ID: 1161727189

View in Genome Browser
Species Human (GRCh38)
Location 19:5936330-5936352
Sequence CTGCATGTGGAGATGACGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161727189_1161727195 15 Left 1161727189 19:5936330-5936352 CCTGGCGTCATCTCCACATGCAG 0: 1
1: 0
2: 0
3: 7
4: 119
Right 1161727195 19:5936368-5936390 GTAAGAGATCATGTGGACAAAGG 0: 2
1: 0
2: 1
3: 14
4: 202
1161727189_1161727194 8 Left 1161727189 19:5936330-5936352 CCTGGCGTCATCTCCACATGCAG 0: 1
1: 0
2: 0
3: 7
4: 119
Right 1161727194 19:5936361-5936383 GCAGAAAGTAAGAGATCATGTGG 0: 1
1: 2
2: 0
3: 17
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161727189 Original CRISPR CTGCATGTGGAGATGACGCC AGG (reversed) Intronic
906058062 1:42931207-42931229 CTGCAGGGGGAGATGCAGCCTGG + Intronic
906701844 1:47865220-47865242 CTGCAAGCGGAGAGGAGGCCTGG - Intronic
907838616 1:58134978-58135000 CTTCATGTGGAGATGAGGTCTGG + Intronic
915032659 1:152896844-152896866 CTGCATGTAGGGATGAGGCAAGG - Intergenic
916584385 1:166137857-166137879 CTGCATGTGGGGATGTAGACAGG - Intronic
920615436 1:207487836-207487858 CTGCAGGTGCAGATGAAGGCAGG + Intronic
921637362 1:217512209-217512231 CTACCTGTGGAGCTGAGGCCAGG + Intronic
922325089 1:224521023-224521045 TTGCATGTGGACGTGATGCCTGG - Intronic
924004029 1:239587172-239587194 CAGCACGTGGAGGTGAGGCCAGG - Intronic
924773408 1:247096723-247096745 CTGCATGTGGAGCTAACCCCAGG - Intergenic
1065004112 10:21363836-21363858 CTGAATGTGGAAATCAAGCCAGG + Intergenic
1066028028 10:31384727-31384749 CTGCAGGTGGAAATGAGGCAAGG + Intronic
1067024861 10:42836175-42836197 CTGCATGTGTTGAGGACCCCAGG - Intergenic
1071971845 10:90915843-90915865 CTGCATGTGGCGGTGAGGACTGG - Exonic
1073143539 10:101264571-101264593 CACAATGTGGAGATGACTCCAGG + Intergenic
1075540227 10:123306650-123306672 ATGCATGCCGAGATGACTCCAGG + Intergenic
1075583052 10:123636665-123636687 CTGGATGGGGAGATGAGGCCGGG + Intergenic
1076825319 10:132964325-132964347 CTGCAGGTGGAGAGGAGGCAAGG + Intergenic
1077269669 11:1669764-1669786 CTGATTGTGGAGATGTCTCCTGG - Intergenic
1077609625 11:3636303-3636325 CTGAATGAGGACATGACGCTGGG - Intergenic
1084272847 11:68038414-68038436 CTGCAGGTGGAGCTGACAGCTGG + Intergenic
1089845000 11:121451811-121451833 CTGGAGGTGGGGATGAGGCCGGG + Intergenic
1089921332 11:122212352-122212374 CTGCATCTACAGAGGACGCCTGG + Intergenic
1090383731 11:126344530-126344552 CTGCATTTGGAGCTCACCCCAGG - Intronic
1091129046 11:133128560-133128582 CTGCCAGTGGAGAGGACCCCTGG + Intronic
1093784586 12:23177389-23177411 CTGCATCTGAAGATGAGGCTGGG - Intergenic
1094807390 12:34106784-34106806 CACCATGTGGGGATGACGCTGGG - Intergenic
1099415149 12:82375324-82375346 CTGCATGTGAAGATGTAGCAAGG + Intronic
1100790754 12:98127423-98127445 CAGCATTGGGAGATGAGGCCCGG + Intergenic
1101888712 12:108692062-108692084 CTTCATGTGGTAATGAGGCCAGG + Intronic
1106422981 13:29598988-29599010 CTGCATGTGGAGAGGGCTTCAGG + Intergenic
1109163097 13:59001139-59001161 CTGCCTGTGGAGATGGCCACTGG - Intergenic
1109815330 13:67574900-67574922 CTGCATGGGGAGAAGACTCTTGG + Intergenic
1114152862 14:20064333-20064355 CTGCTTGTGCAGATAACTCCTGG + Intergenic
1114529782 14:23388508-23388530 CTGCAGGTAGGGAGGACGCCTGG - Intronic
