ID: 1161727255

View in Genome Browser
Species Human (GRCh38)
Location 19:5936765-5936787
Sequence CATCAGTGGGTGACCGTCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161727255_1161727260 20 Left 1161727255 19:5936765-5936787 CCATAGACGGTCACCCACTGATG 0: 1
1: 0
2: 0
3: 2
4: 133
Right 1161727260 19:5936808-5936830 TATGTTGACACAATCGATCAAGG 0: 1
1: 0
2: 0
3: 1
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161727255 Original CRISPR CATCAGTGGGTGACCGTCTA TGG (reversed) Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
903032012 1:20470521-20470543 CATCAGGTGGTGACAGTTTATGG + Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905004839 1:34701191-34701213 CATCAGTCAGTGACAGCCTAGGG - Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
911115306 1:94239959-94239981 CATCACTGGGTGAGTGTCCATGG - Intronic
911333740 1:96556094-96556116 CACCAGTGGGTGAGCATCTGTGG - Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915143149 1:153779175-153779197 CTTCAGGAGGTGAACGTCTATGG + Exonic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
923049512 1:230380969-230380991 CAGGAGTGGGTGGCCGTCTGCGG + Intronic
924943591 1:248829775-248829797 CATCAGAGGGAGACCGTGCAGGG - Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1065883915 10:30060034-30060056 CATCTGTGCGTGACTGTATATGG - Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1070509661 10:77148829-77148851 CATCAGAGGTTGACCAACTATGG - Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1074281502 10:112055974-112055996 CATCAGAGTTTGACTGTCTAGGG + Intergenic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1080814707 11:35743745-35743767 CATCAGTGGGTTACAATCCATGG + Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1090412025 11:126515805-126515827 AATCAGTAGGTGACAGTCTGAGG - Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1104013825 12:124949586-124949608 CATCAGCGTGTGACCTTATATGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1120092911 14:80354195-80354217 CTTCAGTGGTTCACCATCTATGG + Intronic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1129285742 15:74523094-74523116 AATCAGAGGGAGACAGTCTATGG + Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139373904 16:66484993-66485015 CATCATTGGGTCCCCGTGTATGG + Intronic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1149044710 17:52231326-52231348 CATCAGTGGGTGATGGTCACGGG - Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1161727255 19:5936765-5936787 CATCAGTGGGTGACCGTCTATGG - Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1162821630 19:13226747-13226769 CATCAGTGTGCCACCGTCCAGGG + Intronic
1163843226 19:19624271-19624293 CATCAGTGGGTGGCCGTTCTCGG + Exonic
1164196820 19:22974877-22974899 CAACAGAGGGAGACTGTCTAGGG - Intergenic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166307121 19:41941132-41941154 CATTTGTGGGTGACCGACTTGGG - Intergenic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1167973085 19:53201175-53201197 CATCAGTGGGTCACAGGCAATGG - Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
927163217 2:20289878-20289900 TATCAGTGGTTGTCCGTATATGG - Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929613934 2:43293346-43293368 CATAAGTGAGTGGCCCTCTAAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
934233526 2:90208941-90208963 CATCAGTGGGCTACAGTCTAGGG - Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
947154509 2:227148259-227148281 CATCAGTGGGTGAATGAATAAGG + Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1175254429 20:57630774-57630796 GATCACTGGGTGAAGGTCTAGGG + Intergenic
1177543301 21:22523324-22523346 CATCAATGGGTGACTGGATAAGG + Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
956809779 3:72853561-72853583 CATCAGTGGTTGACTGGATAAGG - Intronic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961463058 3:127065027-127065049 CACCAGTGGGTGACCAGCTTAGG + Intergenic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
972154692 4:36145286-36145308 GATCAGTGGTTGACGGGCTAAGG + Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973752177 4:54032289-54032311 CATCAGAGGGAGACCGTAGAGGG - Intronic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
980098583 4:128518918-128518940 CTTCAGTGGGTTCCTGTCTAGGG - Intergenic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
984316971 4:178140867-178140889 GGTCAGGGGGTGACCGTATAGGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
990924128 5:61000122-61000144 GATCAGTGGTTGACAGACTATGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
998330746 5:141324329-141324351 CATCTGTGGCTGACCATCTGTGG - Intergenic
1002415185 5:179116763-179116785 CATCAGAGGGTGCCCGACTTCGG + Intronic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1017411575 6:154172928-154172950 TATCAGTGGGTGCCCCTCTGGGG + Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1024228360 7:47345692-47345714 CATCTGTGGGTCACCTCCTAGGG + Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033859632 7:145608531-145608553 CATCAGTGATTGACCGGATAAGG - Intergenic
1034520040 7:151612719-151612741 GCTCAGCGAGTGACCGTCTATGG + Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1037765354 8:21769160-21769182 CAGCAGTGGTTGACCGTCTCCGG + Intronic
1038148998 8:24925630-24925652 CATCAGTGGGTGAACGTTACAGG - Intergenic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1050464773 9:5910597-5910619 CCTCAGTGAGTGACAGTCTGGGG - Exonic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051973758 9:22923652-22923674 CAGCAGTGGCTCACCCTCTAAGG - Intergenic
1062284356 9:135766456-135766478 CATCAGGGGCGGACCGTCTGGGG + Intronic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1192621815 X:72683764-72683786 CATCAGTGGGTGAATCTCAAAGG - Intronic
1198777548 X:140196820-140196842 CATCAATGGGTTACAGTCCATGG - Intergenic