GTGCCATGACAGGTCAAAGGAGG - Intronic
1065686118 10:28286549-28286571 GTGCCAGTTCAGTTGAAAGTGGG - Intronic
1066680133 10:37930158-37930180 GGCCCATTTCAAAGCAAAGGAGG - Intergenic
1068337438 10:55653614-55653636 ATAACATTTCAATTTAAAGGAGG - Intergenic
1068875567 10:61992203-61992225 GTGACATTTAAATTTAAATGTGG + Intronic
1071250174 10:83809934-83809956 TTGCCACTTCAATTCAATTGAGG + Intergenic
1073521339 10:104132921-104132943 GTGTCATGCTAATTCAAAGGTGG + Intronic
1074083513 10:110187425-110187447 GTGCAAATGCAATTCAATGGAGG - Intergenic
1074976562 10:118586607-118586629 ATGCCATGTGAATTCAATGGTGG - Intergenic
1076510473 10:131010718-131010740 TTGGTATTTCAAATCAAAGGTGG + Intergenic
1078435931 11:11325990-11326012 GTGCAATTACAATTAAAAGAGGG - Intronic
1078958378 11:16230917-16230939 ATGCCATTTCAAGTCAGAGGAGG + Intronic
1079514382 11:21249641-21249663 GTGCAATTCCAATTCAAAACTGG + Intronic
1083153733 11:60809992-60810014 GTGCCCTTTTAATTCCATGGTGG - Intergenic
1083715677 11:64575150-64575172 GTGCCAAATCAATTAAAATGAGG + Intergenic
1084469309 11:69346796-69346818 GTGCCATGGCAATTCAGTGGAGG - Intronic
1085684240 11:78607185-78607207 ATACCATTTCAATTCTTAGGTGG + Intergenic
1087767890 11:102176370-102176392 GTGCAATTTAAATTTATAGGTGG + Intronic
1088483149 11:110315142-110315164 GTACCAGGTCAATTCAAAGGGGG - Intergenic
1088639192 11:111854571-111854593 ATGCCATATAAATTCAAAGATGG - Intronic
1089236961 11:117037464-117037486 AGGCTATTTCAGTTCAAAGGAGG + Intronic
1089803833 11:121064601-121064623 TTGCCATTTCAATTTAATGAAGG - Intronic
1091520911 12:1241361-1241383 ATAACATATCAATTCAAAGGAGG - Intronic
1092591884 12:9959665-9959687 GTTCCATATCATTTCCAAGGTGG - Intronic
1093444429 12:19240166-19240188 GTAACAGTTCAATTCAAAAGGGG - Intronic
1095142324 12:38680963-38680985 GTCACATTTCAATTTTAAGGGGG - Intronic
1096875935 12:54630604-54630626 GTGGCATTTGGACTCAAAGGAGG + Intergenic
1097628845 12:62035086-62035108 ATGCCTTATCAATTTAAAGGAGG + Intronic
1100660868 12:96697398-96697420 GTGCCATATAATATCAAAGGAGG - Intronic
1102014916 12:109641871-109641893 GTGCCACTGCAATTCCAGGGTGG - Intergenic
1103757400 12:123219838-123219860 GTGACATTTCATGACAAAGGAGG - Intronic
1104187011 12:126442513-126442535 GTGGCATTTGAAGTCAAAGCTGG - Intergenic
1105343953 13:19556537-19556559 GTGAGATTCCAACTCAAAGGTGG - Intergenic
1105536085 13:21265052-21265074 GTGAGATTCCAACTCAAAGGTGG + Intergenic
1106371073 13:29133615-29133637 GTGCCATGACTATTCAATGGGGG - Intronic
1106398151 13:29401612-29401634 GTGGCATTTCAAATCCATGGGGG - Intronic
1108364837 13:49699528-49699550 GTGCAATTCCAATTCAAAACTGG + Exonic
1108466215 13:50718334-50718356 GTGCCATTTAAATTTAAAGAAGG + Intronic
1110732461 13:78895067-78895089 GTGCCAAGGCAATTCAATGGGGG - Intergenic
1110938517 13:81320876-81320898 GTCTGGTTTCAATTCAAAGGTGG + Intergenic
1111326416 13:86702422-86702444 ATGCCATTTCTATTTAAAGATGG + Intergenic
1111794518 13:92900801-92900823 ATCCCATCTCAATTCATAGGGGG + Intergenic
1111843682 13:93481702-93481724 GTGCCATGGCCATTCAATGGAGG - Intronic
1113344206 13:109458176-109458198 GTGCCATTCAAGTACAAAGGAGG - Intergenic
1118186796 14:63544786-63544808 TTTCCATTTCAGTTCAAAGCAGG - Intergenic
