ID: 1161737528

View in Genome Browser
Species Human (GRCh38)
Location 19:6000774-6000796
Sequence CTGTATCAGCAGCATGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7148
Summary {0: 1, 1: 66, 2: 1962, 3: 2271, 4: 2848}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161737522_1161737528 23 Left 1161737522 19:6000728-6000750 CCATTCAACCTATTTTTCTTTAT 0: 1
1: 65
2: 1522
3: 1687
4: 2097
Right 1161737528 19:6000774-6000796 CTGTATCAGCAGCATGAGAATGG 0: 1
1: 66
2: 1962
3: 2271
4: 2848
1161737523_1161737528 15 Left 1161737523 19:6000736-6000758 CCTATTTTTCTTTATAAATTACC 0: 50
1: 1594
2: 1651
3: 1205
4: 1396
Right 1161737528 19:6000774-6000796 CTGTATCAGCAGCATGAGAATGG 0: 1
1: 66
2: 1962
3: 2271
4: 2848
1161737527_1161737528 -7 Left 1161737527 19:6000758-6000780 CCAGTGTTGGGTATGTCTGTATC 0: 2
1: 35
2: 1548
3: 3599
4: 5987
Right 1161737528 19:6000774-6000796 CTGTATCAGCAGCATGAGAATGG 0: 1
1: 66
2: 1962
3: 2271
4: 2848
1161737526_1161737528 -6 Left 1161737526 19:6000757-6000779 CCCAGTGTTGGGTATGTCTGTAT 0: 2
1: 59
2: 2451
3: 4430
4: 7881
Right 1161737528 19:6000774-6000796 CTGTATCAGCAGCATGAGAATGG 0: 1
1: 66
2: 1962
3: 2271
4: 2848

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161737528 Original CRISPR CTGTATCAGCAGCATGAGAA TGG Intronic
Too many off-targets to display for this crispr