ID: 1161729115

View in Genome Browser
Species Human (GRCh38)
Location 19:5948117-5948139
Sequence TGCTTTCTGGCCTTTCCTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 207}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161729115_1161729121 8 Left 1161729115 19:5948117-5948139 CCCCTAGGAAAGGCCAGAAAGCA 0: 1
1: 0
2: 1
3: 24
4: 207
Right 1161729121 19:5948148-5948170 TCAGATAAATTCCCTCTAGATGG 0: 1
1: 0
2: 1
3: 13
4: 130
1161729115_1161729127 21 Left 1161729115 19:5948117-5948139 CCCCTAGGAAAGGCCAGAAAGCA 0: 1
1: 0
2: 1
3: 24
4: 207
Right 1161729127 19:5948161-5948183 CTCTAGATGGCTGGGCGTGGTGG 0: 1
1: 1
2: 29
3: 276
4: 1999
1161729115_1161729123 13 Left 1161729115 19:5948117-5948139 CCCCTAGGAAAGGCCAGAAAGCA 0: 1
1: 0
2: 1
3: 24
4: 207
Right 1161729123 19:5948153-5948175 TAAATTCCCTCTAGATGGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 125
1161729115_1161729124 18 Left 1161729115 19:5948117-5948139 CCCCTAGGAAAGGCCAGAAAGCA 0: 1
1: 0
2: 1
3: 24
4: 207
Right 1161729124 19:5948158-5948180 TCCCTCTAGATGGCTGGGCGTGG 0: 1
1: 0
2: 4
3: 21
4: 207
1161729115_1161729122 12 Left 1161729115 19:5948117-5948139 CCCCTAGGAAAGGCCAGAAAGCA 0: 1
1: 0
2: 1
3: 24
4: 207
Right 1161729122 19:5948152-5948174 ATAAATTCCCTCTAGATGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161729115 Original CRISPR TGCTTTCTGGCCTTTCCTAG GGG (reversed) Intronic
905042635 1:34972959-34972981 TCCTTTCTTTTCTTTCCTAGAGG + Intergenic
906128991 1:43444758-43444780 TGTTCTCTGCCCTTTCCCAGTGG + Intronic
910402694 1:86853217-86853239 TGCTTGCTGGCCCTCCCTAGAGG - Intergenic
910420314 1:87054419-87054441 TACTTTCTGGCATTTCCTCTTGG - Intronic
912177714 1:107180984-107181006 TGGTTTCTGGCTTTCCTTAGGGG - Intronic
912691250 1:111806006-111806028 TCCTGTCTGGCCTTCCCCAGGGG + Intronic
913140455 1:115936105-115936127 TGGTTTCTGGGCTTCGCTAGTGG + Intergenic
914701421 1:150137455-150137477 TGCCTTCTGTCCTGTCATAGGGG + Intronic
915109493 1:153553996-153554018 TTCATTCTGTCCTTTCCTGGAGG + Intergenic
923000854 1:230005241-230005263 TGCTGCCAGGACTTTCCTAGGGG - Intergenic
923147082 1:231205788-231205810 TGTTTTCTGGTCTTTCCAAAGGG - Intronic
923286146 1:232497703-232497725 TGCTTTCTGGTCTTTCATTCTGG + Intronic
923652979 1:235891221-235891243 TGCTTTCTGGCCATTATTGGAGG - Intergenic
1066254939 10:33669640-33669662 TGCTCTCTGGCCCTTCCTGTGGG - Intergenic
1067107748 10:43377023-43377045 TGTTCTCTGGCCTTTGCTGGAGG - Intergenic
1067455129 10:46413688-46413710 TGCTTGCTGGCCACTCCTGGTGG + Intergenic