1120509139 14:85392128-85392150 GTGTCATTTCACTTAAAATGTGG - Intergenic
1120806520 14:88757201-88757223 GTGCCAAGACAATTCAATGGGGG + Intronic
1124387330 15:29221182-29221204 GTGTCATTTGCATTAAAAGGTGG - Intronic
1125830443 15:42712580-42712602 GTGCCAAGACAATTCAATGGGGG - Intronic
1125890644 15:43263538-43263560 GTGCCAAGACAATTCAATGGGGG + Intronic
1125904959 15:43383162-43383184 GTGCTATTTTAATTTAAATGTGG - Intronic
1127283745 15:57514864-57514886 GTGCCAAGACAATTCAATGGGGG - Intronic
1130624420 15:85498980-85499002 GTTCCAATTTAATTCATAGGAGG - Intronic
1132024569 15:98394087-98394109 GGGCCATTTCTTTTTAAAGGAGG - Intergenic
1132729550 16:1354742-1354764 GTGCCACTTACATCCAAAGGTGG - Intronic
1135289887 16:21226586-21226608 GTGCCATTTTGTTTCAAAGATGG - Intergenic
1135623834 16:23978448-23978470 GTGCCATTTCTATTCCAATCTGG + Intronic
1135667169 16:24345655-24345677 GTGCCATTGCAATCCAAACTGGG + Intronic
1135894775 16:26389317-26389339 GTGCCAGTGCAATTCAGTGGGGG - Intergenic
1136018297 16:27421072-27421094 GTGCCAAAACAATTCAATGGGGG - Intronic
1136126181 16:28182875-28182897 GTGCCATTTCATTTGAAAAAAGG + Intronic
1137872885 16:51967621-51967643 GAGACATTTTTATTCAAAGGGGG - Intergenic
1138005805 16:53336354-53336376 GTGCCAAGACAATTCAATGGGGG + Intergenic
1143906139 17:10210591-10210613 GTGCCCTTTCATTTCCAAGATGG - Intergenic
1150372558 17:64652799-64652821 GTGCCAAGACAATTCAATGGAGG + Intronic
1150779820 17:68112354-68112376 GTGCCACGACAATTCAATGGAGG - Intergenic
1150881511 17:69034281-69034303 GTGCTATTTCAACTCACAGCAGG + Intronic
1153869028 18:9299384-9299406 GTGCAATTTCAAGTAACAGGTGG + Intergenic
1153870553 18:9315669-9315691 GTGCCAATGAAATTCAATGGGGG + Intergenic
1155406925 18:25499024-25499046 GTGCCAAGTCAATTCAATGGGGG + Intergenic
1158487064 18:57877155-57877177 GTGCCATTTTGATTGAATGGTGG + Intergenic
1159936345 18:74371111-74371133 ATGCCACTTCAATTTAAAGGTGG - Intergenic
1160316340 18:77851201-77851223 GTGCAATTTAACTTCAAAGAAGG + Intergenic
1161465611 19:4428692-4428714 GTGCTCTTTAATTTCAAAGGGGG - Exonic
1161723810 19:5917345-5917367 GTGCCATTTCAATTCAAAGGAGG + Exonic
1162127556 19:8507480-8507502 GTGCCATGTCACCTCAAAGATGG - Intergenic
1163010846 19:14425053-14425075 GTGCCATTACACTTCAAACTGGG + Intergenic
1165790789 19:38490627-38490649 ATGCTATTGCAATTCAAAGATGG + Exonic
1166557018 19:43707014-43707036 GTGCCATTTCCATCCAGATGGGG + Intergenic
926987818 2:18643156-18643178 GTGCCAAGTTAATTAAAAGGAGG + Intergenic
929569607 2:43013363-43013385 GTGTCAATACAATTCAATGGAGG - Intergenic
930407407 2:50976488-50976510 GTGCCTTTTCAAATCAAAAAGGG - Intronic
933015677 2:77123616-77123638 GTGACATTTTAATAAAAAGGAGG + Intronic
933643564 2:84790141-84790163 GTGCCAAGGCAATTCAATGGGGG + Intronic
935706058 2:105858571-105858593 GTGCCATTTTATTCCAAAGCAGG - Intronic
936166703 2:110127046-110127068 GGTCCATTTAACTTCAAAGGAGG - Intronic
938161862 2:128992574-128992596 GTGCGAGAGCAATTCAAAGGGGG + Intergenic
938877081 2:135543233-135543255 GTGCCAAGACAATTCAATGGGGG - Intronic
939474727 2:142673170-142673192 CTGCCATCTGAGTTCAAAGGTGG + Intergenic
939528095 2:143321737-143321759 GTGCCATTACACTCCAAAGTGGG - Intronic
939666724 2:144962134-144962156 TGGCCATGTCAATTCCAAGGTGG + Intergenic
