ID: 1161733552

View in Genome Browser
Species Human (GRCh38)
Location 19:5977291-5977313
Sequence TGGTGCCTTCTCGGGGGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161733552 Original CRISPR TGGTGCCTTCTCGGGGGATC TGG Intronic
900173792 1:1283192-1283214 CTGTGCCTACTCGGGGGAGCAGG + Intronic
901749245 1:11395916-11395938 TGGAGCCTTCTAGGGGAGTCGGG - Intergenic
902678297 1:18024633-18024655 TGGTGAGTTCTCGCGAGATCTGG - Intergenic
903180371 1:21602175-21602197 TGGAGCCCTCTCAGGGGACCTGG + Intronic
903372331 1:22844736-22844758 TGGGGGCTTCCTGGGGGATCCGG - Intronic
904848044 1:33435558-33435580 TGGTTCCTTCTTGGGGCATTAGG + Intergenic
905028328 1:34865897-34865919 GGGCGCCTTCGCGTGGGATCAGG + Exonic
905877979 1:41445565-41445587 TGGTGCCATCTAGAGGGGTCAGG - Intergenic
906480806 1:46197920-46197942 TGATGCCTTCTGGGGAGATGAGG + Intronic
907816983 1:57928246-57928268 TGGTTGCCTCTCGGGGGATAGGG - Intronic
910207239 1:84760058-84760080 TGCTGCCTTCTCGGGGCTTAGGG - Intergenic
912129774 1:106587077-106587099 TGGTGCCATATCGAGGGCTCAGG + Intergenic
912450309 1:109764151-109764173 AGGTGCCTACTCTGGGGAACAGG + Intronic
915558647 1:156674126-156674148 TGGTGGCTTCACTGGGGGTCAGG + Intronic
915789669 1:158654655-158654677 TGGTGACTTCTCGGGGGCTGCGG + Exonic
916787040 1:168093885-168093907 TGCTGCCTCCTCCTGGGATCAGG + Intronic
917837636 1:178953636-178953658 TGGTGCCTTCTCTGCGGGTGGGG - Intergenic
920828696 1:209446377-209446399 TAGTGCCATCTCAGGGGATGTGG - Intergenic
922485877 1:225972655-225972677 TGGTTCCTTCTCTGGGGATAGGG + Intergenic
1069564478 10:69454079-69454101 TGGTGCCATCTCTGGGGTTGAGG + Intronic
1070764065 10:79046464-79046486 TGGTGCATTCTCAGGGTGTCTGG + Intergenic
1074401950 10:113148920-113148942 TGGTGCCTTCCCGTGGTATTTGG + Intronic
1077316883 11:1923346-1923368 TGGTGGCTTTTGGGGGGCTCGGG - Intronic
1079533550 11:21484288-21484310 TGGTGGTTTCTCGGGGCATAAGG - Intronic
1080165227 11:29227681-29227703 TGTTTCCTTCTCAGTGGATCAGG - Intergenic
1089318664 11:117610070-117610092 TGGTGCCTCCTCGAGGGGGCAGG - Intronic
1100170473 12:91969897-91969919 TAGTGAATTCTCGGGAGATCTGG - Intergenic
1102281833 12:111624620-111624642 TGGTGTCTTCTCGGGGGTGCAGG + Intergenic
1102457300 12:113078620-113078642 TGGTGCCTTCTCAGGGTCACCGG + Intronic
1104536250 12:129620809-129620831 TGGGGCCCTCTTGGGGGATGAGG + Intronic
1104933543 12:132352907-132352929 TGGTGCCTTCTCTGGGTTTCCGG + Intergenic
1108437985 13:50420233-50420255 TGTTGCCTTGAGGGGGGATCTGG + Intronic
1113295506 13:108955124-108955146 TGGTGCCATCTCAGGGGAGCAGG - Intronic
1117553131 14:56856261-56856283 GGGTGCTTTCTCGGGGGCTGGGG - Intergenic
1119520192 14:75279253-75279275 CGGTGCCGGCTCGGGGGCTCGGG + Intronic
1120531479 14:85637644-85637666 GGGTGCCTTCTCATGTGATCAGG + Exonic
1122363965 14:101183435-101183457 TGGTGCCCCCTAGCGGGATCCGG - Intergenic
1122903110 14:104790092-104790114 TGGTGCCTTCAGGGGTGATGTGG - Intronic
1127896094 15:63300174-63300196 TGGTGCCATCTCGAGCCATCTGG + Intronic
