ID: 1161730601

View in Genome Browser
Species Human (GRCh38)
Location 19:5958456-5958478
Sequence ATCTCTAAGTGAGTGCTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161730598_1161730601 -6 Left 1161730598 19:5958439-5958461 CCTAACGCTCAACCTGGATCTCT 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1161730601 19:5958456-5958478 ATCTCTAAGTGAGTGCTGGTTGG 0: 1
1: 0
2: 0
3: 7
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161730601 Original CRISPR ATCTCTAAGTGAGTGCTGGT TGG Intronic
908163530 1:61435381-61435403 ATCTGTGAGTGAGTGGTTGTTGG + Intronic
909313476 1:74185256-74185278 ATCTCTCATTCATTGCTGGTGGG - Intronic
909480562 1:76125343-76125365 ATCCCTCAGTGGCTGCTGGTTGG + Intronic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
913229754 1:116731947-116731969 TTCTCAAAGGCAGTGCTGGTGGG - Intergenic
919794572 1:201313553-201313575 AGCTCCAAGTGAGTGCTGCTGGG + Exonic
922055165 1:222035555-222035577 AACTCTAATTTATTGCTGGTGGG + Intergenic
924647578 1:245893241-245893263 AACTCTGAGTCATTGCTGGTGGG + Intronic
1063265155 10:4440400-4440422 GTCTCTAAGTGGGTGCTGCTTGG - Intergenic
1065116066 10:22483759-22483781 ATCTCTAACTGAGGGCTGTCTGG - Intergenic
1065779798 10:29156720-29156742 ATCTATAAGAGAGTTCAGGTTGG + Intergenic
1067023881 10:42826973-42826995 ATTTCAACATGAGTGCTGGTGGG - Intronic
1067784700 10:49236931-49236953 ATAACCAAGTGAGTGCTGGCTGG + Intergenic
1069321741 10:67180168-67180190 TTTTCTAAGTGAGTTCTGCTTGG - Intronic
1073481832 10:103790862-103790884 ATCTCTAAGGGCTTCCTGGTTGG + Intronic
1076213136 10:128668097-128668119 ATCTCTTAGTGAATGCTGCATGG - Intergenic
1081880979 11:46451698-46451720 ATCTCTGACTGTGTGCTGCTGGG + Intronic
1083327737 11:61881740-61881762 ACCTCTTAGTGGGTGCTGGAGGG - Intronic
1083549543 11:63576241-63576263 AGCTCTGAGTGAGTGGGGGTGGG - Intronic
1086874982 11:92084883-92084905 AACTCTAATTCATTGCTGGTGGG - Intergenic
1091949443 12:4580776-4580798 ATCCCTAAGTGCCTGGTGGTTGG - Intronic
1093109616 12:15133704-15133726 ACCTCTCAGTCATTGCTGGTGGG - Intronic
1094236054 12:28168037-28168059 ATTTCAAAATGAGTTCTGGTGGG - Intronic
1100642880 12:96499496-96499518 GTCTCTCATTGATTGCTGGTGGG + Intronic
1102808338 12:115801843-115801865 ATGACTCAGTGAGAGCTGGTTGG - Intergenic
1105384762 13:19919457-19919479 ATCTCTCATTTATTGCTGGTGGG - Intergenic
1106115759 13:26816245-26816267 ATTTCTATGTCAGTGCTGCTGGG + Intergenic
1108963491 13:56266802-56266824 ATCTCTAATTCTTTGCTGGTGGG + Intergenic
1108982875 13:56541188-56541210 ATCTGTAGCTGAGTGCTGCTGGG - Intergenic
1109122870 13:58480661-58480683 ATCTCTGTGTGTGTGGTGGTGGG + Intergenic
1109891855 13:68624794-68624816 AGCTCTTAGTTAATGCTGGTGGG + Intergenic
