ID: 1161729264

View in Genome Browser
Species Human (GRCh38)
Location 19:5949014-5949036
Sequence GTTCTGACGAGACTAAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 81}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161729259_1161729264 4 Left 1161729259 19:5948987-5949009 CCTGGTACTGACTCTTCCATGGC 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1161729264 19:5949014-5949036 GTTCTGACGAGACTAAAAGATGG 0: 1
1: 0
2: 0
3: 8
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161729264 Original CRISPR GTTCTGACGAGACTAAAAGA TGG Intronic
908674141 1:66583196-66583218 GTTTTGATGAGACTGAAAGATGG + Intronic
910535306 1:88290833-88290855 GTTCAGATGAGATTCAAAGATGG + Intergenic
917125281 1:171682122-171682144 ATTCTGACAATTCTAAAAGATGG - Intergenic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
922424277 1:225479178-225479200 GTTCTTACAACACTGAAAGAAGG - Intergenic
924906980 1:248465475-248465497 GGTCTGAGGACACTAAGAGAGGG - Intergenic
924917132 1:248582669-248582691 GGTCTGAGGACACTAAGAGAGGG + Intergenic
1065632923 10:27699320-27699342 CTTCATACTAGACTAAAAGAAGG + Intronic
1068050840 10:51947295-51947317 TTTCTGACGAGCTTAAAAAACGG - Intronic
1069954068 10:72039164-72039186 GCTCTGAGGAGACAAAAACAAGG - Intergenic
1070498906 10:77051930-77051952 GTTCTAACCATACTAAGAGATGG + Intronic
1071703798 10:87974617-87974639 GTTCTGCTGAGTCTAACAGAAGG - Intergenic
1073505855 10:103988862-103988884 CTGATGAGGAGACTAAAAGAGGG + Intronic
1080290611 11:30666945-30666967 GTTATGAAGAGACTAAAACAGGG + Intergenic
1081211679 11:40342898-40342920 GAGATGACTAGACTAAAAGATGG - Intronic
1081676140 11:44970857-44970879 GGTCTGAGGAGACTAAAGCATGG - Intergenic
1081773405 11:45663300-45663322 GTGCTGACGACACTGATAGAGGG - Intronic
1082711109 11:56554732-56554754 TTTCTGACGGGATTAAAAAACGG - Intergenic
1087301407 11:96440241-96440263 GTTCTGCTGAGACTAAATGAGGG + Intronic
1095586377 12:43854282-43854304 GTTCAGACTAGTCTAAAATAAGG + Intronic
1114945265 14:27673357-27673379 TTTCTGACGGGCTTAAAAGACGG + Intergenic
1117464780 14:55982322-55982344 TTTTTGAGGAGACTAAAATATGG - Intergenic
1117491433 14:56251631-56251653 GGTATGACGAGACTGAAACAGGG - Intronic
1121097996 14:91231271-91231293 GTTCTGAAGAGAGGAAAAAAGGG + Intergenic
1130330771 15:82920648-82920670 GTTCTGAAGAGAGTAGCAGAGGG - Intronic
1134693405 16:16205721-16205743 GTTCTAACGAGACAAAGAGAGGG - Intronic
1134978447 16:18588979-18589001 GTTCTAACGAGACAAAGAGAGGG + Intergenic
1139256934 16:65551417-65551439 TTTCTGACGAGCTTAAAAAACGG + Intergenic
1146728435 17:35174222-35174244 GTCCTGAGGAGATGAAAAGATGG - Exonic
1147230549 17:39014902-39014924 GTTCTAACAAGACTGTAAGAAGG - Intergenic
1154248871 18:12726070-12726092 GGTCTGACGAGACTAAAATCAGG + Intergenic
1161729264 19:5949014-5949036 GTTCTGACGAGACTAAAAGATGG + Intronic
1164440056 19:28270005-28270027 TTTCCGACGAGCTTAAAAGAGGG + Intergenic
1164753914 19:30675754-30675776 CTTCAGAGGAGACAAAAAGATGG + Intronic
926473135 2:13286355-13286377 GTTTTGAAGAGAGAAAAAGAAGG - Intergenic
927819609 2:26251791-26251813 GGTCTTTAGAGACTAAAAGAAGG - Intronic
927993788 2:27467734-27467756 GTTCTGAAGAGACTAGAGAATGG + Intronic
932667101 2:73706893-73706915 GTTCTGCCGAGCCTAACACAGGG - Intergenic
942073647 2:172337338-172337360 GGTCTGCCGAGAGAAAAAGAGGG + Intergenic
942395267 2:175540545-175540567 GTACTGTGGAGATTAAAAGAAGG - Intergenic
943191652 2:184685569-184685591 GCTCTCAGGAGACTAAAAGTGGG + Intronic