1067512247 10:46905793-46905815 GGCTTTCTTCCCTTTCCTGGTGG - Intergenic
1067632073 10:47970946-47970968 TGCTTGCTGGCCACTCCTGGTGG - Intergenic
1067649997 10:48146029-48146051 GGCTTTCTTCCCTTTCCTGGTGG + Intergenic
1068905075 10:62313307-62313329 GGCTGTCTGGCCTTTCTTAATGG - Intergenic
1068910993 10:62378156-62378178 TGGTTTCTGGTGTTTCCTGGTGG + Intronic
1070719182 10:78744688-78744710 TGCTTTCTTCCCTTTCCCATGGG - Intergenic
1071252831 10:83838405-83838427 TGCCTTCTGGCCCTTCCCAGTGG + Intergenic
1071537986 10:86452263-86452285 TTCTTTTTGGCCTTTCATACTGG - Intronic
1071564952 10:86666956-86666978 AGCCTTATGCCCTTTCCTAGGGG - Intergenic
1073532302 10:104243817-104243839 GGCTTTCTGCCCTTTTCTGGGGG + Intronic
1074002599 10:109387741-109387763 GGCTTTCTGCCCTTTTCCAGTGG - Intergenic
1079028427 11:16967289-16967311 TGGTTTCTGCGCTATCCTAGAGG - Intronic
1080393632 11:31870949-31870971 TGCTTAGTTGCCTTTCCCAGAGG + Intronic
1080581860 11:33650885-33650907 TGATTCCTGGCCTTTCCTAGAGG + Intronic
1080967872 11:37234624-37234646 TGCATTCTTCCCTTTACTAGTGG + Intergenic
1081289499 11:41307360-41307382 TGCTTTCTTGTCTTCCATAGTGG + Intronic
1083636041 11:64121472-64121494 TCCTTTCTGGGCTTTCCCAGAGG + Intronic
1084553850 11:69864457-69864479 GGCTCTCTGCCCATTCCTAGAGG - Intergenic
1084714660 11:70865999-70866021 TGCTTTCTGCAGTTTCTTAGTGG + Intronic
1088740858 11:112765748-112765770 TGCTTTCTAGACCTGCCTAGCGG - Intergenic
1090071853 11:123550812-123550834 TGGTCACTGGCCTGTCCTAGGGG + Intronic
1095717840 12:45367377-45367399 TTCTTCCTGGCCTATCCTTGTGG + Intronic
1096559829 12:52428184-52428206 AGCTTCCTGGGCATTCCTAGGGG - Intronic
1097337830 12:58404407-58404429 TGCTTTCTGCCCTTATCTAAGGG - Intergenic
1098708660 12:73725228-73725250 TAATTTCTAGCCTTTCCTATTGG - Intergenic
1098770096 12:74540799-74540821 TTCTTTCTGGCCTTTTCTCCTGG + Exonic
1101583697 12:106066551-106066573 TGCTTTATGGCACCTCCTAGAGG - Exonic
1101671227 12:106875487-106875509 TGCTCTCTCCCCTTTTCTAGAGG - Intronic
1103019614 12:117523514-117523536 TGCTCTCTGGCCTCTCCCAGAGG - Intronic
1105284338 13:18992486-18992508 TGCCTTCTGGCCTTGCCTTTTGG - Intergenic
1106178823 13:27353682-27353704 TGCTGTCTGGTCTCTCCTAAAGG + Intergenic
1106432573 13:29694952-29694974 TGCTCTCTGTCCTTCCTTAGTGG + Intergenic
1106534055 13:30623350-30623372 AGCTTTCTGGCTTTTACTATGGG + Intronic
1106597232 13:31155843-31155865 TACTTTCTGGCATTTTCTATAGG - Intronic
1106601972 13:31196028-31196050 AGATTTCTGGGCTTTCCTGGGGG + Intergenic
1107799829 13:44095286-44095308 GGCTTTCTTCCCTTTTCTAGTGG + Intergenic
