ID: 1161732719

View in Genome Browser
Species Human (GRCh38)
Location 19:5971651-5971673
Sequence CAGTTCTCAAAGATGGTCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161732719_1161732724 12 Left 1161732719 19:5971651-5971673 CCCCGGACCATCTTTGAGAACTG 0: 1
1: 0
2: 0
3: 8
4: 116
Right 1161732724 19:5971686-5971708 ATCTGAGTTCTAGCATTCCAAGG 0: 1
1: 0
2: 2
3: 6
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161732719 Original CRISPR CAGTTCTCAAAGATGGTCCG GGG (reversed) Intronic
902224607 1:14988710-14988732 CAGTTTACAAGGATGGTCCTTGG + Intronic
902622129 1:17656696-17656718 CAGTCCTCACCGCTGGTCCGAGG - Exonic
906252808 1:44324279-44324301 AAGATGTCAAAGATGGTCAGTGG + Intronic
910112727 1:83700187-83700209 CACTCCTCACAGATGGTCTGGGG - Intergenic
910874658 1:91867295-91867317 CAGTACGCACAGATGGTACGAGG + Intronic
915105378 1:153532297-153532319 CAGTTTACAGAGATGGTCTGTGG + Intergenic
916824234 1:168428929-168428951 CAGGTCTAAAACATGGTCCCAGG - Intergenic
1063780415 10:9316188-9316210 CAGCTCTCAAAGATGGTTAAAGG + Intergenic
1069722346 10:70557728-70557750 CAGTCCCCAAAGATGGCCAGTGG - Intronic
1069793523 10:71038600-71038622 CAGCTCTGAAGGATGGTCCTGGG + Intergenic
1075252067 10:120888429-120888451 CAGTTCTAATAGATGCTCAGAGG - Intronic
1076584202 10:131534032-131534054 CAGTTCTCAGCCATGGGCCGCGG - Intergenic
1076788400 10:132763212-132763234 CAGATCTCATAGATGCTCCTGGG + Intronic
1079036682 11:17026159-17026181 CGGTTCTTAGAGATGGTCCTTGG + Intergenic
1079226109 11:18606189-18606211 CAGTTCTCTAAGCTGGTAGGGGG + Intergenic
1081435713 11:43025462-43025484 CAGTTATCAAAGGTGGTCCATGG - Intergenic
1082186650 11:49190538-49190560 TGATTCTCAAAGATGGTCCTTGG + Intronic
1089562056 11:119348269-119348291 CAGTTCTCAAAGTGGGGCCCGGG + Intergenic
1094697939 12:32840190-32840212 CAGTTCTCAAAGCTGGCCACAGG - Intronic
1095033993 12:37333960-37333982 CACTTCTCAAAGAAGATCCTGGG + Intergenic
1095034472 12:37343062-37343084 CACTTCTCAAAGAAGATCCTGGG + Intergenic
1095035385 12:37361110-37361132 CAGATCTCAAAGAAGATCCTGGG + Intergenic
1095175750 12:39090340-39090362 CAGTTCTCAAACAGGTTCCAAGG + Intergenic
1096463808 12:51837295-51837317 CTGCTCTCAAAGAAGGTCCGGGG + Intergenic
1096911088 12:54984620-54984642 CAGTTGTCGAAGCTGGGCCGAGG + Exonic
1097937723 12:65272290-65272312 CAGTTCTAAAAAATGGGCGGTGG - Intergenic
1102178215 12:110891989-110892011 TGGTTCTCAAAGCTGGTCCCTGG + Intronic
1105774468 13:23644665-23644687 CAGTCCTCAAATATGCTCTGAGG - Intronic
1106590702 13:31096165-31096187 CAGTTTTCAAACATTTTCCGAGG - Intergenic
1109149107 13:58822754-58822776 CAGTTCTTAAAGATGGTATCTGG + Intergenic
1110031181 13:70616058-70616080 CATTTATCTAAGATGGTCCCAGG - Intergenic
1113929961 13:113963103-113963125 CAGCTCTCAAAGCTGGCCCTGGG + Intergenic
1115594351 14:34894759-34894781 CAGTTCTCTAGGAAGGTCCCTGG + Intergenic
1117066238 14:52015239-52015261 CAGCGCTCACAGATGGTCGGGGG + Exonic
1117584728 14:57189280-57189302 CACTTCTCATAGATGGTAGGAGG - Intergenic
1123215303 14:106803792-106803814 CAATCCTCAAAAATGGTCCCCGG - Intergenic
1126150130 15:45516276-45516298 TAGTTCTAAAATATGGTCCCTGG + Intronic
1128393364 15:67198367-67198389 CGGTTCTCAAAGTGGGTCCCAGG + Intergenic
