ID: 1161737942

View in Genome Browser
Species Human (GRCh38)
Location 19:6002951-6002973
Sequence CAGGGACAACACAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 564
Summary {0: 1, 1: 0, 2: 2, 3: 69, 4: 492}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161737932_1161737942 8 Left 1161737932 19:6002920-6002942 CCGCTGCGCTCCTTGCAGGGGTG 0: 1
1: 0
2: 0
3: 21
4: 191
Right 1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG 0: 1
1: 0
2: 2
3: 69
4: 492
1161737935_1161737942 -2 Left 1161737935 19:6002930-6002952 CCTTGCAGGGGTGTGTGGGCTCA 0: 1
1: 0
2: 4
3: 30
4: 222
Right 1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG 0: 1
1: 0
2: 2
3: 69
4: 492
1161737928_1161737942 14 Left 1161737928 19:6002914-6002936 CCTGTTCCGCTGCGCTCCTTGCA 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG 0: 1
1: 0
2: 2
3: 69
4: 492

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161737942 Original CRISPR CAGGGACAACACAGGGAGGA GGG Intronic
900279643 1:1858424-1858446 CAGGAAGAACCCAGGGATGAGGG - Intronic
900613688 1:3554955-3554977 CAGGGAAAAGACAGGGCGGCTGG + Intronic
900751864 1:4402948-4402970 CAGGGACAAGACAAGCAGGGTGG + Intergenic
901122294 1:6905664-6905686 CACGGACAATACAGAGAAGAGGG - Intronic
901403863 1:9032949-9032971 CAGGAATAGCAAAGGGAGGAAGG + Intergenic
901513300 1:9729171-9729193 CAGGGACGGGACATGGAGGATGG + Exonic
901611796 1:10504587-10504609 CTGGGCCAACACAGAGAGAAAGG - Intronic
901773933 1:11546143-11546165 CAGTGACAGCTCAGGGAGGAGGG - Intergenic
902005125 1:13225900-13225922 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902024350 1:13371694-13371716 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902206099 1:14869179-14869201 AAGGGTCAAGACAGGCAGGAAGG - Intronic
902299608 1:15492653-15492675 TAGAGACAACACAGGGATCATGG + Exonic
902754646 1:18541059-18541081 TAGGGCCACAACAGGGAGGATGG - Intergenic
902841162 1:19074767-19074789 GAGGGAGAACAGAGGGTGGAAGG + Exonic
905016894 1:34783907-34783929 CAGGCCCAGCACAGGGAGCAGGG + Intronic
905592072 1:39172914-39172936 CAAGGACAAAAAAGGGAGGAGGG - Intronic
905898309 1:41563439-41563461 CAGGAAAAAGTCAGGGAGGAGGG - Intronic
905914419 1:41675047-41675069 CAGGGACACCCATGGGAGGATGG - Intronic
906290209 1:44614779-44614801 CAGGGACAAGGGAGGGAGGCTGG - Intronic
906638677 1:47427715-47427737 CAGGGAGAAGACAGAGAGTAGGG + Intergenic
909259053 1:73463774-73463796 CAGGAACAAGCCAGGGAAGAGGG + Intergenic
910891432 1:92024436-92024458 GAGGGAGAAGAGAGGGAGGAGGG + Intergenic
915346707 1:155201249-155201271 CAGGGAAAATATAGGGAGGAGGG - Intronic
917651125 1:177078286-177078308 CAGTGACCCCACAGGGATGAAGG - Intronic
917798932 1:178552917-178552939 CAGGGAGAGAACAGGGAGCAAGG + Intergenic
918177819 1:182060780-182060802 CAGGGACAGCAAAGGGATGCTGG + Intronic
919552319 1:199006205-199006227 CAGGGACAAAAGAGGGAGAGGGG + Intergenic
919920572 1:202164402-202164424 CGGGGACAACACAGAGCGGGAGG - Intergenic
919972163 1:202588117-202588139 CAGGGCAAAGACAAGGAGGAAGG - Exonic
920011834 1:202873690-202873712 CAGGGACAGCACAGCCTGGATGG - Intergenic
920915899 1:210257764-210257786 CAGGGAAAATACTGGCAGGAAGG + Intergenic
921273022 1:213489657-213489679 CAGTGGCAACTCAGGGAGGCAGG + Intergenic
921528607 1:216251161-216251183 TAGGTACAAGACAGGGAGGGAGG + Intronic
921599110 1:217088755-217088777 AAGGGAAAAGAAAGGGAGGAGGG + Intronic
922079702 1:222283842-222283864 GAGGGGGAACACAGGCAGGAAGG + Intergenic
922932746 1:229403118-229403140 CAGGGACCACCCTGGGAGCATGG - Intergenic
923835724 1:237609035-237609057 CAGGGACAAGGAAGGAAGGAAGG - Intronic
924932016 1:248740316-248740338 CAGGGAAAACTCAGGCAGGGAGG - Intronic
1062820444 10:530799-530821 AAGCGGCATCACAGGGAGGAAGG + Intronic
1063883551 10:10554601-10554623 CAGGGTCACCACAGGGAGGCTGG - Intergenic
1064136258 10:12753554-12753576 CAAGGACCACACGGGGTGGATGG - Intronic
1064301846 10:14129942-14129964 GAGGGCCACCACAGGGAAGAGGG - Intronic
1064844670 10:19638310-19638332 CAGGGAAAACAAAAGGAGGTGGG + Intronic
1065552381 10:26881861-26881883 CAGTGACAACATAGGCAGCATGG + Intergenic
1065644065 10:27816188-27816210 CAGGGACAAGACAGGGTGCAGGG - Intronic
1065813096 10:29460430-29460452 TAGTGAATACACAGGGAGGATGG + Intronic
1066068336 10:31778705-31778727 CTGGGAGGAAACAGGGAGGATGG - Intergenic
1066275617 10:33865639-33865661 CAGGGAAAAGAAAGGAAGGAAGG - Intergenic
1066444504 10:35469682-35469704 CAGGGAGAAGACAGGGAGATAGG + Intronic
1066654131 10:37683362-37683384 CTGGGACAACATAGGGAAGCAGG + Intergenic
1066701117 10:38129427-38129449 CAGGGACTACTCAAGGTGGAGGG - Intergenic
1067338767 10:45384305-45384327 CAGGGACAGCACAGGTTGGAGGG + Intronic
1067771898 10:49132333-49132355 CAGGGACTATACAGAGAGAAGGG - Exonic
