ID: 1161729050

View in Genome Browser
Species Human (GRCh38)
Location 19:5947733-5947755
Sequence CCACGTCCCTGCCGGCGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 177}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161729050 Original CRISPR CCACGTCCCTGCCGGCGGGG TGG Intronic
900558654 1:3292671-3292693 CCACCTCCCTTCCTGTGGGGTGG + Intronic
901066996 1:6498902-6498924 CGAGGTCCCTGCCTGCTGGGAGG + Intronic
901882464 1:12202257-12202279 CCTCGTCCCACCCTGCGGGGAGG - Intronic
902747212 1:18482021-18482043 CCACGGCCCTGTCTGCGGGGAGG - Exonic
903179491 1:21598088-21598110 CCACCTCACTGGCCGCGGGGAGG + Intronic
903438381 1:23369167-23369189 CCAGGCCCCTGCGGGGGGGGCGG + Intronic
903894817 1:26596406-26596428 CCACCTCCCTCCCGGACGGGGGG - Intergenic
908128124 1:61050443-61050465 CCCCGTGAGTGCCGGCGGGGCGG + Intronic
909957767 1:81800985-81801007 CCCCGGCTCCGCCGGCGGGGCGG - Intronic
911325839 1:96469780-96469802 CCACCTCCCTCCCGGATGGGGGG + Intergenic
917553340 1:176058110-176058132 CCACCTCCCTCCCGACGGGGTGG - Intronic
920100406 1:203513808-203513830 CCCCGTCCCTGAGGGAGGGGTGG - Intergenic
922102534 1:222487969-222487991 CCACCTCCCTCCCGGATGGGGGG - Intergenic
923589931 1:235309402-235309424 CCACCTCCCTCCCGGACGGGTGG - Intronic
1064247997 10:13684531-13684553 CCATGTGTCTGCCGGCCGGGAGG - Intronic
1065387439 10:25147628-25147650 CCACTTCACTGCAGGCTGGGTGG - Intergenic
1068135657 10:52949631-52949653 CCACGTCACTGCCTCCGGGGAGG - Intergenic
1069052542 10:63811286-63811308 CCACCTCCCTCCCGGACGGGGGG + Intergenic
1070807444 10:79279030-79279052 CCACGTCCCAGACGGGGCGGCGG + Intronic
1073514961 10:104068044-104068066 CCATGGCCCTGCTGGCGGAGGGG + Intronic
1075923855 10:126235216-126235238 CCAGGTCCCTCCCTGGGGGGTGG - Intronic
1077326141 11:1964925-1964947 CGCTGTCCCTGCCGACGGGGAGG - Intronic
1080860121 11:36144832-36144854 CCACCTCCCTCCCGGACGGGCGG - Intronic
1082010946 11:47449233-47449255 CCACGTCCCAGCTCGCGGGTGGG - Intergenic
1083330599 11:61896679-61896701 CCACATCCCTACAGGTGGGGAGG + Intergenic
1202809121 11_KI270721v1_random:20104-20126 CGCTGTCCCTGCCGACGGGGAGG - Intergenic
1091550427 12:1531428-1531450 CCACGTCCCCGCCGTGGGAGAGG + Intronic
1091571643 12:1691532-1691554 CCAGCTCCCTGCCCGCGGAGAGG + Intronic
1095571119 12:43685290-43685312 CCACCTCCCTCCCGGACGGGGGG - Intergenic
1095571196 12:43685464-43685486 CCACCTCCCTCCCGGACGGGTGG - Intergenic
1096082428 12:48842251-48842273 CCACCTCCCTCCCGGATGGGCGG - Intronic
1096788911 12:54033338-54033360 CCGCGGCGCTGCAGGCGGGGCGG - Exonic
1096856642 12:54488392-54488414 CCACCTCCCTCCCGGACGGGTGG + Intergenic
1097218215 12:57430691-57430713 CCACCTCCCGGCCGAGGGGGCGG - Intronic
1100577591 12:95907589-95907611 CCACCTCCCTCCCGGACGGGTGG + Intronic
1102768493 12:115452883-115452905 CCTTGTCCCTGCAGGCGGGCCGG - Intergenic
