ID: 1161735943

View in Genome Browser
Species Human (GRCh38)
Location 19:5992076-5992098
Sequence AGGCCAGTTTCCCGAGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161735943_1161735950 28 Left 1161735943 19:5992076-5992098 CCTGGCACTCGGGAAACTGGCCT No data
Right 1161735950 19:5992127-5992149 TGGGCCACCCTCCCTCCCGCAGG No data
1161735943_1161735948 9 Left 1161735943 19:5992076-5992098 CCTGGCACTCGGGAAACTGGCCT No data
Right 1161735948 19:5992108-5992130 GCAACTGTACTAGCCTCTGTGGG No data
1161735943_1161735947 8 Left 1161735943 19:5992076-5992098 CCTGGCACTCGGGAAACTGGCCT No data
Right 1161735947 19:5992107-5992129 AGCAACTGTACTAGCCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161735943 Original CRISPR AGGCCAGTTTCCCGAGTGCC AGG (reversed) Intergenic