1067856601 10:49799057-49799079 CAGTGACAGAAGAGGGAGGAGGG - Intergenic
1068850354 10:61731749-61731771 GAGGGAGGACAGAGGGAGGAAGG + Intronic
1069987640 10:72295418-72295440 GAGGGACCACACACAGAGGAAGG + Intergenic
1070656817 10:78277347-78277369 CCAGGACAACAAAGGGAGAAAGG + Intergenic
1070850453 10:79558606-79558628 GAGGGACAGCACTGGGAGGCAGG - Intronic
1070856766 10:79612690-79612712 GAGGGACAGCACTGGGAGGCAGG + Intronic
1071533834 10:86411097-86411119 CAAGGCCCACACAGGGAGGGAGG - Intergenic
1071886029 10:89951654-89951676 CAGAGACAACAGAGAGAGAATGG - Intergenic
1072543267 10:96414451-96414473 CAGGGAGAAGACAGTGAGGAGGG - Intronic
1072711045 10:97715613-97715635 CCGGGACAGCACAGGGATGCTGG - Exonic
1072712381 10:97724414-97724436 CAGGGCCACGAGAGGGAGGAGGG - Intergenic
1072805163 10:98419384-98419406 AAGGGAAAAGACAGAGAGGAGGG + Intronic
1074001539 10:109378698-109378720 CAGGGCCAGTGCAGGGAGGAGGG + Intergenic
1074033887 10:109718346-109718368 CAGGAAAAACACATGGAAGATGG + Intergenic
1075779459 10:125007517-125007539 CAGGTAGATCTCAGGGAGGATGG + Intronic
1075923989 10:126235889-126235911 CAAGGGGAACACACGGAGGAGGG + Intronic
1076160855 10:128243159-128243181 CAGCGACAAGACAGGGTGGGTGG - Intergenic
1076181509 10:128412587-128412609 CAGGGAAAAGCCAGGGAGGGTGG - Intergenic
1076401518 10:130188598-130188620 CAGGGACAGCACTGGGTGCAGGG + Intergenic
1076620071 10:131781341-131781363 CAGGCACAACAGAGGGATGCAGG + Intergenic
1076812888 10:132898467-132898489 ATGGGGCAACCCAGGGAGGACGG - Intronic
1076817682 10:132922845-132922867 TAGGGACATCACTGGAAGGATGG - Intronic
1077344212 11:2038978-2039000 CATGGAGGGCACAGGGAGGAGGG + Intergenic
1077445104 11:2587161-2587183 CAGTGGCCACACAGTGAGGAAGG - Intronic
1077961418 11:7080033-7080055 CAGGGGGAACACAGAGAGTAAGG + Intergenic
1078011282 11:7574971-7574993 AAGGGACAGAAAAGGGAGGAAGG - Intronic
1078153394 11:8777838-8777860 CAGGTAGATTACAGGGAGGATGG - Intronic
1079843331 11:25430946-25430968 CAGTGAGAACACATGGAGAAAGG + Intergenic
1083681660 11:64354361-64354383 CGGGGACAGCACAGGCAGGAGGG - Intronic
1083821657 11:65174978-65175000 GAGGGACAAGACAGGCAGGGAGG + Intergenic
1083904356 11:65660413-65660435 CAGGGAGCCCACAGGGAGGCTGG - Intronic
1084164003 11:67366751-67366773 CAGGGAAAGAAAAGGGAGGAGGG - Intronic
1084357886 11:68651721-68651743 CAGGGACCGCAGAGGGAGGGAGG + Intergenic
1084912734 11:72404265-72404287 CAGTGCCAAGAAAGGGAGGAGGG + Intronic
1085129496 11:74025967-74025989 AAGGGAAAGCACAGAGAGGAAGG + Intronic
1085236281 11:75017862-75017884 CAGTGACAAGACTGGGAGGTAGG + Intronic
1085319820 11:75567077-75567099 CTGTGACAACCCAGGGAGGCAGG + Intronic
1085345581 11:75766259-75766281 CAGTGACAGCACAGGGGGAAAGG + Intronic
1085482340 11:76833119-76833141 GAGGGACAAGACAGAGAGGAGGG - Intergenic
1086444289 11:86857919-86857941 CAGGGAGAGCCCAGTGAGGACGG + Intronic
1087761762 11:102110469-102110491 CAGGGAAAAGAAAGGGAGGAAGG + Exonic
1088763446 11:112953639-112953661 CAGGGACAAAACAGGGAGTTAGG + Intergenic
1089396253 11:118137863-118137885 CACGGAGAGCTCAGGGAGGAAGG - Intronic
1089702884 11:120255863-120255885 CAAGGTCACCAGAGGGAGGAAGG - Intronic
1090106797 11:123862142-123862164 CAGGCGCAACACAGCCAGGAAGG + Intergenic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090418211 11:126555568-126555590 CAGGGTAGACACAGGGAGCAGGG + Intronic
1091347962 11:134867959-134867981 CAGAGCCCACACAGGGAGCATGG + Intergenic
1202827198 11_KI270721v1_random:94167-94189 CATGGAGGGCACAGGGAGGAGGG + Intergenic
1091386062 12:95570-95592 CAGGGAAAAAACATGGAGGTAGG - Intronic
1091831820 12:3555491-3555513 CAGGGATCAGAGAGGGAGGAGGG + Intronic
1092173939 12:6390353-6390375 CAGGGAGAAGAGAGGAAGGATGG + Intronic
1092431783 12:8415653-8415675 CAGGGACAGCAAAGTGAGGACGG + Intergenic
1092434734 12:8438273-8438295 CAGGGACAGCAAAGTGAGGACGG + Intergenic
1092671579 12:10867802-10867824 AAGAGACAAAATAGGGAGGAGGG - Intronic
1094075371 12:26466754-26466776 CAGAGAAAACACAGGGTGCAGGG + Intronic
1096621611 12:52869102-52869124 CAGTGACAGCACAGGGAAGTAGG - Intergenic
1097038631 12:56140747-56140769 GAGGGACAACACTGGGGGCAGGG + Intronic
1098784637 12:74736149-74736171 CAGGAACAAAAAAGAGAGGATGG - Intergenic
1098851430 12:75600864-75600886 CAGGGACAGCACAGGACAGAAGG + Intergenic
1099877743 12:88430194-88430216 CAGGGACACATCAGGGAAGAAGG - Intergenic
1100194307 12:92226949-92226971 CAGGGACAACACCAGGGAGATGG - Intergenic
1100792254 12:98143404-98143426 CAGGAACTAGAGAGGGAGGAGGG + Intergenic
1101177877 12:102174967-102174989 GAGGGAAGAGACAGGGAGGAAGG - Intronic
1101785977 12:107884011-107884033 CAGGGATAACGGAAGGAGGAAGG - Intergenic
1102078601 12:110080012-110080034 AAGGGAGAAGACAGGGAGAAAGG + Intergenic