940533657 2:154910004-154910026 GTGCCAGGGCAATTCAATGGGGG - Intergenic
941377039 2:164744412-164744434 GTGCTATATCAATTCAAAGAAGG - Intronic
942277220 2:174332297-174332319 GGGCCACTTCAACTCTAAGGTGG - Intergenic
942707902 2:178798007-178798029 GTGGCCTTTCAATTCAGGGGAGG - Intronic
944690330 2:202153101-202153123 GGCCCACCTCAATTCAAAGGAGG - Intronic
948235139 2:236382209-236382231 GTGCAAAAGCAATTCAAAGGAGG - Intronic
1169842121 20:9950864-9950886 GTAGCATTTCAATTCAATGAAGG + Intergenic
1172741677 20:37173388-37173410 GTGCTATTTAAATCTAAAGGAGG - Intronic
1175079475 20:56407187-56407209 GAGCCCTTTCAATTCAAACCTGG + Intergenic
1177477423 21:21642033-21642055 TCGCCATTTCAAATCAAAGTTGG + Intergenic
1179606310 21:42517773-42517795 TTGCCATTTGAATCCAAAGGAGG - Intronic
949371025 3:3334949-3334971 ATGCCACTTCCCTTCAAAGGTGG - Intergenic
949459310 3:4273568-4273590 GTGCCATCACAATTCAATGTTGG - Intronic
949892544 3:8744096-8744118 GGGCCATTCAAATTAAAAGGGGG - Intronic
950568531 3:13786077-13786099 GTCCCATTTTAATGCAAAGGAGG + Intergenic
951518369 3:23587335-23587357 CTGCCACTTCAGCTCAAAGGGGG - Intronic
952340770 3:32444321-32444343 GTGCCAATGCCATTCAATGGGGG - Intronic
953740121 3:45530917-45530939 ATGACATTTCAATTGAAATGTGG + Intronic
954760408 3:52869760-52869782 GTCCCATCACAAGTCAAAGGTGG + Intronic
956344934 3:68268284-68268306 GCACCATTTCAGTTTAAAGGAGG + Intronic
960604246 3:119488631-119488653 GTGACATCTGAATTCAAAGGAGG + Intronic
962633346 3:137302267-137302289 ATGCCTTTTCAATTCAATGGAGG - Intergenic
963026194 3:140921949-140921971 GTGGCATTTCAAATCACTGGGGG - Intergenic
963670462 3:148245355-148245377 GTGCCATGTAAATTCAAATGTGG - Intergenic
965560058 3:170052975-170052997 GTACCAATGCAATTCAATGGAGG - Intronic
970273442 4:14371241-14371263 TTGCAATTTCAATTATAAGGGGG - Intergenic
971612292 4:28741296-28741318 GTCCCTTTTCAAATCCAAGGCGG - Intergenic
973732821 4:53839719-53839741 TTGCCATGACAATTCCAAGGGGG - Intronic
975759198 4:77601619-77601641 GTGACATTTTAATTCACAGCAGG + Intronic
977293275 4:95186273-95186295 GTGCTATTTCAATAAAAAGCAGG + Intronic
979549172 4:121970968-121970990 TTAACATTTCAATTCAAAGAAGG + Intergenic
980569107 4:134587294-134587316 GTGCCATTTCAGTACAGAGACGG + Intergenic
982854783 4:160366824-160366846 GTGCCATGTTCATTCTAAGGAGG - Intergenic
984011630 4:174378666-174378688 GTCCCAATTAAAATCAAAGGAGG + Intergenic
984305145 4:177979750-177979772 GGGTGATTTCAATTCCAAGGTGG - Intronic
985612258 5:896851-896873 ATGCCATGTCAGTTCACAGGGGG + Intronic
985759625 5:1739369-1739391 TTGACAATTCAATTCAATGGAGG - Intergenic
986201749 5:5585518-5585540 TTTCCATTTTAGTTCAAAGGAGG - Intergenic
987714725 5:21553182-21553204 GTGTCAAGTCAATTCAATGGGGG - Intergenic
987943292 5:24570424-24570446 TGGCCATTTCAGTTCAAAGAGGG + Intronic
989808433 5:45641512-45641534 GTCCCAGTTCTATACAAAGGAGG + Intronic
993323264 5:86502219-86502241 GGGCCTTTCCATTTCAAAGGTGG - Intergenic
995479003 5:112576729-112576751 GTTCCTTTAGAATTCAAAGGAGG - Intergenic
996441281 5:123493953-123493975 GGGCAATATCTATTCAAAGGAGG + Intergenic
997280644 5:132642110-132642132 GTGACTTTTCAAATCAAAGAAGG + Intronic
998024885 5:138807479-138807501 GTGTCATGGGAATTCAAAGGAGG - Intronic