1103239722 12:119403248-119403270 CCACCTCCCTGGCTGCAGGGAGG - Intronic
1103775686 12:123364860-123364882 CCCCGCCCCTCCCGGCGGGGCGG - Intergenic
1104925647 12:132312813-132312835 CCACGTCTCTGCCCCCAGGGTGG + Intronic
1105799244 13:23889247-23889269 CCCCGGCCCGCCCGGCGGGGCGG + Exonic
1106840661 13:33682328-33682350 CCCCATCCCTGCCTGGGGGGAGG - Intergenic
1107165862 13:37280470-37280492 CCACCTCCCTCCCGGACGGGTGG - Intergenic
1110596598 13:77326802-77326824 CCTCGTCCCCGCGGGCCGGGCGG + Intronic
1112088208 13:96053529-96053551 CCACGTCGGAGCCGCCGGGGCGG + Intergenic
1114473737 14:22980757-22980779 CCAGGTGCCCGCGGGCGGGGCGG - Intronic
1114507932 14:23232530-23232552 CCACCTCCCTCCCAGAGGGGTGG - Intronic
1115235663 14:31207200-31207222 CCGGGGCCCTGCCGGCGGCGGGG - Exonic
1115688905 14:35824690-35824712 CCACCTCCCTCCCGTCCGGGAGG + Intergenic
1118955632 14:70477787-70477809 CCACCTCCCTCCCGGCGGGGCGG - Intergenic
1120505783 14:85352717-85352739 CCACCTCCCTCCCGACGGGGTGG + Intergenic
1122212283 14:100180980-100181002 CCACCTCCCTCCCGGACGGGCGG - Intergenic
1122436811 14:101706278-101706300 CCCTGTCCCTGCCTCCGGGGCGG - Intergenic
1125016950 15:34946685-34946707 CCACCTCCCTCCCGGACGGGCGG - Intronic
1125532348 15:40421919-40421941 CCCAGTCCCTGCCTGCCGGGTGG + Intronic
1127224996 15:56918970-56918992 CCGCGTCCCTGCCGGAGTGGGGG + Intronic
1127480369 15:59372153-59372175 CCACGTCCCAGCAGGAGGAGGGG + Intronic
1128794980 15:70459946-70459968 GCACTTCCCTGCCAGCCGGGTGG + Intergenic
1129428529 15:75481588-75481610 CCACCTCCCTCCGGACGGGGTGG - Intronic
1129428550 15:75481634-75481656 CCACCTCCCTCCCGGACGGGCGG - Intronic
1129431368 15:75503784-75503806 CCACCTCCCTCCCGGACGGGGGG - Intronic
1129935113 15:79440672-79440694 CCACGTGCCTGCCTGGGTGGTGG - Intronic
1134675460 16:16086988-16087010 CAAGGTGCCTGCTGGCGGGGTGG + Exonic
1136564442 16:31061575-31061597 CCCCGCCCCTGCTGCCGGGGCGG + Exonic
1138043590 16:53698647-53698669 CCACCTCCCTCCCGACGGGGCGG - Intronic
1138467204 16:57200971-57200993 CCACCTCCCTCCCGGACGGGCGG + Intronic
1138467228 16:57201019-57201041 CCACCTCCCTCCCGGATGGGCGG + Intronic
1138699290 16:58846186-58846208 CCACCTCCCTCCCGGACGGGCGG + Intergenic
1139468064 16:67164664-67164686 CCACGTGCAAGCCCGCGGGGCGG - Exonic
1140221663 16:73048333-73048355 CCGGGTCCCTGCGGGCGGGCGGG - Exonic
1141503999 16:84462823-84462845 TCTGGGCCCTGCCGGCGGGGAGG - Intronic
1141941459 16:87278800-87278822 CCACATCTCTGCCGGCCAGGAGG - Intronic
1142312530 16:89322473-89322495 CCACGTGCCTGCGTGAGGGGAGG - Intronic
1142605736 17:1080120-1080142 CCACTTCCCTGCTGGCGTGTGGG - Intronic
1142750153 17:1982706-1982728 CCACCTCCATGCAGGAGGGGAGG - Intronic
1142876417 17:2853994-2854016 CCATGTCCCAGCCCGCGGGGAGG + Intronic
1143371637 17:6444239-6444261 CCACGAGGCTGGCGGCGGGGCGG + Intergenic