1103134262 12:118493976-118493998 CAGGGAAAAGGCAGGGAGAAGGG + Intergenic
1103341047 12:120221349-120221371 CTGGGAGCACCCAGGGAGGAAGG + Intronic
1103380185 12:120488195-120488217 GAGAGACAAGACAGGGAGTAGGG - Intronic
1103507987 12:121454282-121454304 CAGAGCCACCCCAGGGAGGATGG + Intronic
1103612646 12:122133535-122133557 CATGGTGAAGACAGGGAGGAAGG - Exonic
1103820053 12:123690519-123690541 CAGGGACACCTGAGGGAGAAGGG - Exonic
1103926606 12:124426867-124426889 CAGGGAAGACACAGAGGGGACGG + Intronic
1104073761 12:125371367-125371389 CTGGGAAGAGACAGGGAGGAAGG + Intronic
1104332136 12:127856818-127856840 CTGGGAAAACACAAGGAGGGAGG + Intergenic
1104418990 12:128619652-128619674 TGGGGACAGCGCAGGGAGGAGGG - Intronic
1104603458 12:130169461-130169483 CAGGGACAGAGGAGGGAGGAGGG + Intergenic
1104938921 12:132385731-132385753 CAGGGAAAACACAGAGAGGCTGG + Intergenic
1106670602 13:31900480-31900502 GAGTGACAATGCAGGGAGGAAGG + Intergenic
1106708762 13:32309618-32309640 CAGAGATAGCACAGGAAGGAGGG - Intronic
1108530155 13:51320944-51320966 CAGGGACAGCACATGGGGGAAGG - Intergenic
1109839338 13:67902329-67902351 CCGGGACAACCCAGCGAGGACGG - Intergenic
1112625408 13:101098052-101098074 CAGGGACCGAACAAGGAGGAAGG - Intronic
1113408417 13:110062877-110062899 AATGGGCAACACAGGGAGGGAGG - Intergenic
1113432712 13:110264454-110264476 TAAGAACAACAGAGGGAGGACGG + Intronic
1113568433 13:111335826-111335848 CAGGAAGATCACAGCGAGGAAGG + Intronic
1114850363 14:26376142-26376164 CAGGGATAGCACTGGGAGTAAGG + Intergenic
1115700994 14:35952855-35952877 AAAGGAGACCACAGGGAGGAGGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118101578 14:62610889-62610911 CAGGGAGAAGACTGGGAGGGTGG + Intergenic
1118530499 14:66700522-66700544 CTGGGACAACTCGGGGATGAAGG + Intronic
1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG + Intronic
1119480429 14:74954937-74954959 CAGGGAAGCCACAGGGAGGGAGG - Intronic
1119684250 14:76618422-76618444 CAGAGACAAAGCAGGGAGGCAGG + Intergenic
1121261562 14:92570011-92570033 CAGGGATGGCACAGGAAGGAAGG - Intronic
1121332133 14:93056251-93056273 CAGAAAGATCACAGGGAGGACGG + Intronic
1122319595 14:100845732-100845754 CAGAGACAACACAAGGAGGCAGG - Intergenic
1122573003 14:102720786-102720808 AAGGTACAACCCAAGGAGGAGGG - Intronic
1122685406 14:103502479-103502501 GAGGGACAGCCCAGGGTGGATGG + Intronic
1122790706 14:104183065-104183087 CGGGGTCCAGACAGGGAGGACGG - Intergenic
1122911087 14:104827836-104827858 CAGGGACGGGGCAGGGAGGAGGG + Intergenic
1122950631 14:105042548-105042570 CAGTGACACCACAAGGAGGCAGG + Intergenic
1123876994 15:24633424-24633446 CAGGGGGAACACAGAGAGTAAGG + Intergenic
1124129967 15:26974571-26974593 CAGAGACAGCAGAGGGAGGGAGG + Intronic
1124627092 15:31314419-31314441 CAGGGAGATGACAGGGATGATGG - Intergenic
1126429266 15:48563414-48563436 CAGGGAGCAGGCAGGGAGGAGGG + Intronic
1126789594 15:52209046-52209068 CAGGGAAACCTCAGAGAGGAAGG + Intronic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1127329286 15:57922974-57922996 CAGGATCAGCTCAGGGAGGAGGG + Intergenic
1128635320 15:69298995-69299017 CGGGGACAGCACAGGCAGGCCGG - Exonic
1128738741 15:70068965-70068987 CTGGCACAACACAGAGAGGTCGG - Intronic
1129253492 15:74321091-74321113 CAGGGACAAGTCGGGGAGGATGG - Intronic
1129756910 15:78104247-78104269 CAGGGTCAGGGCAGGGAGGAGGG - Exonic
1129887328 15:79047805-79047827 CACGGTCCACACTGGGAGGAAGG + Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130956570 15:88631014-88631036 CAGGCACAGCTCAGGGAGGAGGG + Exonic
1131060558 15:89401290-89401312 CCAGGACAACACAGAGAAGAGGG - Intergenic
1131249051 15:90819041-90819063 CAGGGTCACCACTGGGAAGAAGG + Intergenic
1132462572 16:62715-62737 CAGGGTGGACACAGGCAGGAAGG + Intronic
1132758161 16:1495998-1496020 CAGGGAAAACAGAGCGAGCATGG - Intronic
1132799087 16:1742674-1742696 CAGTAACACCACAGGGAGGCAGG + Intronic
1132799929 16:1747004-1747026 AAGGCCAAACACAGGGAGGAGGG - Intronic
1133417023 16:5614890-5614912 GAGGAAGAACACAGGGAGGGTGG + Intergenic
1133507030 16:6422389-6422411 GAGGGGAAAGACAGGGAGGAGGG - Intronic
1135405197 16:22192562-22192584 CAGGGAGAAGAAAGAGAGGAAGG - Intergenic
1137387975 16:48058390-48058412 CAGGGAAAACACATAGAGAAAGG - Intergenic
1137396363 16:48118276-48118298 CAGAGAAAACCGAGGGAGGAGGG - Intronic
1137701350 16:50500293-50500315 CAGTGACAACCCAGGGAGGGAGG + Intergenic
1137801040 16:51262205-51262227 CAGGAAGAAGACAGGGAGGAAGG - Intergenic
1138299266 16:55912630-55912652 CAGGGAAAAGACCAGGAGGAGGG + Intronic
1138541528 16:57690543-57690565 CAGGGACCACTCTGGGATGAGGG - Intergenic
1138600151 16:58049246-58049268 GAGGAACCACACAGGGAGGTAGG + Intergenic