998293134 5:140936875-140936897 GTGCCAATTAAAATCAAAGCAGG - Intronic
998779532 5:145640885-145640907 GTGGCATTACAAATCAAGGGAGG + Intronic
999536392 5:152522286-152522308 GTGGCATTTCAATCCAGAGCTGG - Intergenic
1002682684 5:180980676-180980698 GTGCCATGTCTATTAAAAAGAGG - Intergenic
1003365210 6:5467344-5467366 GGGCCATTTCATTTCTAAGGAGG + Intronic
1003598047 6:7492580-7492602 GTGCCAAGTCCATTCAATGGGGG - Intergenic
1005247544 6:23905578-23905600 CTACCATTTCAATGCAAATGTGG - Intergenic
1005777958 6:29158351-29158373 GTGCCATTTTAATTTATATGCGG + Intergenic
1007028398 6:38602154-38602176 GTAGCATTTCAATTAAATGGGGG + Intronic
1009001992 6:57728860-57728882 GTGTCAAGTCAATTCAATGGGGG + Intergenic
1009563839 6:65284084-65284106 GTGCCATTTCAATTCTTGGCAGG - Intronic
1013959642 6:115883722-115883744 TTGGCAGCTCAATTCAAAGGAGG + Intergenic
1018098955 6:160419304-160419326 CTGACATTTCCTTTCAAAGGGGG + Intronic
1018745448 6:166758133-166758155 GTGTCATTTAAACTGAAAGGAGG + Intronic
1021850792 7:24806543-24806565 TTGGCATTTCAATGCAAATGGGG + Intronic
1022532106 7:31073624-31073646 GAGCAATTTCCATTCAAAAGAGG + Intronic
1023938068 7:44753936-44753958 GTGCGAGAGCAATTCAAAGGAGG - Intronic
1024652286 7:51414759-51414781 TTTCCCTTTCAATTCAAGGGGGG + Intergenic
1025037472 7:55605394-55605416 TTTCCCTTTCAATTCAAGGGGGG + Intergenic
1026364595 7:69635068-69635090 GTGCCAGTTCAATACACATGGGG - Intronic
1027979098 7:85194618-85194640 GTAGCATTTAAATTCAAAGAGGG + Intergenic
1029235754 7:99117074-99117096 GTGCCAATACCATTCAATGGGGG + Intronic
1032151122 7:129430913-129430935 GTGCCATTCCAGTTAAGAGGAGG + Intergenic
1033004373 7:137545742-137545764 GCTCCATTTCAAATCAAAGAGGG + Intronic
1039027977 8:33278802-33278824 GTACCAGTTGAATTGAAAGGTGG + Intergenic
1039631135 8:39112650-39112672 GTGGCATTTCAAATGAATGGGGG - Intronic
1040548432 8:48420118-48420140 GTGCCTTTTCAAATAAAAAGAGG + Intergenic
1041078756 8:54193857-54193879 GTGCCAATACCATTCAATGGTGG - Intergenic
1042463897 8:69104044-69104066 GTGCCATATCAACTCAAGGATGG - Intergenic
1044152110 8:88793828-88793850 GTGCAAATACAATTCAATGGAGG + Intergenic
1046620808 8:116527655-116527677 GTGCTATTGGAATTCACAGGAGG + Intergenic
1049049013 8:140177403-140177425 GTGCCAAGGTAATTCAAAGGGGG - Intronic
1049926450 9:413137-413159 GTGCCAAAACAATTCAATGGGGG + Intronic
1055719204 9:79152921-79152943 GTTTAATTTCAATGCAAAGGAGG - Intergenic
1055917019 9:81414340-81414362 GTGTTATTTTAATTCAAAAGAGG + Intergenic
1056159793 9:83877388-83877410 GTGCCAAGTCCATTCAATGGAGG + Intronic
1056360432 9:85852417-85852439 GTGCCAAGTCCATTCAATGGAGG - Intergenic
1186419900 X:9417219-9417241 GTGACATTTCAATTCAATTCTGG - Intergenic
1186453628 X:9693358-9693380 GTTCCATTTCAAGGCAAAGATGG - Exonic
1186651265 X:11562773-11562795 GTGACATTGCGTTTCAAAGGTGG - Intronic
1186770578 X:12814119-12814141 ATGCCATTTCAAATCAATAGAGG - Intronic
1187228815 X:17401116-17401138 GTGCCAAGACAATTCAATGGGGG + Intronic
1190915189 X:54806693-54806715 GTGCCATTTCAAAGCAGAGAGGG + Intergenic
1196067434 X:111480123-111480145 GTGCCAAGACAATTCAATGGGGG - Intergenic
1196687174 X:118521195-118521217 GTGGCATTTCAACTCAGAAGTGG - Intronic
1196806626 X:119593738-119593760 GTGCCAAGGCAATTCAATGGAGG + Intronic