1143569166 17:7743955-7743977 CCAAGTCCCTGCCCTCAGGGAGG + Intronic
1144524674 17:15979804-15979826 CCACCTCCCTCCCGGACGGGGGG + Intronic
1144524716 17:15979885-15979907 CCACCTCCCTCCCGGACGGGGGG + Intronic
1145976221 17:28985942-28985964 CCCCGGCCCTGCGGGAGGGGAGG - Intronic
1147852393 17:43452449-43452471 CCACCTCCCTCCCGGACGGGGGG - Intergenic
1148048687 17:44759000-44759022 CCGCGGCCATCCCGGCGGGGCGG - Intergenic
1148406570 17:47421000-47421022 CCACCTCCCTCCCGGACGGGGGG - Intronic
1151337808 17:73450398-73450420 CCATGTCCCGGTCTGCGGGGTGG - Intronic
1152111360 17:78359348-78359370 TCCCGCCCCTGCCGGCAGGGTGG + Intronic
1152349957 17:79778694-79778716 CCCCGTCCCGGCCGGGAGGGAGG + Intronic
1152524060 17:80877265-80877287 CCAGGTTCCTGCCTGCGGGGAGG + Intronic
1152568339 17:81110190-81110212 CCACGTCCCAGGCCACGGGGAGG - Intronic
1152924553 17:83081056-83081078 CCACGCCCCTTCCCCCGGGGAGG - Intronic
1154278243 18:12980010-12980032 CCACCTCCCTCCCGGACGGGCGG + Intronic
1156448565 18:37253984-37254006 CCGGGGCGCTGCCGGCGGGGAGG + Intronic
1160680097 19:408484-408506 GCAGGGCCCTGCCGGCGGGGTGG + Intronic
1160861256 19:1238032-1238054 CCCCTTCCCTTCCGGCGGGGCGG + Intergenic
1160952858 19:1675879-1675901 CCCCGCCCGGGCCGGCGGGGAGG - Intergenic
1160991601 19:1862580-1862602 CCGCGTCGCCGCCGCCGGGGTGG - Intronic
1160991663 19:1862813-1862835 CCCCGCCACTGCCGCCGGGGCGG + Intronic
1161163115 19:2771627-2771649 CCACGTACCTGCCTGTGTGGGGG - Intronic
1161729050 19:5947733-5947755 CCACGTCCCTGCCGGCGGGGTGG + Intronic
1163905657 19:20149512-20149534 CCACCTCCCTCCCGGACGGGCGG + Intergenic
1164256576 19:23533429-23533451 CCACCTCCCTCCCGATGGGGCGG + Intronic
1166191670 19:41180441-41180463 CCACCTCCCTCCCGGACGGGGGG - Intergenic
1166531932 19:43548056-43548078 CCACCTCCCCCCCGACGGGGCGG - Intronic
1166531970 19:43548135-43548157 CCACCTCCCTCCTGGAGGGGCGG - Intronic
925158775 2:1667045-1667067 CCACGTCCCTGCAGGTGGGCTGG - Intronic
925407552 2:3615906-3615928 CCACCTCCCTCCCGGACGGGGGG + Intronic
926738791 2:16094177-16094199 CCACGACGCTGCCGGCCAGGTGG - Intergenic
929110759 2:38403687-38403709 CCACCTCCCTCCCGGACGGGCGG - Intergenic
929739612 2:44588454-44588476 CCACCTCCCTCCGGACGGGGCGG - Intronic
933751170 2:85602740-85602762 CCACGTCCCGGCGGGCGGCGCGG - Intronic
934045545 2:88170339-88170361 CCGCGTCCCTGACGGTGCGGTGG - Intronic
934774473 2:96928413-96928435 CCTGGTCCCTGCCTGTGGGGAGG - Intronic
940269549 2:151875681-151875703 CCACCTCCCTCCCGGACGGGCGG + Intronic
944060870 2:195568352-195568374 CCACCTCCCTCCCGGACGGGCGG - Intergenic
944262993 2:197696246-197696268 CCACCTCCCTCCCGGACGGGCGG + Intronic
946304243 2:218846834-218846856 CCACCTCCCTCCCGGATGGGCGG - Intergenic
946318240 2:218931828-218931850 CCACCTCCCTCCCGGACGGGCGG - Intergenic
948462923 2:238138950-238138972 CCATGTCCCAGCCGGAGAGGTGG + Intronic