1108436068 13:50402826-50402848 TTCTTTCTGGACCTTCCTATTGG - Intronic
1111932118 13:94523358-94523380 TGCCTTCTTGCCTTTCCCTGGGG + Intergenic
1111998945 13:95192377-95192399 TGTTTTCTGGCCTTGTCTTGGGG - Intronic
1112065349 13:95786999-95787021 TGCTTTTTGGCATTTCTGAGGGG - Exonic
1112723972 13:102280828-102280850 TGATTTCTGGTGTTTCCCAGGGG - Intronic
1114498560 14:23151451-23151473 TACTTTGTGAGCTTTCCTAGAGG - Intronic
1114781219 14:25540110-25540132 TTCTTTATGGCCTTTCCTGCTGG + Intergenic
1117150429 14:52881828-52881850 TCCTTTCTTTCCTTTCCTATAGG - Intronic
1117273157 14:54165764-54165786 TGTTCTCTCTCCTTTCCTAGAGG + Intergenic
1117749862 14:58910275-58910297 TTCTTTCTGAACTTTCCTGGAGG + Intergenic
1117809575 14:59532574-59532596 TGGTTTCTGGCCTTCCCTTGTGG + Intronic
1117976483 14:61302275-61302297 AGCATTCTTGCCTTTCCCAGAGG + Intronic
1119000363 14:70876258-70876280 TGGTTTCTGGAACTTCCTAGGGG - Intergenic
1120144270 14:80962429-80962451 TCCTTTCTGGCTCTTCCTAGGGG + Intronic
1120448879 14:84640292-84640314 TTATATCTGGCCTTTCATAGTGG - Intergenic
1121160341 14:91732996-91733018 AGCTTTATTGCCTTCCCTAGTGG - Intronic
1122476034 14:102009687-102009709 TGCTCTTTGGCCTTTCTTCGGGG - Intronic
1125730678 15:41891177-41891199 TGTTTTCTGGTGTATCCTAGGGG + Intronic
1127773817 15:62250724-62250746 GGCTTTCTTGCTTTTCCTATAGG + Intergenic
1127774755 15:62256100-62256122 GGCTTTCTTGCTTTTCCTATAGG + Intergenic
1127775351 15:62260326-62260348 GGCTTTCTTGCTTTTCCTATAGG + Intergenic
1128613918 15:69094681-69094703 TTCTTTCTTTCCATTCCTAGTGG + Intergenic
1128673927 15:69595151-69595173 TGCCCTCTGTCCTTTCCCAGGGG - Intergenic
1128889294 15:71316614-71316636 TGCTTTCAGGCCTGGCTTAGTGG + Intronic
1129772952 15:78214224-78214246 TGCTTCCTGGAGTTTCCTGGGGG + Intronic
1130355685 15:83128400-83128422 TGGTTCCTGTCCTTTCCTTGAGG + Exonic
1131089631 15:89613510-89613532 TCCTTTCTGTCCTTTCCTTCTGG + Intronic
1133452292 16:5913772-5913794 TGCATTCTGGCCTTTGTTAAAGG + Intergenic
1133621627 16:7532095-7532117 TGTTCTCTGGCCTTTTTTAGGGG + Intronic
1133997346 16:10758585-10758607 TGCTTTTTGAACTTTCCTTGAGG + Intronic
1136406268 16:30049477-30049499 TCCTGTCTGCCCTTTCCTAGGGG + Intronic
1138723552 16:59110579-59110601 GGCTTTCTTCCCTTTCCTGGTGG + Intergenic
1141600964 16:85126181-85126203 GGCTTCCTGGCCCTTCCCAGTGG - Intergenic
1142732831 17:1873340-1873362 TACTTTCTGGCCTTTACTTTAGG + Intronic
1142947772 17:3447868-3447890 TACTTGCTGGCTTTTGCTAGAGG - Intronic
1145124901 17:20292172-20292194 TGCTCTCTGCCCTTCCCAAGAGG + Intronic