1118501014 14:66362741-66362763 CTTCATGTGGAGATGAAGGCAGG - Intergenic
1125801831 15:42455625-42455647 GTGCATGAGGAGACGAGGCCAGG - Intronic
1128546873 15:68574276-68574298 CAGCATGTGGGCATGCCGCCTGG + Intergenic
1128579475 15:68798760-68798782 CTGCAAGTGGAGAAGAGGCAGGG + Intronic
1133229830 16:4361232-4361254 CTGCAGCTGGTGAGGACGCCAGG - Exonic
1133267217 16:4592342-4592364 CGGCCTGTGGAGATGATGACTGG + Exonic
1136057729 16:27702869-27702891 CTGCATGTGAAAAGGCCGCCCGG + Intronic
1143003483 17:3811065-3811087 CTGCAGGTGGAGGAGGCGCCAGG - Intergenic
1143159814 17:4862086-4862108 CTACTTGTGGAGATGAGGCTTGG + Intronic
1151749732 17:76029677-76029699 CAGCATGAGAAGATCACGCCAGG - Intergenic
1152127012 17:78453256-78453278 GTGCATGTAGAGAAAACGCCCGG - Intronic
1152820521 17:82435572-82435594 CTGCCTGTGGGGAGGAGGCCAGG - Intronic
1158705278 18:59787013-59787035 CTGCTGGTGGAGATGAGGCTTGG - Intergenic
1159762878 18:72450505-72450527 CTGCATGTGGGAATTACGCAAGG - Intergenic
1160224569 18:77002129-77002151 CTCCATGTGGAGTTGCCGCCTGG + Intronic
1160483826 18:79269822-79269844 CTGCTTGTGGAGCTGAAGTCAGG - Intronic
1161268297 19:3375301-3375323 CTGCCTGTGGAGGAGATGCCAGG - Intronic
1161727189 19:5936330-5936352 CTGCATGTGGAGATGACGCCAGG - Intronic
1164760114 19:30722321-30722343 CTGCATGTGGAGGGAAGGCCTGG + Intergenic
1164857295 19:31534970-31534992 CCGCATGTGGACATGGGGCCTGG - Intergenic
1166193560 19:41192323-41192345 CTGCATGTGGATATGAGCTCAGG + Intergenic
1166876475 19:45901025-45901047 CTGCCTGTGCTGATGACCCCAGG + Intronic
1167223101 19:48216486-48216508 ACTCATGTGGAGATGAGGCCTGG + Intronic
925014887 2:515254-515276 CTGCATGTGGAGCAGAAACCAGG + Intergenic
925102074 2:1255624-1255646 CTGCATCGGCAGGTGACGCCTGG + Intronic
927844203 2:26463040-26463062 CTGGATGTGAGGATGACGCAGGG + Intronic
928421241 2:31138816-31138838 CTGCACGTGGCGCTGAAGCCGGG + Intronic
928824152 2:35398458-35398480 TTGAATGTGGAGATGTAGCCTGG + Intergenic
932045291 2:68342410-68342432 CTGCTTGGAGAGATGACCCCGGG - Intergenic
933945980 2:87286537-87286559 CTGCATGTGGAGTTGAGGGAGGG + Intergenic
935433638 2:103004515-103004537 CTGCAGGTGGAGGTGGCCCCAGG - Intergenic
936334233 2:111575049-111575071 CTGCATGTGGAGTTGAGGGAGGG - Intergenic
937986752 2:127641457-127641479 CTGCATGTGAGGATGAGGGCTGG + Intronic
938623140 2:133078473-133078495 CTGCATGGGGAGATTCCCCCAGG + Intronic
947224046 2:227822969-227822991 CTTCATGTTGAGAAGACCCCAGG + Intergenic
1172067073 20:32228804-32228826 CTGACTGTGGAGATGAGGCATGG + Intronic
1176191000 20:63809496-63809518 CAGCAGGTGGAGAGGACTCCGGG + Intronic
1180035235 21:45244900-45244922 CTGCATGGGAAGATGGCTCCAGG + Intergenic
1180037518 21:45257416-45257438 CTCACTGTGGAGATGAGGCCCGG - Intergenic
1180044933 21:45300988-45301010 CTGCAGGAGGTGAAGACGCCAGG + Intergenic
1181173857 22:21025253-21025275 CTGCATGACGAGGTGACGCTCGG - Intronic
1181427251 22:22851656-22851678 CTGCATGAGGGCATGGCGCCTGG - Intronic
950150203 3:10680880-10680902 CTCCATGTGGAGGTGGGGCCTGG + Intronic
954335118 3:49911795-49911817 CTGCAGGAGGAGATGCTGCCAGG - Exonic
955660867 3:61297673-61297695 GTGCATGTGGAGAGGAAGCAAGG + Intergenic
955892382 3:63663730-63663752 CTGCATGTGGTGAGGACCTCAGG - Intronic