947006428 2:225516537-225516559 GTTCTGAAGAGAAAAAAAAAAGG - Intronic
1170802788 20:19604198-19604220 GGTCTGAAGAGAGTAAAATAGGG + Intronic
1172185982 20:33031363-33031385 GTTCTGACCAGCCTGCAAGATGG - Intergenic
1175532436 20:59683162-59683184 GTTCTGTCGTGAGTAACAGAAGG + Intronic
1179292831 21:40033459-40033481 TTTCTGACGAGCTTAAAACACGG + Intronic
1180038865 21:45265520-45265542 GTTCTGCGGAGACCAAGAGAAGG - Exonic
1184442766 22:44528397-44528419 GTTCTGAAGACAATAAAAGATGG + Intergenic
952302345 3:32114293-32114315 GTTCTAACAAGAGTAAGAGAAGG + Intronic
953387977 3:42517470-42517492 CTTCTGAACAGACTAAATGATGG + Intronic
954057217 3:48037139-48037161 GTTCTGAGGAAAGTAAAAAAGGG + Intronic
955544427 3:60012928-60012950 TTTCTGGAGAGACTAAATGAAGG - Intronic
959554157 3:107697904-107697926 TTTCTGACGAGCTTAAAAAATGG - Intronic
964429035 3:156584661-156584683 GTTATGAAGAAATTAAAAGAGGG + Intergenic
966558125 3:181286575-181286597 GTTCTGAAGAGAGTTAAAGGGGG + Intergenic
969433959 4:7173331-7173353 GTGCTGACGAGGGTAAAGGAAGG + Intergenic
972048507 4:34698932-34698954 GTTATGGCAAGACAAAAAGATGG - Intergenic
972301705 4:37791088-37791110 GATCTGATGATACTAAAAAAGGG + Intergenic
973208048 4:47582604-47582626 GTACTGAAGAAACTGAAAGAGGG - Intronic
978218292 4:106235413-106235435 GAACTGTCTAGACTAAAAGATGG - Intronic
979694610 4:123598693-123598715 GATGTGAGGAGACTGAAAGAAGG + Intergenic
979694659 4:123599264-123599286 GATGTGAGGAGACTGAAAGAAGG + Intergenic
982181505 4:152752090-152752112 GTTCTCAGGAGACTCAAAGTGGG - Intronic
984544477 4:181084763-181084785 ATTCTGACAAGAATTAAAGATGG - Intergenic
990820782 5:59838145-59838167 GTTCTGATGATACTGGAAGAAGG + Intronic
1001469445 5:171999961-171999983 GTTTTAATGAAACTAAAAGATGG - Intronic
1012844126 6:104368225-104368247 GTTCTTACCACAATAAAAGATGG - Intergenic
1014778033 6:125533208-125533230 GTTATGGAGAGAGTAAAAGATGG - Intergenic
1015207497 6:130656596-130656618 GTTCTGACCAGGCTAAAATCAGG + Intergenic
1027504503 7:78998730-78998752 GTTCTTATGGGACTTAAAGACGG - Intronic
1028845760 7:95478216-95478238 GTTCTGAAGAGACAAAATTATGG + Intergenic
1034724071 7:153319100-153319122 GTCCTGAAGAGATTAAAATATGG + Intergenic
1036385779 8:8279555-8279577 GTTGTGGTGAGACTAGAAGAAGG - Intergenic
1037196698 8:16199318-16199340 GTTCAGATGACATTAAAAGAGGG + Intronic
1038140480 8:24839865-24839887 GTTGTGACGGGCTTAAAAGACGG + Intergenic
1045422735 8:102032507-102032529 GTTTTGGCTAGACTGAAAGATGG + Intronic
1046118360 8:109812684-109812706 GTTCTGCCTAGACCAAAACAGGG + Intergenic
1050457914 9:5851048-5851070 GTTCTGAAGGGTCTAAAAGAGGG - Intergenic
1051456915 9:17268866-17268888 TTTCTGACGGGATTAAAAAACGG - Intronic
1051495382 9:17717025-17717047 GTTCTGACGAAATAAAAAGCAGG - Intronic
1056098460 9:83278003-83278025 GTTCTGAAGAAAATAAAACAGGG + Intronic
1058009622 9:99962066-99962088 GTTCTGAAGAGAAGAAAATATGG - Intronic
1188539915 X:31238331-31238353 ATTCTGAGGAGAATAAAAGCTGG - Intronic
1191853302 X:65602092-65602114 GATCTGAAGAGAATACAAGATGG - Intronic
1193795843 X:85871960-85871982 GTTCTTACTAAACTAACAGAAGG + Intronic
1194599093 X:95898420-95898442 CTTCTGACCAGACTAGAAGTAGG + Intergenic
1194884049 X:99290534-99290556 GCTCTGAAGAGAACAAAAGAAGG - Intergenic
1195724072 X:107895943-107895965 GTTCTGACGAGATAGAAAGGAGG + Intronic
1196129759 X:112142584-112142606 GTTCTGAGGACACTAAACAATGG + Intergenic
1199091515 X:143698580-143698602 GTTCACACGAGGCTAAGAGAAGG - Intergenic