1148825332 17:50389064-50389086 TGCTTTCTGGCCATTAGCAGTGG - Intronic
1151298138 17:73200804-73200826 TGTTTTATGGCCAATCCTAGTGG + Intronic
1152903796 17:82959772-82959794 TGTCTCCTGGGCTTTCCTAGGGG + Intronic
1153595696 18:6723001-6723023 TGTTTTCTTGCCTTTCCTGATGG + Intergenic
1156478872 18:37423714-37423736 GGCTTCCTCCCCTTTCCTAGAGG - Intronic
1157949855 18:52023991-52024013 TGCTTTCAGGCCTTTTCAGGGGG - Intergenic
1158407788 18:57175768-57175790 TGCCTTCTGGCCTGTCCCTGGGG + Intergenic
1160412330 18:78683469-78683491 TGCTGCCTGGCCTTTCCTCCAGG - Intergenic
1161729115 19:5948117-5948139 TGCTTTCTGGCCTTTCCTAGGGG - Intronic
1165164487 19:33841971-33841993 TCCTTCTTGGTCTTTCCTAGAGG - Intergenic
925117916 2:1396140-1396162 TGGTGTCTGCCCTTTCCAAGGGG - Intronic
925888090 2:8410893-8410915 AGCTTTCTTCCCTTTCCTGGAGG + Intergenic
927397423 2:22669928-22669950 TGCAGTCTGGCCTTTCCTGGTGG + Intergenic
928650594 2:33400034-33400056 GGCTTTCTTCCCTTTCCTGGTGG + Intergenic
928701312 2:33902050-33902072 TGATTTCTAGCATTTCCTTGTGG + Intergenic
930614467 2:53579080-53579102 TGCAATCTGGCCTTTGCTACTGG - Intronic
932714681 2:74092758-74092780 GTCTTTCTGGCCTTTCCTTCAGG - Intronic
933914887 2:86980207-86980229 TGCTTTTTTCCCTTTCCTGGTGG + Intronic
934008107 2:87789693-87789715 TGCTTTTTTCCCTTTCCTGGTGG - Intronic
935616836 2:105094729-105094751 TTCTCTCTGGCTTTTCCTAAGGG - Intronic
939446845 2:142321353-142321375 GGCATTCTTCCCTTTCCTAGTGG - Intergenic
940901173 2:159127973-159127995 GGCTGTCTGCCCTTTCCCAGTGG + Intronic
945010033 2:205451130-205451152 TCCTCTCTTGCCTTTCCCAGTGG + Intronic
945432156 2:209777102-209777124 TGCTTTTTGGACTTCCCTACTGG - Intronic
1169227342 20:3864901-3864923 TGCTCTGTGGCCTCTCCTTGAGG + Intronic
1170764955 20:19281967-19281989 GGCTTTCTGTCCTTGCCTGGTGG + Intronic
1172288991 20:33761769-33761791 TTCTTTCTGGGCCTTCCTTGTGG + Intronic
1173182292 20:40814472-40814494 TGGGTCCTGGCCTTTCCTAAGGG - Intergenic
1173312083 20:41905516-41905538 TGCTTTCTGGCCTTCTCCAAAGG - Intergenic
1174516367 20:51095453-51095475 TGCTTTCTGGCCTGGTCTGGAGG - Intergenic
1174574458 20:51526680-51526702 CCCTTTCTGGGCTATCCTAGAGG + Intronic
1179002769 21:37479036-37479058 TGCTTTCTTTCCTCTTCTAGTGG + Intronic
1179716772 21:43292437-43292459 TGCTATCAGCACTTTCCTAGAGG - Intergenic
1181932223 22:26411401-26411423 TGGTGTCTGGGCTTTCCAAGAGG - Intergenic
1182240235 22:28910392-28910414 TTAGTTCTGTCCTTTCCTAGAGG + Intronic
1182506076 22:30783607-30783629 TGCTCTCTGGCCTGGCGTAGTGG - Intronic