962737054 3:138335132-138335154 CTGCATGTGCAGGTGTCACCTGG + Intergenic
962806837 3:138933543-138933565 CTGCCTCTGGAGATGGCGCTTGG - Intergenic
966908113 3:184542431-184542453 CTGCATCTGTAGATGACACAAGG + Intronic
969302135 4:6303425-6303447 CTCCAGCTGGAGATGAAGCCAGG - Intergenic
969414635 4:7050463-7050485 CTCCCTTTGGAGACGACGCCTGG + Intronic
969425948 4:7123875-7123897 CTGGAGGTGGAGAGGCCGCCAGG + Intergenic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
1000594613 5:163200347-163200369 CTGTATGAGGACATGATGCCTGG + Intergenic
1002168242 5:177361200-177361222 CAGCCTGTGGAGATGACCCCTGG - Intronic
1002605260 5:180379406-180379428 CTGCATGTGGAGAACACACTTGG - Intergenic
1002824079 6:756926-756948 CTGCATTTGGAGATGAAGGAAGG + Intergenic
1003525942 6:6897480-6897502 CTGTATGTGGAATTGACACCTGG + Intergenic
1006583264 6:35088707-35088729 CTGCAGGCGGAGGTGAGGCCTGG - Exonic
1018793707 6:167170103-167170125 CTGCCTGTGGAGAGCACACCTGG - Intronic
1018822626 6:167384978-167385000 CTGCCTGTGGAGAGCACACCTGG + Intergenic
1019357073 7:586056-586078 TGGCATGTGGAGATGATGGCTGG + Intronic
1021167372 7:17358157-17358179 TTGCATGTGTAGATGCCACCTGG - Intergenic
1028936957 7:96475675-96475697 CTACATGTGGAGGTGCCTCCAGG + Intergenic
1032261150 7:130338015-130338037 CTGCATTTGAGGATGACGCCAGG + Intergenic
1032340424 7:131067327-131067349 CTCCATGTGGCGATGATGCTTGG + Intergenic
1036424280 8:8629044-8629066 CTGCATGTGAAGGAGACACCTGG - Intergenic
1036728655 8:11242646-11242668 CTGCCTCTGGAGATAACACCTGG - Intergenic
1037819611 8:22129349-22129371 CTGCATGTGGAGAGGCAGCATGG - Intronic
1037925570 8:22841613-22841635 CTGCATGTGCAAATGCCACCTGG + Intronic
1038010915 8:23475156-23475178 CTGCATGGGGAGAGGCTGCCTGG + Intergenic
1038575233 8:28699273-28699295 TTGCAGGTGGAGATGATGCAGGG + Intronic
1039612041 8:38927876-38927898 CTGGAGCTGGAGATGACGGCTGG + Intronic
1047205408 8:122799233-122799255 CTGCGTGGGGAGATGAGGCTTGG - Intronic
1048161024 8:132022214-132022236 CTGCATGTGTAGGTGTCCCCTGG + Intergenic
1048305021 8:133278143-133278165 CTGAATGAGCAGATGACCCCTGG + Intronic
1049207881 8:141371833-141371855 ATACATGTGGAGATGAAGGCCGG + Intergenic
1049253302 8:141600828-141600850 CTGCATGTGTAGAGGGTGCCTGG - Intergenic
1050582535 9:7075609-7075631 CTGCATGTGGTGAGGACCTCAGG - Intronic
1051493979 9:17698171-17698193 CTGCATCTGGACTTGAAGCCAGG - Intronic
1054928622 9:70613681-70613703 CTGCCTGTGGAGAAGAAGCTTGG + Intronic
1057092019 9:92266810-92266832 CTGCATGTGGGGAGGACCTCAGG - Intronic
1057131681 9:92658351-92658373 CTGCTTGTGGCGAGGACCCCAGG - Intronic
1060492396 9:124094513-124094535 TTAAAAGTGGAGATGACGCCGGG - Intergenic
1060733652 9:126052804-126052826 CCCCAGGTGGAGATGAGGCCGGG + Intergenic
1060818549 9:126648693-126648715 CTTCAGGTGAAGATGAGGCCTGG + Intronic
1062143449 9:134973246-134973268 CTGCGTGTGCACTTGACGCCCGG - Intergenic
1062732473 9:138117844-138117866 CTGCATGTGTTGGAGACGCCTGG + Intronic
1199266042 X:145827186-145827208 TTGAATGTGGAGAAGACTCCTGG + Intergenic
1199584363 X:149398115-149398137 CTGCAGGTGGGGATGACCCAGGG - Intergenic
1200278844 X:154759750-154759772 GTTCATGTGGAGGTGATGCCTGG - Intergenic
1200281894 X:154784188-154784210 CTGCTTGTTGAGATGTCGCGAGG - Intronic