1111657340 13:91170405-91170427 TTCTTTAAGTGATTGATGGTTGG - Intergenic
1112787655 13:102968767-102968789 TTCTTTAAGTGAATGCTGGCTGG + Intergenic
1115491947 14:33966253-33966275 ATCTCAAAGTGAGGGCTTCTAGG + Intronic
1122452496 14:101821375-101821397 ATCTCAAAGTGACTGCTGCCTGG + Intronic
1125126887 15:36234731-36234753 ATCTCTCATTCATTGCTGGTGGG + Intergenic
1125932607 15:43611224-43611246 ATCCCTAGGCGAGTCCTGGTCGG - Exonic
1125945705 15:43710686-43710708 ATCCCTAGGCGAGTCCTGGTCGG - Intergenic
1128924137 15:71638423-71638445 ACCTCTAACTCAGTGCTGCTGGG - Intronic
1129052256 15:72791983-72792005 AACTCTAATAGAATGCTGGTAGG - Intergenic
1130663788 15:85852485-85852507 ATCTGACAGTGAGAGCTGGTGGG - Intergenic
1131047204 15:89323770-89323792 TTCTCTAGGTGGGTGCTGGGTGG - Intronic
1132210652 15:100019851-100019873 ATCTCCAAGTGTGAGCTGGAGGG - Intronic
1132266254 15:100473678-100473700 AACTCTAATACAGTGCTGGTAGG + Intronic
1136923582 16:34351072-34351094 ATGTCTGAGGGAGTGCTGGAGGG - Intergenic
1136980991 16:35060734-35060756 ATGTCTGAGGGAGTGCTGGAGGG + Intergenic
1139098917 16:63742251-63742273 ATCTCTTATTCATTGCTGGTGGG + Intergenic
1140159418 16:72471726-72471748 ATCACTTGGTGAGTGCGGGTTGG - Intergenic
1141241546 16:82269713-82269735 AGTTCAAAGTGAGTGGTGGTGGG - Intergenic
1142978254 17:3657669-3657691 GTCTCCAAGTGAGTGCTGAGAGG + Intronic
1147510681 17:41066381-41066403 ATCTTTAAGTGAGTCATGGAAGG - Intergenic
1149744221 17:59079358-59079380 ATCTCTAAGAAAATGCTGGCAGG + Intronic
1150582864 17:66491332-66491354 ATCTCTGAGTGAGTTTTTGTTGG + Intronic
1150970757 17:70024793-70024815 ATCTCTAAATAAGTCCTAGTTGG - Intergenic
1158454138 18:57591762-57591784 ATCTCAAAGTCAGAGCTGTTAGG - Intergenic
1159588982 18:70311017-70311039 ACCTCCAAGTGAGTGGCGGTTGG + Intronic
1161730601 19:5958456-5958478 ATCTCTAAGTGAGTGCTGGTTGG + Intronic
1162458036 19:10797627-10797649 ATCTCTAAGTGACAACTGGTAGG - Intronic
1166350026 19:42192846-42192868 AGCTCTCATTCAGTGCTGGTGGG + Intronic
1166554179 19:43687202-43687224 ATCTCTAAGTGGGAGCTGCTGGG - Intergenic
1167651935 19:50736179-50736201 TTCTCTAAGGGAGAGCTTGTGGG + Intergenic
925916258 2:8608594-8608616 AGTTCTCAGTGAGTGGTGGTTGG - Intergenic
928872174 2:35992755-35992777 ATCCCTAATTCAGTGCTGCTAGG + Intergenic
934857451 2:97738100-97738122 ATCTACAAGTGAGTGCCAGTGGG + Exonic
936019317 2:108982817-108982839 ATTGCTTAGTGAGTGCTGGCGGG + Intronic
936025550 2:109028611-109028633 TCCTCTAAGTGAGGGCTGTTGGG - Intergenic
936755307 2:115702230-115702252 AACCCTCAGAGAGTGCTGGTGGG + Intronic
937959306 2:127442746-127442768 ATCTCTCATTCATTGCTGGTGGG - Intronic
942366925 2:175238132-175238154 AACTCTCAGTCATTGCTGGTGGG - Intergenic