1129059571 15:72849905-72849927 TGGTGCCTTCTCAGGCTGTCTGG + Intergenic
1130885300 15:88087670-88087692 TGGTGACATCTCTGGGGCTCTGG - Intronic
1132226253 15:100144012-100144034 TGGAGCCTTCTCAGGGTATGTGG + Intronic
1132852985 16:2033158-2033180 TGGAGCCTTCGCAGGGGAGCGGG + Intronic
1134064572 16:11219587-11219609 TGGTGACTTCTGGGGGGCTGGGG - Intergenic
1134070431 16:11256629-11256651 TGTGGCCTCCTAGGGGGATCTGG - Intronic
1135415557 16:22265898-22265920 TGGTGCCTTATATGGGGAGCTGG + Intronic
1136034719 16:27530498-27530520 TGCTGCCTTTTGGGGGGATTTGG - Intronic
1138387266 16:56644184-56644206 TGGGGCCTTCCCTGGGAATCTGG + Intronic
1138387942 16:56648899-56648921 TGGGGCCTTCCCTGGGAATCAGG + Intronic
1139273463 16:65705052-65705074 TGGTGCCCTCTAGGGGTAACTGG - Intergenic
1141153324 16:81579617-81579639 TGTTGCCTTCAGGGGGGAGCAGG - Intronic
1142620091 17:1159995-1160017 AGGTGCCTTCTGGAGGGAACAGG + Intronic
1143024993 17:3936306-3936328 TGAGGGCTTCTCGGGGGCTCCGG + Exonic
1143072664 17:4310293-4310315 TGTTTACTTCTCTGGGGATCAGG - Intronic
1144649854 17:17000575-17000597 TGGTTACTTCTCGGGGGGTGGGG + Intergenic
1145941291 17:28744490-28744512 CGGCGCCTTCTCGTGGGGTCAGG + Intronic
1146139958 17:30357257-30357279 TGCTGCCTTCTCAGGGGCACAGG - Intergenic
1147946596 17:44083805-44083827 TGCTGCCTTGTGGGGGCATCGGG - Exonic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1156095816 18:33530868-33530890 GGGTGCCTTTGTGGGGGATCTGG - Intergenic
1157441952 18:47718398-47718420 TGGTTCCTTCTGGGGGCATGGGG + Intergenic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
929842271 2:45480288-45480310 TGGTGATTTCTCTGAGGATCTGG + Intronic
932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG + Intronic
934603806 2:95679318-95679340 TGGTGCCCTTTGGGAGGATCTGG + Intergenic
934814089 2:97309755-97309777 TGGTGCCTTCACGGGGGTGGGGG + Intergenic
937294174 2:120799784-120799806 TGGAGCCTTCTGGGGGACTCAGG - Intronic
939242521 2:139579513-139579535 TGGGGCCTGCTGGGGGGTTCTGG + Intergenic
939485127 2:142801872-142801894 TGGTGCATTCTCATGAGATCTGG - Intergenic
943660101 2:190550398-190550420 TAGGGCCTTGTCGGGGGATTAGG - Intergenic
1172704534 20:36873161-36873183 TGGCCCCCTCTCTGGGGATCAGG + Intergenic
1173827831 20:46058598-46058620 CGGTGCCTTCGCTGGGGAGCAGG + Intronic
1179072524 21:38084950-38084972 TGGGCCCTTCTCAGGGCATCAGG + Intronic
1179908294 21:44435337-44435359 TGGTGCCTACTGGGGGGATGCGG + Intronic
1182332429 22:29560821-29560843 TTGTGCCTTCTCCAGGGCTCGGG - Exonic
951092924 3:18596892-18596914 TGGTGCATTCTGGGGGCATGGGG + Intergenic
952816968 3:37454047-37454069 TGGTGCCTAGTGTGGGGATCTGG - Intronic
957226084 3:77448709-77448731 TGGCAGCTTCTCGGGGGAACTGG + Intronic
961125259 3:124411874-124411896 TGGGGCATCCTTGGGGGATCTGG - Intronic
966945201 3:184772979-184773001 TGGCGCCAGCTCGGGGAATCAGG - Intergenic
968901844 4:3435706-3435728 GGGTGGCTTCTGGTGGGATCCGG - Intronic