1184445645 22:44545340-44545362 CTCTTGCTGGCCTTTCCTTGGGG - Intergenic
950192198 3:10985107-10985129 TGCTTTCTTGCCTCTCCATGGGG - Intergenic
950674534 3:14546571-14546593 TGCTTTCTGACCTCTCCCACTGG - Intergenic
950695818 3:14700486-14700508 TGCTTTCAGGCATTTACAAGGGG + Intronic
950978341 3:17274803-17274825 TTCTTTCTGGACTTTTCTTGAGG - Intronic
951136917 3:19114590-19114612 TGGTTTATGGCCTTTATTAGAGG + Intergenic
951263445 3:20539651-20539673 TGCTTTCTCCCCTTTTCTAGTGG + Intergenic
952147729 3:30551346-30551368 TGCTTTCTTCCCTTTTCCAGTGG + Intergenic
954404858 3:50339996-50340018 TGCTTGCTGGCGATTCCCAGGGG + Intronic
955500162 3:59575244-59575266 TGCCTTCTGGCCTCTGCTGGAGG - Intergenic
957966955 3:87334271-87334293 TGCTTTCTGTCCTTCCACAGTGG - Intergenic
958271476 3:91505066-91505088 TGCTTTCCAGGATTTCCTAGAGG - Intergenic
960838447 3:121931794-121931816 TGTTTTCTGCCCCTGCCTAGAGG - Intronic
961388114 3:126535954-126535976 GGTGATCTGGCCTTTCCTAGAGG + Intronic
961943320 3:130659122-130659144 TGCTTTCAGGCATTTCTTTGTGG - Intronic
962364083 3:134765863-134765885 TCTTTTCTGGCCCTACCTAGAGG - Intronic
963833739 3:150035469-150035491 TGCTTTGTGGCCGTCCCCAGGGG + Intronic
964137152 3:153357022-153357044 AGTTTTCTGGCCTTTCCATGTGG + Intergenic
965057151 3:163735062-163735084 TGATTTCTGGCATTTGCTAGAGG - Intergenic
965337937 3:167450759-167450781 TGCTTTTTGGTCTTTCCTCTTGG - Intronic
965379227 3:167967335-167967357 TGCTTTCTGGGGTTTCCTTCTGG + Intergenic
967148019 3:186622410-186622432 ACCTTTCTGGCCTTTCCTTTTGG - Intergenic
967173138 3:186839609-186839631 TCCTTTCTTGCCATTTCTAGGGG + Intergenic
968318749 3:197747197-197747219 TGCTTTCTTGCCTTTCCCTCTGG + Intronic
970331561 4:14990990-14991012 TGGTCTCTGGTCTTTCTTAGAGG + Intergenic
970486505 4:16530008-16530030 TGTTTTCTTGCCTTTCTTACTGG - Intronic
970656459 4:18235766-18235788 TGCTTCCTTGCCTTTCCCAGGGG - Intergenic
972865064 4:43221860-43221882 AGCTTTCTTCCCTTTTCTAGTGG + Intergenic
973028688 4:45308132-45308154 TGCTTTCATGCCTTTGCTAAAGG + Intergenic
973768288 4:54183635-54183657 TGATTTTTGGCTTTTCCTAGAGG - Intronic
974582246 4:63817774-63817796 TGGATTCTGGCCTTTCCAATAGG + Intergenic
978324665 4:107538788-107538810 TATTTTCTAGTCTTTCCTAGAGG - Intergenic
982945098 4:161612013-161612035 TGCTCTCTGGCTTTTGCCAGTGG - Intronic
984222684 4:176996869-176996891 TGCTTTCTAGAGTTTTCTAGAGG - Intergenic
985424339 4:189813507-189813529 TGTTTTCTGGCTTTTGCTATGGG - Intergenic
985697482 5:1348992-1349014 TGCCTGCTGCCCTTTCCTAGTGG + Intergenic
987754375 5:22081990-22082012 TGGTTTCAGGCATTTCCTGGGGG - Intronic