1168988821 20:2076723-2076745 ATCTCTCATTCATTGCTGGTGGG + Intergenic
1169034626 20:2439442-2439464 ATCTCTACGTCAGTGCTGTATGG - Intergenic
1173357722 20:42309943-42309965 ACATATGAGTGAGTGCTGGTGGG + Intronic
1174176827 20:48650569-48650591 AACTCCAAGGGAGTTCTGGTTGG - Intronic
1175128368 20:56769591-56769613 ATCTCTATGGGCGTGGTGGTGGG - Intergenic
1175283679 20:57821954-57821976 ATTTTTAAGTGGGTGCTGGGTGG + Intergenic
1184239880 22:43206493-43206515 AACCTAAAGTGAGTGCTGGTGGG + Intronic
1185124479 22:48999865-48999887 ATTTCAACGTGAGTTCTGGTGGG - Intergenic
949110269 3:252043-252065 GTCTCTAAGTTTGTGGTGGTTGG - Intronic
949258170 3:2075356-2075378 AACTCTAATTCACTGCTGGTAGG + Intergenic
949781036 3:7688671-7688693 ATTTCTAAGTGATTGCTTTTGGG + Intronic
952491145 3:33874205-33874227 AACTCTCATTCAGTGCTGGTGGG - Intergenic
956263106 3:67366724-67366746 AACTCTAACAGAGTGCTGGAGGG - Intronic
957498420 3:81021335-81021357 AACTCTCAATGATTGCTGGTTGG - Intergenic
958264987 3:91427529-91427551 AACTGTCAGTGATTGCTGGTGGG - Intergenic
958490945 3:94772398-94772420 ATCTCTCATTCATTGCTGGTGGG + Intergenic
958951854 3:100425410-100425432 ATCTCATAGTCAGTGCTGTTGGG + Intronic
960044442 3:113183147-113183169 CAGTCTGAGTGAGTGCTGGTGGG - Intergenic
961353535 3:126319398-126319420 AACTCTCAGTCATTGCTGGTGGG - Intergenic
963886768 3:150591681-150591703 AACTCTAATTTATTGCTGGTGGG + Intronic
964255974 3:154774402-154774424 ATCTCTCATTCATTGCTGGTGGG - Intergenic
964733049 3:159887645-159887667 ATCTCTAAGTGGATGCTAGCTGG + Intronic
967305834 3:188058536-188058558 ATCTCTAAATGATTGCTCCTAGG - Intergenic
967547850 3:190752886-190752908 AGCTCTCAGTCATTGCTGGTGGG - Intergenic
969965679 4:10992916-10992938 ATCGCTTAGTGGGTGCTGTTTGG + Intergenic
970719659 4:18971552-18971574 ATGTCTAAGTGTGTGGTAGTAGG + Intergenic
971630627 4:28988541-28988563 AACTCTAAATCATTGCTGGTGGG - Intergenic
972001659 4:34043879-34043901 ATCTCTTAGTAAGTGATGGGGGG + Intergenic
973089538 4:46116224-46116246 ATTTCTATGTGAGTGCTTTTTGG + Intronic
973138582 4:46737062-46737084 AACTCTCATTCAGTGCTGGTGGG - Intronic
974670864 4:65028041-65028063 ATCTCTCACTGATTGCTGGTGGG - Intergenic
977786977 4:101047479-101047501 TTCTCTAAGTGAATGATAGTGGG - Intronic
979515410 4:121603397-121603419 AACTCTCATTGACTGCTGGTGGG - Intergenic
979582251 4:122374520-122374542 ATCTTTAAATGAGTGATGGTGGG - Intergenic
980442163 4:132863338-132863360 AACTCTAATTCATTGCTGGTAGG + Intergenic
981848172 4:149194340-149194362 ATCTCTCAGGGAGTTCTGCTTGG - Intergenic
982047130 4:151459378-151459400 GTCTCAAAGTGAGTACGGGTGGG + Intronic
988615005 5:32766710-32766732 ATTTCATAGTGAGTGCTAGTTGG + Intronic
989006298 5:36816625-36816647 ATCTCTTATTCAATGCTGGTGGG + Intergenic