948479058 2:238239318-238239340 CCGCGTCCCCGCGGGCCGGGTGG - Intronic
948587016 2:239026032-239026054 CCACGTCCCAGCTGTGGGGGAGG - Intergenic
948596470 2:239082642-239082664 CCACGTGCCTGCAAGCGGGCAGG - Intronic
1170578529 20:17681697-17681719 CGACGGCCCTGCCGGGAGGGAGG + Intronic
1170623087 20:18010581-18010603 CCACCTCCCTCCCGGACGGGGGG + Intronic
1171957439 20:31471469-31471491 CCACCTCCCTCCCGGACGGGGGG + Intronic
1175278387 20:57787326-57787348 CAACTTCCCTGCAGGCTGGGTGG + Intergenic
1175521243 20:59604063-59604085 CCTCCTCCCTGCCGGGGGGCGGG - Intronic
1176131383 20:63498223-63498245 CCCTGGCCCTGCCGCCGGGGAGG - Intronic
1176180357 20:63746906-63746928 CACCGACCCTGCCGGCGGGCGGG + Exonic
1177178001 21:17719464-17719486 CCACCTCCCTCCCGGACGGGCGG + Intergenic
1179951572 21:44711548-44711570 CCACTTCCCTGCAGGCTGAGCGG - Exonic
1180000810 21:44994738-44994760 CCAGGTCCCGGCCTGCAGGGTGG + Intergenic
1182295301 22:29308630-29308652 CAACGCCCCTGCCGCTGGGGAGG + Exonic
1182586509 22:31346711-31346733 CCCCGGCCCCGCGGGCGGGGTGG - Intergenic
1183667386 22:39253674-39253696 CCACTGCCCTGCCGGGGCGGCGG - Intergenic
950427656 3:12933125-12933147 CCACTTCTCTCCCTGCGGGGTGG - Intronic
950754674 3:15162768-15162790 CCACCTCCCTGCCCGGGCGGGGG + Intergenic
959419083 3:106111220-106111242 CCACCTCCCTCCCGGACGGGCGG + Intergenic
959419108 3:106111268-106111290 CCACCTCCCTCCCGGACGGGCGG + Intergenic
961784187 3:129339246-129339268 CCACCTCCCTCCCGGACGGGCGG + Intergenic
961784338 3:129339597-129339619 CCACCTCCCTCCCGGACGGGCGG + Intergenic
961784483 3:129339947-129339969 CCACCTCCCTCCCGGACGGGTGG + Intergenic
962063286 3:131952597-131952619 CCACCTCCCTCCGGACGGGGCGG - Intronic
962827949 3:139113841-139113863 CCACCTGCCTGCCGTCAGGGAGG + Intronic
964716782 3:159731366-159731388 CCTCGTCCCTGCCAGCTGGAAGG + Intronic
966015067 3:175131781-175131803 CCACCTCCCTCCCGGACGGGGGG + Intronic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
967938243 3:194746500-194746522 CCACGTCCCTGCAAGCGGCATGG - Intergenic
968457168 4:705740-705762 CCACGCCCCTTGCCGCGGGGTGG + Intronic
973672705 4:53237480-53237502 CCACCTCCCTCCCGGACGGGCGG + Intronic
975170349 4:71225552-71225574 CCTCATCCCTGCCAGCTGGGTGG + Intronic
981524288 4:145694576-145694598 CCACCTCCCTCCCGGACGGGCGG - Intronic
982157300 4:152535484-152535506 CCACCCCCCGGCCGGGGGGGCGG - Exonic
984004752 4:174294733-174294755 CCACCTCCCTGCTGGGCGGGGGG + Intronic
985410319 4:189676640-189676662 CCACGTCCCTGCTGCCTGAGGGG + Intergenic
986706959 5:10460426-10460448 CCAAGTCCCTGCGGGGGTGGGGG - Intronic
987728898 5:21742083-21742105 CCACGTCACTGACGGGGGAGGGG + Intergenic
988552337 5:32208856-32208878 CCACCTCCCTCCCGGACGGGCGG - Intergenic
989075928 5:37563567-37563589 CCACCTCCCTCCCGGACGGGCGG + Intronic
989211564 5:38862428-38862450 CCACCTCCCTCCCGGACGGGTGG + Intronic