990327165 5:54689947-54689969 TTCTTTCTAGCCTTTCATATGGG - Intergenic
993772135 5:91941917-91941939 TGATTACTGGCCTTACCCAGAGG - Intergenic
993943136 5:94086008-94086030 TGCCTTCTGTTCTTTCCCAGTGG - Intronic
994147466 5:96410986-96411008 TGCATTCTGGCTTTTCCTTTAGG - Exonic
995377628 5:111494021-111494043 TGTTTTCTAGTCTTTCCTAAAGG + Exonic
997003089 5:129785108-129785130 TCCTTTCAGGCCTTTGGTAGTGG + Intergenic
997250535 5:132385543-132385565 TTCTGTCTGGCCTTCACTAGAGG + Intronic
997917277 5:137940333-137940355 CTCTTTCTGGGCATTCCTAGGGG + Exonic
999310089 5:150546368-150546390 TGCTTTTAGGCCTTCCCTGGTGG + Intronic
1003328332 6:5109537-5109559 TTCCTTCTGGCCTTTCCCAGGGG - Intronic
1003801478 6:9673870-9673892 TGCTATCTGACCTGCCCTAGTGG - Intronic
1003878146 6:10456416-10456438 TATTTTCTGCCATTTCCTAGGGG + Intergenic
1005826478 6:29634099-29634121 TGCTTTCTGGCTGGTCCTAGGGG + Intergenic
1008440208 6:51524304-51524326 TGCATTCTGTACTTTCCTATAGG - Intergenic
1008811265 6:55503142-55503164 TGCTTTCTGCCCTTACCCTGTGG + Intronic
1010357903 6:74956615-74956637 TCCTTTCTCCCCTTGCCTAGTGG - Intergenic
1011753320 6:90474948-90474970 TGTGTCCTGGCCTTTCCCAGGGG + Intergenic
1012232964 6:96782222-96782244 GGCTTTCTTCCCTTTTCTAGTGG - Intergenic
1012720463 6:102736277-102736299 TGCCTTCTGGTCTACCCTAGTGG - Intergenic
1017160725 6:151363158-151363180 TGCTTTCAGACCTTTCCTTGTGG + Intergenic
1017390436 6:153933106-153933128 TGCTATCTGGTCTTACCCAGTGG + Intergenic
1020227370 7:6290795-6290817 TTCTTTCTGGCCTTGCCAAGAGG - Intergenic
1020635830 7:10694873-10694895 TTCTTTCTTGACTTTCCTGGAGG - Intergenic
1021093526 7:16510031-16510053 AGTTTTGTGGCCTTGCCTAGGGG + Intronic
1021646503 7:22794735-22794757 TCCTTTCTCCCCTTTCCTGGTGG - Intergenic
1028896830 7:96050723-96050745 TGCTTTCTTGCCTGTTCCAGGGG + Intronic
1032015637 7:128378883-128378905 GGCTTTCTGTCCTTCTCTAGGGG + Intergenic
1032106632 7:129036850-129036872 TGCTGTTTGGCCTTTTCTAATGG - Intronic
1032656871 7:133939910-133939932 TTCTTTCTGACTTTTTCTAGAGG - Intronic
1034179257 7:149125425-149125447 AGTTTTCTGTCCTTTCCTAGAGG + Intronic
1036225351 8:6953287-6953309 TGCACGCTGGCCTTTCCTGGTGG - Intergenic
1036416790 8:8557050-8557072 TGCTCTCTAGCCTTTCCTGAAGG + Intergenic
1036640406 8:10579934-10579956 TGGTTTCTGGACTTTGCTTGCGG + Intergenic
1038291346 8:26252487-26252509 TGCTTTCTTCCTTTCCCTAGAGG + Intergenic
1039759548 8:40559551-40559573 TGCTTTTTGGCCTCTGCTAGAGG + Intronic
1040083863 8:43318555-43318577 TGCTTTCTGCTCTTTCTTTGTGG - Intergenic