1139345311 16:66299377-66299399 CAGGCAGAAAACAGGGAAGAAGG - Intergenic
1139532975 16:67552502-67552524 AGGGGACAACAGAGGGAGGGAGG + Intergenic
1140119701 16:72072949-72072971 CAGGGAGAACACAGAGAGTAAGG - Intronic
1140257516 16:73349758-73349780 GAGGGAAAAAAGAGGGAGGAAGG - Intergenic
1140516785 16:75548970-75548992 CAGGAACATCTCAGAGAGGAGGG + Intronic
1140595530 16:76405384-76405406 TTTGGATAACACAGGGAGGAGGG + Intronic
1140808175 16:78552783-78552805 CAGAGAGAACAGAGGGAGAAAGG - Intronic
1141245471 16:82302913-82302935 CAGGGATGAGGCAGGGAGGAGGG - Intergenic
1141466130 16:84206900-84206922 CAGGGACAAGACAGTGAACAGGG - Intergenic
1141498404 16:84426227-84426249 CAGGGGCAGGAGAGGGAGGAAGG + Intronic
1141902636 16:87002684-87002706 TGGGGAGAACAGAGGGAGGAAGG - Intergenic
1142887546 17:2922192-2922214 CAGTGTCCTCACAGGGAGGAAGG + Intronic
1142889271 17:2932423-2932445 CAGGGAGAGGAGAGGGAGGAAGG + Intronic
1142946411 17:3433065-3433087 CAGTGACACCACAGAGAGGTGGG + Exonic
1143610654 17:8015852-8015874 CGGGGACAAGACGGGGAGGTGGG + Intronic
1143705829 17:8697165-8697187 CAGGGACCTGCCAGGGAGGAAGG + Intergenic
1143875886 17:9990471-9990493 CAGGGACCACCCAGGAGGGAAGG + Intronic
1145086732 17:19948684-19948706 CAGGGACATCACAGAAAAGAAGG + Intronic
1145097860 17:20046965-20046987 AGGGGACAAGACTGGGAGGAGGG + Intronic
1145961677 17:28890031-28890053 CAGGGACAACACTGGGGGGCTGG + Intronic
1146004981 17:29155419-29155441 CAGGGTCCACACAGGGCGGCAGG - Intronic
1146400602 17:32497580-32497602 CAGGGACAACAGAGGGCAGGAGG - Intronic
1146464323 17:33074327-33074349 CAGGGCCAACACAGAAGGGAGGG - Intronic
1147187243 17:38719623-38719645 GAGGGACACCCGAGGGAGGAGGG + Intronic
1147911876 17:43860951-43860973 CTTGGACAAGACAGGAAGGAAGG + Intronic
1148389160 17:47257900-47257922 CAAGCACACCACAGTGAGGAGGG + Intronic
1148492537 17:48032603-48032625 CAGGAGAAAAACAGGGAGGAAGG + Intronic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1149576758 17:57719164-57719186 GAGGGACAACTAAGAGAGGAGGG + Intergenic
1150153681 17:62832090-62832112 CTGGAACAACACAGGGGGGTAGG - Intergenic
1151694515 17:75707341-75707363 CAGAGATAACACACAGAGGAAGG - Exonic
1152107244 17:78337800-78337822 GAGGGCCCACACAGGGAGTAGGG - Intergenic
1152700235 17:81814993-81815015 CAGGGACCACACAGCGGGGGTGG + Intergenic
1152812334 17:82387917-82387939 CAGAGACAAGACAGGGGAGAGGG + Intergenic
1152905025 17:82965298-82965320 CTGGGACAACAGAGGGAGAAGGG - Intronic
1153449663 18:5213143-5213165 CAGGGGCATCACAGTGAGAAGGG + Intergenic
1153671239 18:7414533-7414555 CTGGCAGAGCACAGGGAGGAGGG + Intergenic
1154188630 18:12208855-12208877 CAGGGATCACCCAGGGTGGATGG + Intergenic
1154978534 18:21482778-21482800 CAGCGAAAGCACAGGGAGCATGG + Intronic
1155493644 18:26422625-26422647 GTGGGACCTCACAGGGAGGAGGG - Intergenic
1156005112 18:32430954-32430976 CAGGGATATCACAGAGAGAAAGG + Intronic
1156341581 18:36214509-36214531 CAGGGAAGAGACAGGGAGGGTGG - Intronic
1156472597 18:37387198-37387220 CCGGGAAAAGGCAGGGAGGAAGG - Intronic
1156608088 18:38692661-38692683 AAGGGAGAACACAGGAAGAAGGG + Intergenic
1157305697 18:46515863-46515885 CAGGGACAAAATAGGGAAGCTGG - Intronic
1157814623 18:50721830-50721852 GAGGGACAACACAGGGCAGTGGG - Intronic
1157824736 18:50802542-50802564 CAGGTAAACCAGAGGGAGGAGGG + Intronic
1158082893 18:53615422-53615444 CATGGCTAATACAGGGAGGAAGG - Intergenic
1158863926 18:61619353-61619375 GAGAGACAACACAGGGTGGGTGG - Intergenic
1159020010 18:63135685-63135707 CAGGGACAATTGACGGAGGAAGG - Intronic
1160072767 18:75643011-75643033 AAAGGAGAACCCAGGGAGGAGGG + Intergenic
1160778928 19:869212-869234 CGGGGCCCACACAGGGACGAGGG + Intronic
1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG + Intronic
1161021553 19:2013811-2013833 CAGGGAGGACGCAGGGAGCAAGG + Intronic
1161587009 19:5111093-5111115 CGGGGACATGACAGGGAGTATGG - Intronic
1161697207 19:5776079-5776101 CAGGGCCTCCGCAGGGAGGAGGG + Intronic
1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG + Intronic
1161948433 19:7453573-7453595 CAGGGAGATCGCAGGGAAGATGG + Exonic
1162231246 19:9268790-9268812 CGTGCACCACACAGGGAGGACGG - Intergenic
1162345399 19:10115432-10115454 CTGGGACAAGGCAGGGAGCAGGG + Intronic
1163102031 19:15103637-15103659 CAGGGATCTCATAGGGAGGAGGG + Intergenic
1163189771 19:15669246-15669268 CAGGGACAAAAGAAGAAGGAAGG + Intergenic
1163267391 19:16229189-16229211 CAGGGGCATCACAGAGAGGGAGG - Intronic
1163557128 19:17999200-17999222 CTGGGACCACACTGCGAGGAAGG + Exonic
1163635501 19:18435361-18435383 CAGGGACAGCACGGGGTGGAAGG + Exonic
1163648607 19:18504181-18504203 CAGGGACGGCACAGAGAGGCTGG + Intronic
1164100453 19:22050372-22050394 CAGGGACATGACAGAGAAGAAGG + Intergenic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1164611427 19:29635098-29635120 CAGGGACTCCACAGGGGGCAGGG - Intergenic