992978392 5:82140527-82140549 CCACCTCCCTCCCGGACGGGCGG - Intronic
992978416 5:82140575-82140597 CCACCTCCCTCCCGGAGGGGCGG - Intronic
998406764 5:141878530-141878552 CCACCTCCCGGCCGGAGGGGGGG - Intronic
999318706 5:150600404-150600426 CCACTTCCCTGCCTGGGGGATGG - Intergenic
1002658297 5:180771313-180771335 CCACCTCCCTCCCGGACGGGGGG + Intergenic
1007656763 6:43455389-43455411 CCACCTCCCCGCCGGAGGTGAGG - Intronic
1008106324 6:47444034-47444056 CCACCTCCCTCCCGGACGGGCGG + Intergenic
1008437096 6:51489005-51489027 CCACGTCCCTGTCGGGGCAGGGG - Intergenic
1013575693 6:111482518-111482540 CCACCTCCCTGCCCGGGGGTGGG + Intronic
1017008174 6:150043311-150043333 TCACCTACCTGCCGGCGGGGCGG + Intergenic
1018743061 6:166744759-166744781 CCACGTCCCTGGCGGCGGTGGGG + Intronic
1019381490 7:726592-726614 CCACGTGCGCACCGGCGGGGAGG + Intronic
1022005527 7:26262376-26262398 CCACCTCCCTCCGGACGGGGCGG - Intergenic
1022083548 7:27045503-27045525 CCACCTCCCTCCCGGACGGGCGG - Intergenic
1022923367 7:35037524-35037546 CCGCCTCCCGGCCCGCGGGGAGG - Intronic
1024339514 7:48243006-48243028 CCACGTCCCTGCAGTACGGGTGG + Intronic
1024472158 7:49775407-49775429 CCACGTCCCGGCGGGCGGGCGGG - Exonic
1025821596 7:64968201-64968223 CCACCTCCCTCCCGGACGGGCGG + Intergenic
1029569150 7:101359110-101359132 CCACCTCCCTCCAGACGGGGCGG + Intergenic
1029569259 7:101359354-101359376 CCACCTCCCTCCGGACGGGGCGG + Intergenic
1029580729 7:101435399-101435421 CCCCCTCCCTGCTGGCTGGGAGG + Intronic
1031051867 7:116953406-116953428 CCGCGTCCCCGGCGGCGGGCGGG + Exonic
1032291269 7:130591452-130591474 CCACCTCCCTCCCGGACGGGCGG - Intronic
1035450926 7:158976364-158976386 CCACATCCCTGCAGGCTCGGGGG + Intergenic
1036633215 8:10529843-10529865 CCACGTCCCCACAGGCTGGGGGG - Intronic
1039407904 8:37328494-37328516 GCACGTTCCTGCCTGCAGGGAGG - Intergenic
1042020580 8:64369420-64369442 CCACTTCCCAGCCGGCCGCGAGG - Intergenic
1044660959 8:94591579-94591601 CCACCTCCCTCCCGGACGGGCGG - Intergenic
1057154743 9:92830831-92830853 CCACCTCCCTCCCGGACGGGCGG + Intergenic
1060703851 9:125780701-125780723 CCACCTCCCTCCCGGACGGGGGG + Intronic
1060855808 9:126914594-126914616 CAGCATCCCTGCGGGCGGGGAGG + Intergenic
1061712746 9:132499038-132499060 CACAGTCCCTGCCGGCGGCGGGG - Intronic
1062254654 9:135615218-135615240 CCACGCCCCTGCAGGTGGAGGGG + Intergenic
1062520058 9:136954045-136954067 CCAAGTCACTCCAGGCGGGGTGG - Intronic
1203672439 Un_KI270755v1:28840-28862 CCACGTCCCTGCTGCCTGAGGGG - Intergenic
1186427460 X:9474334-9474356 CAACGTCCCTGCCTGCAGGTAGG + Intronic
1190891472 X:54572644-54572666 CCACCTCCCTCCCGGATGGGCGG + Intergenic
1191618033 X:63189480-63189502 CCACCTCCCTCCCGGACGGGGGG + Intergenic
1192386823 X:70679759-70679781 CCACCTCCCTCCCGGACGGGCGG - Intronic
1201424200 Y:13831320-13831342 CCAGCTCCCTGCTTGCGGGGAGG + Intergenic