985657017 5:1137558-1137580 CAGTGCCTGCTCGGGGGGTCTGG - Intergenic
986418157 5:7549282-7549304 TGCTGCCTTCGCCAGGGATCTGG - Intronic
989425508 5:41291141-41291163 TCTTGCCTTCTTGGGGGCTCAGG - Intergenic
1009519496 6:64663757-64663779 TGCTGCCATCTTGGGGGCTCTGG - Intronic
1013152957 6:107464205-107464227 TGGAGCCTTCTCAGGGTATGTGG - Intergenic
1013722823 6:113051307-113051329 TGGAGCTTTCTCGGGACATCAGG + Intergenic
1018174585 6:161167719-161167741 TGATGCCTTCTAGAGGGCTCTGG - Intronic
1022939429 7:35218904-35218926 TGGTGCCTTCTTGGTGGAAAGGG - Intronic
1026237252 7:68538140-68538162 TGGTGCCATCTCGGGCTGTCTGG - Intergenic
1028832874 7:95345442-95345464 TGGTGCCTACTCTGGGGGTGGGG + Intergenic
1028935147 7:96456017-96456039 TGGTGCCGTATCGAGGGCTCAGG - Intergenic
1030832939 7:114249367-114249389 TGGGGCCTACTGGGGGGAACGGG - Intronic
1031506633 7:122592825-122592847 TGGGGCCTTCCAGGGGGATGGGG + Intronic
1036447313 8:8833118-8833140 TGGTGAATTCTCATGGGATCTGG - Intronic
1042374403 8:68032596-68032618 TGGTCCCTTCTGGGGAGTTCAGG + Intronic
1042733809 8:71965355-71965377 TGGTGAGTTCTCGTGAGATCTGG + Intronic
1048039141 8:130708126-130708148 TAGTGACTTCTCGTGAGATCTGG - Intergenic
1048164860 8:132053628-132053650 AGGTCCCTTCTCAGAGGATCTGG + Intronic
1052831156 9:33216933-33216955 TAGTCCCTTCTCTGGGGATATGG + Intergenic
1053610613 9:39709710-39709732 GGGTGCCTTCTCATGAGATCTGG - Intergenic
1053868648 9:42467732-42467754 GGGTGCCTTCTCATGAGATCTGG - Intergenic
1054087640 9:60761447-60761469 GGGTGCCTTCTCATGAGATCTGG + Intergenic
1054242910 9:62632685-62632707 GGGTGCCTTCTCATGAGATCTGG + Intergenic
1054557034 9:66667203-66667225 GGGTGCCTTCTCATGAGATCTGG + Intergenic
1054928633 9:70613809-70613831 TGGTGGCTTCTTGAAGGATCAGG + Intronic
1056427608 9:86492728-86492750 TTGTGAGTTCTCGGGAGATCTGG + Intergenic
1056832055 9:89925049-89925071 TGGTGCCTTCACGGGGAGTGGGG - Intergenic
1057631168 9:96720033-96720055 TGGTGCCGTCCCGGGGGTGCGGG + Intergenic
1058656708 9:107228917-107228939 TGTTGACTCCTCGGGGGATGGGG + Intergenic
1060515377 9:124262517-124262539 AGATGACTTCTCGGGTGATCTGG + Intronic
1062155416 9:135045612-135045634 TGGTGCCCTCGCTGGGGATGAGG + Intergenic
1203761310 EBV:13869-13891 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203762239 EBV:16941-16963 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203763168 EBV:20013-20035 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203764097 EBV:23085-23107 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203765026 EBV:26157-26179 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203765955 EBV:29229-29251 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203766884 EBV:32301-32323 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1185766790 X:2732231-2732253 TGTTGGCTTCGCGGGGGACCTGG + Intronic
1195492950 X:105494658-105494680 TGGTCCCTTTTTGGGGGGTCAGG + Intronic
1200247401 X:154533460-154533482 TGGTGACTTCTCCGGGGTTGAGG + Intronic