1165486124 19:36097268-36097290 CAGGGACACAACAGTGAGCAAGG + Intronic
1166773121 19:45296646-45296668 CAAGAACGAAACAGGGAGGATGG + Intronic
1166975744 19:46604121-46604143 CAGGGAAAGAACAGAGAGGAGGG - Intronic
1167428829 19:49442969-49442991 CAGGGGCAAGACTGGGAGGGCGG - Intergenic
1168428303 19:56257310-56257332 CTGGGAGAACAAAGGGAGGCAGG + Intronic
1168518742 19:57031695-57031717 CGGGGGCAGCAGAGGGAGGAAGG - Intergenic
925079660 2:1053972-1053994 CAGGGCCTGCAGAGGGAGGAGGG - Intronic
925185370 2:1843083-1843105 CAGGGAGAGCCCAGCGAGGATGG - Intronic
925191146 2:1884783-1884805 CCAGGACAAGACAGGAAGGAGGG + Intronic
925200608 2:1965246-1965268 CAGGGACCAGGCAGGGAAGAGGG + Intronic
926746338 2:16161435-16161457 CTGGAAATACACAGGGAGGATGG + Intergenic
928189915 2:29154631-29154653 CAGGGAAATCATAGAGAGGAGGG + Intronic
930047642 2:47187236-47187258 CAGGGACTACTCAGGAAGTAGGG + Intergenic
930094935 2:47559861-47559883 CTGGTAGAAAACAGGGAGGAAGG + Intronic
931643874 2:64404408-64404430 CAAGAACAATAAAGGGAGGAGGG - Intergenic
931926441 2:67078087-67078109 CAAAACCAACACAGGGAGGAAGG - Intergenic
932350690 2:71029002-71029024 CAGGGACAGCCCAGCGAGGATGG - Intergenic
933324892 2:80823110-80823132 CAGGGACAACACCAAGACGAAGG + Intergenic
933628830 2:84633427-84633449 AAGGGAGAACAGAGAGAGGAAGG + Intronic
934107220 2:88706500-88706522 CAGTGAGAACACATGGAGGCAGG + Intronic
934590585 2:95546660-95546682 CAGGGACAGCCCAGGGAGGACGG - Intergenic
935114888 2:100127060-100127082 CAGGGACCTCCCAGAGAGGATGG - Intronic
935280320 2:101511735-101511757 TGGGGACTACAGAGGGAGGAGGG + Intergenic
935580347 2:104750739-104750761 CAGGGTGAAGACAGGGAGGTGGG - Intergenic
935794444 2:106627892-106627914 CATGCACAACAGAGGCAGGAAGG - Intergenic
936519455 2:113202451-113202473 CAGGCACCCCACAGGAAGGAAGG - Exonic
937968548 2:127533000-127533022 CAGGGTCCATCCAGGGAGGATGG + Intergenic
938248919 2:129798809-129798831 CAGGGAGGACACAGGGAGTAAGG - Intergenic
938282576 2:130074946-130074968 CAGGGACAGCACAGCCTGGATGG + Exonic
938341917 2:130541475-130541497 CTGAGCCAACACAGGAAGGAGGG + Intronic
938347915 2:130579236-130579258 CTGAGCCAACACAGGAAGGAGGG - Intronic
939117172 2:138073589-138073611 CAGGGACACCAAAGAGAGGGAGG - Intergenic
940316845 2:152335603-152335625 CATGGGCAACGCAGGGAGCATGG + Exonic
940803434 2:158157682-158157704 CAGGGAGAACACTGGGAGTGGGG - Intergenic
941918568 2:170828149-170828171 CGAGGACAGCAGAGGGAGGAGGG - Intronic
941918620 2:170828383-170828405 TGGGGACAGCAGAGGGAGGAGGG - Intronic
941918704 2:170828733-170828755 CGAGGACAGCAGAGGGAGGAGGG - Intronic
941918735 2:170828853-170828875 CAAGGACCGCAGAGGGAGGAAGG - Intronic
943602550 2:189939114-189939136 CAGAGACAAAGCAGGGAGGTGGG + Intronic
944683168 2:202095449-202095471 CACAAACAACCCAGGGAGGAAGG - Intronic
944970305 2:204985189-204985211 GAGGGAAAAAACAGGCAGGAGGG - Intronic
945009400 2:205445497-205445519 CAGGAGCAAGACAGAGAGGAGGG + Intronic
945923227 2:215777722-215777744 CAGGGAGAACACAGTGTGAAGGG - Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946170610 2:217893128-217893150 AAGGGAGAACATAAGGAGGAAGG + Intronic
946372317 2:219288297-219288319 CTGGGACTATACAGGGTGGAGGG + Intergenic
946716224 2:222556942-222556964 CAGGGAGAAGTCAGGGTGGATGG - Intronic
946919637 2:224565388-224565410 CAGGCACAAGAGATGGAGGAGGG + Intronic
947514544 2:230790582-230790604 CAGAAACAAAACAGGGAGAAAGG - Intronic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947765757 2:232636068-232636090 CGGGGACAACGCAGAGAGGAAGG - Intronic
948087714 2:235265480-235265502 CAGGGTGAAGACAGGGAGGCTGG - Intergenic
948351901 2:237347681-237347703 CAGGGATAGCACAGGGTGGAAGG - Intronic
948708296 2:239809471-239809493 CAGCGCCCACACAGGGAGGAGGG - Intergenic
1169719381 20:8657109-8657131 CAGAGAAAAAACAGGGAGGGAGG + Intronic
1170757263 20:19214972-19214994 CGGGGGCAACACAGGGAGGCTGG - Intronic
1170856542 20:20061702-20061724 CATGGGGAACACAGGGAGGCGGG - Intronic
1171299860 20:24050736-24050758 CAGGGACTAATCAAGGAGGATGG + Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172768684 20:37364441-37364463 CAGGGGCCCCACAAGGAGGAGGG - Intronic
1173160945 20:40652346-40652368 CAGGAACAACACAGGTGGTAAGG + Intergenic
1173249008 20:41354766-41354788 CAGGGCCAGCACAGGGCGGGAGG + Intronic
1173274929 20:41572213-41572235 GAGGGACAACGCAGGAAGAAGGG + Intronic
1173341401 20:42155828-42155850 CAGGGACAACAGAGGCAGGTAGG - Intronic
1173576668 20:44116390-44116412 CCAGGGCAACACAGGGAGGCTGG + Intronic
1173609875 20:44359254-44359276 CAAAGACAACGCAGTGAGGAGGG - Intronic
1173707752 20:45124872-45124894 CCGGGGCAGCACAGGAAGGAGGG - Intergenic