1134447126 16:14339138-14339160 CAGTTCACAAAGAAGCTTCGAGG - Intergenic
1134913380 16:18049462-18049484 CAGCTCTGAAAGATGATCCCAGG + Intergenic
1139471511 16:67180396-67180418 CCGTTCTCACAGATGCTCCTGGG - Exonic
1141257839 16:82419386-82419408 CAGTTCACAAACAGGGGCCGGGG + Intergenic
1142500473 17:330076-330098 CAGTTCTCCAAGCTGGGCCCAGG - Intronic
1148241679 17:46003240-46003262 CAGTTCTCTATAATGGTCAGTGG - Intronic
1151457423 17:74234235-74234257 CAGTTCTCAAGTGTGGTCCCGGG - Intronic
1152011414 17:77721037-77721059 CAGTTCTGAATGATTGCCCGAGG + Intergenic
1152759498 17:82100603-82100625 CAGTTCAGAAAGGTGGCCCGAGG + Intergenic
1158897081 18:61924261-61924283 CATTTCTCAAACATGCTCCAAGG + Intergenic
1161732719 19:5971651-5971673 CAGTTCTCAAAGATGGTCCGGGG - Intronic
1163786746 19:19278763-19278785 CAGCTGACAAAGATGGGCCGGGG - Exonic
926055329 2:9770992-9771014 CAGTGCTCAGAGAGGCTCCGTGG - Intergenic
935173367 2:100628022-100628044 CAGTTCTGAAAGTAGGTCAGTGG + Intergenic
939585940 2:144005898-144005920 CAGTTCTAAAAGTTGGTTCCAGG - Intronic
940175721 2:150875612-150875634 TGGTTCTCAAAGTTGGTCCCTGG - Intergenic
941930948 2:170937893-170937915 CAGTTCCCAAAGGTGGTCTCTGG - Intronic
942784403 2:179684040-179684062 CATTTCTGAAAGATGGACCTTGG + Intronic
1172794596 20:37528015-37528037 AAGTCCTCAAAGGTGGTCTGTGG - Intergenic
1173319538 20:41975029-41975051 CAGTTCTCATCGCTGGTCCTGGG + Intergenic
1174859249 20:54075048-54075070 CAGGTCTGAAAGAGGGTCCTGGG - Intergenic
1175156370 20:56974404-56974426 CAGGTCTCCAAGAAGGTCGGAGG - Intergenic
1177253215 21:18623929-18623951 CAGCCCTCAAAGAAGGTCCATGG - Intergenic
1178474150 21:32921810-32921832 CAGCTCTCCAAGATGGTCCAGGG - Intergenic
961720154 3:128888636-128888658 CACTTCTCAAAGAGGTTCTGGGG - Intronic
962544075 3:136414252-136414274 CAGTTTTGAAAGAAGGTCTGTGG - Intronic
962783241 3:138741273-138741295 CAGTCCTCATAGCTGGTCAGTGG - Intronic
969457152 4:7306638-7306660 CAGTTCCCAAAGCTGGTCCTGGG + Intronic
970400513 4:15712859-15712881 CAGTTCTCAATGAGGGGCCCTGG - Intronic
975655375 4:76636054-76636076 CAGTTCTCCAAGATGGTTCCTGG + Intronic
978845980 4:113273209-113273231 AAGTTCTCAAAGATTGTCCAAGG - Intronic
979313877 4:119236510-119236532 CAGTTCTGAAAGAAGATCTGTGG - Intronic
982613749 4:157613382-157613404 CAGTTCTTAAAAATGCTCCCTGG + Intergenic
985560275 5:582268-582290 CAGTTCTTAAAGATGGTGTCCGG + Intergenic
986603506 5:9498128-9498150 CAGTTCTTAAAGATGGCCATGGG + Intronic
987710274 5:21495442-21495464 CTGTTTTCAAAGATGGTCTTTGG + Intergenic
988749340 5:34178731-34178753 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991737595 5:69641923-69641945 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991760599 5:69914502-69914524 CTGTTTTCAAAGATGGTCTTTGG + Intergenic
991786733 5:70203599-70203621 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991789171 5:70221649-70221671 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991813921 5:70496755-70496777 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991817052 5:70518039-70518061 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991839830 5:70789552-70789574 CTGTTTTCAAAGATGGTCTTTGG + Intergenic