989723803 5:44562390-44562412 AACTCTAATTCACTGCTGGTAGG - Intergenic
991982430 5:72246639-72246661 ATCTTTAATTTAGTGCTGGTAGG + Intronic
992467676 5:77023220-77023242 ATGTCTAATTGCCTGCTGGTGGG - Intergenic
993467374 5:88265632-88265654 ATTTCTAACTGAGAGCAGGTTGG - Intronic
994312577 5:98292111-98292133 AATTCTAAGTGTGGGCTGGTGGG + Intergenic
999076999 5:148805981-148806003 TTCTCTGAGTGAGTGATGATTGG + Intergenic
1003906761 6:10707692-10707714 ATTTCTGAGTGTGAGCTGGTGGG + Intronic
1005245475 6:23879343-23879365 ATCTCTACGTGAATGCTGTGAGG + Intergenic
1007074069 6:39055749-39055771 ATCTGTAAGTGAGTGCGTTTTGG + Intronic
1008203564 6:48624221-48624243 ATATCTAAATGAATGCTGGATGG - Intergenic
1008990396 6:57595132-57595154 AACTGTTAGTGATTGCTGGTGGG + Intronic
1011554445 6:88560025-88560047 CTTTCTAAGAGAGTTCTGGTGGG - Intergenic
1013306844 6:108855674-108855696 ATCTCTCATTCATTGCTGGTGGG - Intronic
1015788346 6:136941303-136941325 ATCCCTATGTGTGGGCTGGTGGG + Intergenic
1017400498 6:154055490-154055512 AGCCCTGAGTGAGTGTTGGTAGG - Intronic
1023164852 7:37333447-37333469 CTCTGTAGGTGGGTGCTGGTGGG - Intronic
1023610912 7:41969460-41969482 CTTTCTAAGTGAGTGCTGCATGG + Intronic
1023741848 7:43288045-43288067 ATCTAACAATGAGTGCTGGTGGG - Intronic
1024717428 7:52095913-52095935 AGCTCTAAGTTATTCCTGGTGGG + Intergenic
1026294165 7:69036571-69036593 ATGTCTAAATGAGTGCTATTAGG - Intergenic
1031381483 7:121091456-121091478 ATCTGTTAGTGAGTAGTGGTGGG + Intronic
1031428022 7:121631402-121631424 ATCTCTCATTCATTGCTGGTGGG - Intergenic
1033497485 7:141913962-141913984 AACTCTCAGTCATTGCTGGTGGG + Intronic
1046168677 8:110475108-110475130 ATCTCAAAATGATTGCTGCTAGG - Intergenic
1047125888 8:121960158-121960180 CGCCATAAGTGAGTGCTGGTTGG + Intergenic
1050300712 9:4255242-4255264 AACTCTCATTCAGTGCTGGTGGG + Intronic
1055613709 9:78049489-78049511 AACTCTAATTCATTGCTGGTGGG + Intergenic
1055921724 9:81467882-81467904 ATCTGTAAGAGAGTGATGGGAGG + Intergenic
1185547135 X:954561-954583 ATCTCTCAGTGAGTGAAGGAAGG - Intergenic
1185990635 X:4891178-4891200 GTGTTTAAGTGAATGCTGGTTGG + Intergenic
1185991601 X:4897577-4897599 GTGTTTAAGTGAATGCTGGTTGG + Intergenic
1187130154 X:16494673-16494695 ATCTCTAGGGAAGTGCTGGGAGG + Intergenic
1187964894 X:24601820-24601842 ATCTCTCATTTATTGCTGGTGGG + Intronic
1188253887 X:27935709-27935731 ATCTATGAGTGAGAACTGGTAGG + Intergenic
1188342929 X:29027648-29027670 AACTCTAATTAATTGCTGGTGGG - Intronic
1192801623 X:74470432-74470454 AACTCTCATTTAGTGCTGGTGGG - Intronic
1195698556 X:107684759-107684781 AATTCTAAGTGAATTCTGGTAGG + Intergenic
1199095578 X:143734776-143734798 ATCTCTCATAGATTGCTGGTGGG + Intergenic