1173827865 20:46058726-46058748 CTGGGACAAGTGAGGGAGGAGGG + Intronic
1174102359 20:48137407-48137429 CTGGGACCACAGAGGAAGGAGGG - Intergenic
1174252675 20:49231194-49231216 CAGTGACAATGCAGGCAGGACGG - Intronic
1174393292 20:50231398-50231420 CAGGCAGAACAGTGGGAGGAAGG + Intergenic
1174588222 20:51625107-51625129 CAGGGAGATCACAGGGGGAAAGG - Intronic
1175449346 20:59049565-59049587 CTAGGACTACACAGGGAGGTCGG + Intergenic
1176044514 20:63085418-63085440 CAGGAACAGCAGAGGGAGGGAGG + Intergenic
1176289442 21:5036355-5036377 CGGGGACCTCACAGGCAGGACGG + Intronic
1176866494 21:14057423-14057445 CAGGGCCAGGACAGGCAGGATGG + Intergenic
1178488773 21:33034744-33034766 CACGGAGGACACACGGAGGAGGG - Intergenic
1179066449 21:38029018-38029040 CAGGGAACACACAGAGAGGAAGG + Intronic
1179293671 21:40042076-40042098 CAGGGAGAACACAGCCAGGTCGG + Intronic
1179409781 21:41153798-41153820 CTGGGCCAAGGCAGGGAGGAAGG + Intergenic
1179867788 21:44227232-44227254 CGGGGACCTCACAGGCAGGACGG - Intronic
1180139928 21:45887003-45887025 AAGGGACAGCACAGTGAGGCTGG - Intronic
1180245201 21:46542692-46542714 AAGGGCCATCACAGGGAGGCAGG - Intronic
1180715676 22:17870617-17870639 CAGGGACAGCTCAGCGAGGTTGG + Intronic
1180874835 22:19170309-19170331 CAGGGACCCCAAAGGGAAGATGG - Intergenic
1180965185 22:19784484-19784506 CAGGTAACACGCAGGGAGGAAGG + Exonic
1180980829 22:19877262-19877284 CGGGGTCAGCACAGGGAGGGGGG + Intronic
1181435786 22:22910044-22910066 CTAAGACAACACAAGGAGGACGG + Intergenic
1181484736 22:23223601-23223623 CAGGGGGTACTCAGGGAGGAGGG + Intronic
1181487628 22:23241543-23241565 AAGGGGCAAGACAGGGAAGATGG - Intronic
1181495356 22:23284490-23284512 CTGGGTGAACCCAGGGAGGAGGG - Intronic
1181513888 22:23400852-23400874 CAGGGCAACCACAGGGAGGAGGG + Intergenic
1182094177 22:27614950-27614972 TTGGGACACCACAGGGATGAGGG + Intergenic
1183642996 22:39103629-39103651 GTGGGACACCACAGGGAGGAAGG - Intronic
1184402678 22:44282889-44282911 CTGGGACACCACATGGAGGCTGG + Intronic
1184563418 22:45276612-45276634 CAGGTAAGACACAGGGAGTAGGG - Intergenic
1184652600 22:45925968-45925990 CAGGGACAGGGGAGGGAGGAGGG - Intronic
1185258742 22:49850043-49850065 AAGGGAAACCACAGGCAGGAGGG - Intergenic
1185320981 22:50200237-50200259 AAGGGAAACCACAGGCAGGAGGG + Intergenic
1185359962 22:50400200-50400222 CAAGGGAAACACTGGGAGGAAGG + Intronic
949249936 3:1971851-1971873 TAGGGACAGCTCTGGGAGGATGG + Intergenic
949885296 3:8688265-8688287 CAGGGACAGCCCAGCGAGGACGG - Intronic
949943559 3:9172921-9172943 CAGGGACGCCGCAGGCAGGAAGG + Intronic
949988480 3:9558411-9558433 CATGGACAACACAGAGACCAAGG + Intergenic
950206991 3:11088498-11088520 ACGGGACAACAATGGGAGGATGG - Intergenic
950251848 3:11472238-11472260 CAGGGAAAACCCAGGCAAGAGGG - Intronic
950562592 3:13743385-13743407 CAGGGACTCCAAAAGGAGGAGGG - Intergenic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950677521 3:14563623-14563645 GAGGGAGAAGGCAGGGAGGAGGG + Intergenic
950880872 3:16321783-16321805 CAGGGAAAATTCAGAGAGGATGG - Intronic
951329932 3:21354548-21354570 TAGGTCCAACACAGGGAGAAAGG - Intergenic
951922484 3:27871681-27871703 CTGGGAAGACACAGGGATGAGGG + Intergenic
953064119 3:39453748-39453770 CAGGGAGAAAACAGAGAAGATGG + Intergenic
953262755 3:41356143-41356165 CAGGGAGAACACAGGGGACAGGG - Intronic
953796045 3:45986704-45986726 CAGGGACACCAAACTGAGGATGG + Intronic
953862701 3:46558625-46558647 CAGGGAGATCACAGAGAGGGAGG - Intronic
954160992 3:48722056-48722078 CAGGAACTAGACAGGGATGATGG + Intronic
954453168 3:50582631-50582653 GAGGGCAGACACAGGGAGGAAGG + Exonic
954708890 3:52495333-52495355 CAGGCACAGCACAGGCAGGCGGG - Exonic
955628779 3:60949577-60949599 CAGCGACAGGATAGGGAGGAGGG - Intronic
955843370 3:63135739-63135761 CAGGGACAAAAGAGGGTAGAGGG + Intergenic
956086609 3:65617957-65617979 CAGGCACAAAACAGGCATGAAGG + Intronic
957043679 3:75357358-75357380 CAGGGTCAGCCCAGCGAGGACGG + Intergenic
957164291 3:76651316-76651338 CAGGGACAACAATGGTTGGAAGG - Intronic
959981736 3:112525057-112525079 CAGGGACAGCCCAGCGAGGACGG + Intergenic
961022612 3:123521654-123521676 CAGAGTCACCACAGGGAGGAGGG + Intronic
961272964 3:125703448-125703470 CAGGGACAGCCCAGCAAGGATGG - Intergenic
961810354 3:129518462-129518484 CAGGGGCCACACTGGGAGGAGGG + Intronic
961875776 3:130022429-130022451 CAGGGACAGCAAAGCGAGGACGG + Intergenic
961910261 3:130307603-130307625 CAGGGAGAAGAATGGGAGGAGGG + Intergenic
962266516 3:133948220-133948242 CAGGAACAACACAGGAAAGAGGG - Intronic
962437871 3:135383149-135383171 CAGGGAGAATGCAGGGCGGAAGG + Intergenic
963274939 3:143320541-143320563 CAGGCACAGCACATGGTGGAGGG + Intronic
965277250 3:166701325-166701347 CAGTGACAATAAAGTGAGGATGG + Intergenic