991879178 5:71203984-71204006 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991881618 5:71222013-71222035 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
994422226 5:99535547-99535569 CTGTTTTCAAAGATGGTCTTTGG + Intergenic
994460145 5:100061993-100062015 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
994484293 5:100375418-100375440 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
995522966 5:113028114-113028136 CAGTTCTCCCAGATAGTCTGAGG + Intronic
996371063 5:122753005-122753027 CAGTTCCTAAACATGGTCCTGGG + Intergenic
999319898 5:150607629-150607651 CAGGTCTCACAGCTGGTACGTGG + Intronic
999889593 5:155962676-155962698 CGGCTCTCAAAGATGTTCCCAGG - Intronic
1003534903 6:6968353-6968375 TGGTTCTCAAAGGTGGTCCAAGG + Intergenic
1004209983 6:13630324-13630346 CAATTCTCAAAGATATTCCTTGG - Intronic
1004878143 6:19976975-19976997 CAGTTCTCAAAAATCGACTGTGG + Intergenic
1005547414 6:26885077-26885099 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
1006650179 6:35545000-35545022 CAGCTCTTAAACATGGTCCTGGG - Intergenic
1007177715 6:39908156-39908178 CAGTGGGCAAAGATGGTCCTTGG + Intronic
1007281481 6:40715570-40715592 CAGTATTCAAAAATGGTCAGAGG - Intergenic
1008613876 6:53207781-53207803 GAGGTCTCAGAGATGGTCCCCGG - Intergenic
1009018177 6:57926144-57926166 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
1015759988 6:136648441-136648463 CAGTTCTGAAAGATGCTGCTCGG + Intronic
1016389293 6:143559027-143559049 CAGAAGTCAAAGATGGGCCGAGG - Intronic
1016996955 6:149967465-149967487 CAGTTCTCAAAGCTGGGCAAAGG + Intronic
1017001855 6:150002787-150002809 CAGTTCTCAAAGCTGGGCAAAGG - Intergenic
1017011571 6:150067206-150067228 CAGTTCTCAAAGCTGGGCGAGGG - Intronic
1019901978 7:4028082-4028104 TGGTTCTCAGAGATGGTCTGTGG + Intronic
1022170805 7:27827866-27827888 TGGTTCTCAAAGGTGGTCCTTGG + Intronic
1032606863 7:133364862-133364884 CAGTTCACAAAGCTTGTTCGTGG + Intronic
1034126219 7:148674413-148674435 CAGTTCTCAGAGATGTGCCTTGG + Intergenic
1043417486 8:80066040-80066062 CAGTTCTCAGAAATGGTCCTGGG - Intronic
1044817502 8:96128165-96128187 CATTTCTCAAACATGGTACGTGG + Intergenic
1048442091 8:134467526-134467548 CAGTGCTCAAAAATGGTCACTGG + Intergenic
1048743586 8:137588897-137588919 CAGTTTTCAAAGATATTCTGGGG - Intergenic
1049653749 8:143788776-143788798 CAGTGCTCACAGCTGGTGCGTGG - Intergenic
1055765192 9:79655247-79655269 CAGTTCTCAACCATTGGCCGAGG + Intronic
1056578870 9:87876149-87876171 AGGTTCTCAAAGTTGGTCCCTGG - Intergenic
1056773063 9:89493372-89493394 CAGCCCTCAAAGATGGCCCAGGG + Intronic
1060008233 9:120019398-120019420 GAGGTCTCATAGATGGTCCTAGG - Intergenic
1060913918 9:127373215-127373237 CAGTTCTCTAGGAAGGTCCCTGG - Intronic
1061676851 9:132222270-132222292 CAGATCCCAGAGATGGTCCTTGG - Intronic
1187589402 X:20699992-20700014 TAGTTCTCAAAGTTGGTTCTTGG + Intergenic
1195029697 X:100914381-100914403 GAGTTCTCAACCCTGGTCCGAGG + Exonic
1195052605 X:101111290-101111312 AAATTCTCAAATATGGTCTGTGG + Intronic
1198775879 X:140178555-140178577 CTGTTTTCAAAGATGGGGCGGGG - Intergenic
1199815109 X:151390537-151390559 CAGTTTTGAAAGAAGTTCCGTGG + Intergenic