1040389652 8:46938987-46939009 CACTTTCTGGCTTATCCTAGTGG + Intergenic
1043800813 8:84607595-84607617 TGCTTTCTGCAGTTTCCTAATGG - Intronic
1044117887 8:88356601-88356623 GGCTTTCTGGCTTTTGCTAGGGG + Intergenic
1045295322 8:100867537-100867559 TGCTTTCTGGCCTATTACAGAGG - Intergenic
1046359472 8:113131624-113131646 TCCCTTCTGCACTTTCCTAGCGG - Intronic
1046556688 8:115782073-115782095 ATTTTTCTGGCCTTTCCTACCGG + Intronic
1047792544 8:128219094-128219116 TGCTCTATGGCCATTCCTAAGGG - Intergenic
1048503312 8:134998043-134998065 CCCTTTCTGGGCTTTCCAAGGGG - Intergenic
1048522898 8:135173271-135173293 TACTATCTGGCCTTTCATAGAGG - Intergenic
1051209095 9:14722614-14722636 TGCCGTGTGGTCTTTCCTAGAGG + Exonic
1052819129 9:33125090-33125112 TGTTTTCTGGCCTTTCTTTTGGG - Intronic
1052855334 9:33403152-33403174 GCCTTGCTGGCCTTTCCTAAGGG - Intergenic
1053683345 9:40499495-40499517 GCCTTGCTGGCCTTTCCTAAGGG - Intergenic
1053933325 9:43127810-43127832 GCCTTGCTGGCCTTTCCTAAGGG - Intergenic
1054280369 9:63125433-63125455 GCCTTGCTGGCCTTTCCTAAGGG + Intergenic
1054296449 9:63334993-63335015 GCCTTGCTGGCCTTTCCTAAGGG - Intergenic
1054394466 9:64639498-64639520 GCCTTGCTGGCCTTTCCTAAGGG - Intergenic
1054429115 9:65144697-65144719 GCCTTGCTGGCCTTTCCTAAGGG - Intergenic
1054501268 9:65876838-65876860 GCCTTGCTGGCCTTTCCTAAGGG + Intergenic
1056806837 9:89735645-89735667 TGCATTCAGGCTTTTCCTAGTGG - Intergenic
1058445410 9:105050597-105050619 AGGTTTCTGGCCTTTCCTTTGGG + Intergenic
1059801808 9:117757514-117757536 TGTTTTCTGACCTTTGCTATGGG + Intergenic
1060394206 9:123304193-123304215 TGCTTTCTCCCATTTCCTAGAGG - Intergenic
1186645670 X:11504757-11504779 TGGTTTCATGCCTTTCCTGGAGG + Intronic
1189082791 X:37992356-37992378 TGCCTGCTGGCCTTTCACAGAGG + Intronic
1189301982 X:39958672-39958694 TGCTCACTGGCCTATCCAAGAGG + Intergenic
1194396084 X:93388349-93388371 TATTTTCTTTCCTTTCCTAGAGG + Intergenic
1194553088 X:95325140-95325162 GGCTTTCTTCCCTTTCCTGGTGG + Intergenic
1195482623 X:105364251-105364273 TGCTTTCTGTCCTTTTCCATTGG + Intronic
1195675381 X:107503681-107503703 AGCTTTCTGGTCTTTCATGGGGG + Intergenic
1196030002 X:111086491-111086513 TTCTTTCTGGCCTTACATGGTGG + Intronic
1196662617 X:118283330-118283352 TGCAGCCTGGCCTTTCCTAGAGG + Intergenic
1197046923 X:122008768-122008790 TGCTTTCTGTGCTTTCTTTGTGG - Intergenic
1198025274 X:132699412-132699434 GGCTTTCTGGACTCTCCTGGTGG + Intronic
1198073505 X:133172453-133172475 TCCTTTCTGCCCTTTCCCTGGGG + Intergenic
1201626876 Y:16024447-16024469 TGCTTTCTGACACTTCCCAGTGG + Intergenic