965583004 3:170289471-170289493 CAGGGACAAGAATGGAAGGAAGG + Intronic
965664747 3:171081341-171081363 AAGAGACAACACAGGGATGCTGG - Intronic
965696327 3:171412061-171412083 CAAGGACAACTCAAGTAGGATGG - Intronic
966768999 3:183487172-183487194 CAGAGACAACACAGGAACAATGG + Intergenic
966942637 3:184756608-184756630 CAGGGGCAGCACAGGGAGAACGG - Intergenic
967109008 3:186276720-186276742 CAGGGATAGCACATGCAGGAGGG - Intronic
967183367 3:186925794-186925816 CAGCCACAAGACTGGGAGGATGG - Intergenic
967523973 3:190470903-190470925 CAGAGACAAAGCAGGGAGGTGGG + Intergenic
967529603 3:190533491-190533513 CAGGGGAAGCACAGGGGGGAGGG - Intronic
967828265 3:193896293-193896315 CGGGGAAGACACAGGGAGGAGGG + Intergenic
968551582 4:1226243-1226265 CAGGGACAAGCCAGGGATGAGGG - Intronic
968829521 4:2925663-2925685 CAGGGAGAAGGCAGGGAGGGAGG + Intronic
968836285 4:2966891-2966913 CAGGGACCAGAGAGGGAGGGGGG - Intronic
969058026 4:4414132-4414154 CAGGTTCCCCACAGGGAGGAGGG + Intronic
969108974 4:4829462-4829484 CAGGGAAAATGCAGGGAAGAGGG - Intergenic
969249270 4:5956383-5956405 CAGGGACAACACAAGGCCCAGGG - Intronic
969471303 4:7390957-7390979 CAGTGACCACTCAGGGAGGAGGG + Intronic
969734923 4:8981524-8981546 CAGGGACAGCCCAGCCAGGATGG - Intergenic
969838307 4:9861358-9861380 CAAGGACAGTACAGGGGGGATGG + Intronic
971097396 4:23423419-23423441 CAGGCAGAAGACAGTGAGGATGG + Intergenic
972842451 4:42947307-42947329 CAGGGAAAACTTAGGGACGAGGG + Intronic
973220738 4:47723277-47723299 CAGGGAGATCACAGAGAAGAGGG + Intronic
973647218 4:52961749-52961771 CATGCACAAGACAGGAAGGAGGG + Intronic
974896510 4:67946499-67946521 CAGGGACAACACAATGAGAACGG + Exonic
976623771 4:87156354-87156376 CCTGGACAACACAGAGAGGTGGG + Intergenic
977061177 4:92258499-92258521 CAGGAACAAGAGAGGGAGTAGGG + Intergenic
977287359 4:95125390-95125412 TATGGAAAACACAGGGAAGATGG - Intronic
977591044 4:98827588-98827610 CAAGGACAACAGAGGGCAGAGGG - Intergenic
978445343 4:108775080-108775102 CAGGGACAAGCCAGGAAGAAAGG - Intergenic
981269567 4:142829335-142829357 CAGGTAGATCAGAGGGAGGAGGG + Intronic
982302863 4:153898041-153898063 AAGAGAGAACAGAGGGAGGAGGG - Intergenic
982434415 4:155367269-155367291 CAGAGAAAACACAGGGAAGAAGG + Intronic
984050994 4:174865113-174865135 CATGGAGAACACAAGGAGAAAGG + Intronic
984220913 4:176973404-176973426 CAGGGAAAACACAGGGAAACTGG + Intergenic
984874502 4:184355194-184355216 CAGGGGCAACACAGCGAAGAAGG + Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
986174053 5:5336963-5336985 CATGGGCAGCACAGGGAGGAGGG + Intergenic
986294213 5:6423864-6423886 GAGGAAAAACACAGGAAGGAAGG + Intergenic
986729538 5:10624951-10624973 CAGGGACCCCACATTGAGGATGG + Intronic
988506083 5:31824511-31824533 TAGGGGCTACACTGGGAGGAAGG + Intronic
989100320 5:37817125-37817147 TAGGGAGATCACATGGAGGAAGG + Intronic
991208796 5:64080857-64080879 TAGGGACACCAAAAGGAGGATGG - Intergenic
991452788 5:66770611-66770633 CAGTGACAAGACAGGCATGAGGG + Intronic
991970044 5:72131774-72131796 CAGAGAAGACACTGGGAGGAAGG - Intronic
993560595 5:89402590-89402612 CAGGGGCAACAAAGGGAGACAGG + Intergenic
994057456 5:95434348-95434370 CATGGAAAACACAAGAAGGAAGG - Intronic
995831649 5:116361407-116361429 CAGGGGCAACCCAAGGAGGTGGG + Intronic
996305389 5:122040497-122040519 GAGGGTCAATAAAGGGAGGAGGG + Intronic
997341030 5:133144735-133144757 CTTGGTCAACACAGTGAGGAGGG + Intergenic
997578911 5:135005047-135005069 CCAGGACCACACAGGGAGGAGGG + Intronic
998506617 5:142677633-142677655 AAGGGACAACAGAGGGTAGAAGG + Intronic
999443591 5:151621313-151621335 CAGGGATCTCACAGGAAGGATGG - Intergenic
999843091 5:155449879-155449901 CAGCCACAACAATGGGAGGAAGG - Intergenic
999893192 5:156000917-156000939 CAGGGACCACACTTTGAGGATGG + Intronic
1001298377 5:170515338-170515360 AAGGGAAAAACCAGGGAGGAGGG - Intronic
1002192989 5:177488478-177488500 CAGGGAGGACCCCGGGAGGAAGG + Intronic
1002307829 5:178294153-178294175 TAGGAACAAGACAGTGAGGAGGG - Intronic
1002475316 5:179461883-179461905 CCAGGACATCCCAGGGAGGAGGG - Intergenic
1002950978 6:1810648-1810670 CAGGGAACAGACAGGGAGGAGGG + Intronic
1004945601 6:20609326-20609348 GAGGGAAAAGAGAGGGAGGAGGG - Intronic
1004947834 6:20635342-20635364 CAGGGACTACAAAGGAAGGAAGG - Intronic
1005312355 6:24570723-24570745 AAGGGACATCACAGAGAGGGAGG + Intronic
1005378816 6:25213143-25213165 AAGTGAGAACACATGGAGGAAGG + Intergenic
1005959053 6:30683602-30683624 GAGGGGAAACCCAGGGAGGAAGG + Intronic
1006979014 6:38131644-38131666 AGGGGACAACAGTGGGAGGAAGG - Intronic
1007599161 6:43071228-43071250 CAGGAACAAAACATGGAGGGAGG - Intronic
1007954046 6:45900403-45900425 CAAGAACAACTCAGGGAGCACGG - Exonic
1009938357 6:70260003-70260025 CAAGGCAAAGACAGGGAGGATGG - Intronic
1010657633 6:78530490-78530512 TAGGAACAGCACAGAGAGGATGG - Intergenic
1010813685 6:80329615-80329637 CAGCACCAGCACAGGGAGGAGGG - Intronic
1011629691 6:89311711-89311733 CAGGGCCTGCACAGGGAGGAGGG - Intronic
1011841695 6:91508807-91508829 CAGGGACAAGACAGTGGGGGAGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1013627774 6:111954653-111954675 CAGGGAGCTCACAGAGAGGATGG - Intergenic
1013685994 6:112583771-112583793 CAGGGAAAAAACTGGGAGGTGGG - Intergenic
1014014866 6:116518480-116518502 CAGGGACAGAACAGGGATTAGGG + Exonic
1014165666 6:118221516-118221538 CAAGGACACTGCAGGGAGGAAGG + Intronic
1015695660 6:135977049-135977071 CCTGGTCAACACAGGGAGGGAGG + Intronic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1018425247 6:163674025-163674047 CAAGGACAACACCTAGAGGATGG + Intergenic
1019334897 7:478438-478460 AAGGGAGGACAAAGGGAGGAAGG + Intergenic
1019401877 7:859451-859473 CAGAGGCCACACAGGCAGGAGGG + Intronic
1019485046 7:1285563-1285585 CAGGGACAACTGGGGGAGGAGGG - Intergenic
1019516322 7:1441712-1441734 CCGGGACACCACAGGGGGGACGG + Intronic
1020009186 7:4799287-4799309 CAGTTACAAAACAGGGACGAAGG + Exonic
1020105313 7:5420030-5420052 CAGGGACAGCCCGGGAAGGAGGG + Intronic
1020181449 7:5925603-5925625 CAAGGACACAACAGTGAGGAAGG - Intronic
1020301484 7:6799286-6799308 CAAGGACACAACAGTGAGGAAGG + Intronic
1020440229 7:8209787-8209809 CAGGCACAAAAGAGGGAGAAGGG + Intronic
1020731516 7:11887283-11887305 AAGGGACAACACAGTGTTGAAGG - Intergenic
1020891242 7:13880440-13880462 CAGTGTCAACACAGGCAGGCAGG - Intergenic
1021446149 7:20735768-20735790 AGGGGAAAACACAGAGAGGAAGG + Intronic
1021477655 7:21080718-21080740 CAGGGCCATCCCACGGAGGAAGG + Intergenic
1021505957 7:21385349-21385371 CAGGTATAACAGAGGGAGGCAGG - Intergenic
1022624790 7:32024201-32024223 AAGGGAGGAAACAGGGAGGAAGG + Intronic
1023067292 7:36390247-36390269 CAGATAAAACTCAGGGAGGAAGG + Intronic
1023539548 7:41250877-41250899 CAGGGACAGCACAGGGTGGGAGG + Intergenic
1023738913 7:43260400-43260422 TAGGTGCAACACAGGGAGCAAGG + Intronic
1024242785 7:47448236-47448258 GAGGGGGAGCACAGGGAGGAGGG + Intronic
1024251327 7:47507846-47507868 CAGGGACAGCTGTGGGAGGAGGG + Intronic
1024575941 7:50764186-50764208 CAGGGACAGGACAGGGTGGATGG - Intronic
1024626873 7:51215428-51215450 CAGAAACATCACAGGGAGGTTGG + Intronic
1024752456 7:52483501-52483523 CAGGGACAACAAAGGCCGGCAGG + Intergenic
1024876514 7:54030330-54030352 GAGGGAAAAAAAAGGGAGGAAGG + Intergenic
1029551616 7:101239740-101239762 CAGGGAAAGGACAGCGAGGATGG + Exonic
1029875047 7:103741676-103741698 AAGGGAAAAGACAGGGAGGGAGG + Intronic
1031371850 7:120977704-120977726 CTGGGAGAACACTGGGAGGCAGG + Intergenic
1033176831 7:139132518-139132540 CAGTCACATCCCAGGGAGGAGGG - Intergenic
1033307914 7:140238648-140238670 CAGGAACCCCACAGGAAGGAAGG - Intergenic
1033969772 7:147025325-147025347 CAGGGAGAAGAAAGGGGGGAGGG + Intronic
1034495992 7:151422739-151422761 CAGGTACAACACACTGAGGCAGG - Intergenic
1034960535 7:155361757-155361779 CAGAGACAGCCCACGGAGGAAGG + Intronic
1035046725 7:155972737-155972759 CAGGGAAGAGACAGGGAGGAAGG + Intergenic
1035100069 7:156389244-156389266 CAGGGACACCAGCTGGAGGAAGG - Intergenic
1035189343 7:157152197-157152219 CAGGGACAGAGCTGGGAGGAAGG + Intronic
1035389196 7:158494477-158494499 CAGGAACCAAAGAGGGAGGAGGG + Intronic
1035417485 7:158702524-158702546 CTGGAAAAACACAGGCAGGATGG - Intronic
1035553187 8:545134-545156 CGGGGACCACACTGGGAGGAGGG - Intronic
1036905325 8:12703915-12703937 CAGGGACAGCCCAGCGAGGATGG + Intergenic
1037109898 8:15153664-15153686 CAGGGACAAGAGAGAGAGGGTGG - Intronic
1038680546 8:29663364-29663386 AAGGGGCAACACTGGGCGGAGGG - Intergenic
1039444729 8:37621958-37621980 TGGGGACAACACAGAGGGGAAGG - Intergenic
1039447785 8:37646474-37646496 CAGGGGCAAGAGAGAGAGGAGGG + Intergenic
1039893399 8:41699369-41699391 CAGGGATTCCAGAGGGAGGAAGG - Intronic
1040001634 8:42581972-42581994 CTGAGACAAAACAGGGAGCAAGG - Intergenic
1040435043 8:47381913-47381935 CTGGTAGAACAAAGGGAGGATGG - Intronic
1041197728 8:55418023-55418045 CAGAAACAACACAGTGAGGGTGG + Intronic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1042624845 8:70746909-70746931 AAGGGAGAAGACAGGGAGGAGGG - Intronic
1044403946 8:91805159-91805181 CAGAGACAACATACGGAGAAGGG + Intergenic
1044927732 8:97223809-97223831 CAGGTTTAACACAGGGAAGAGGG - Intergenic
1046732053 8:117736479-117736501 AAGGGACAAAAGAGGGAAGATGG + Intergenic
1046893765 8:119450809-119450831 CAGGGAGAATACATGGAGCAAGG - Intergenic
1046929699 8:119829720-119829742 CAGGGACAACACAGGTGGAAGGG + Intronic
1047023338 8:120800539-120800561 CAAGGACAGCCCAAGGAGGATGG + Intronic
1047164419 8:122421200-122421222 CAGGGAGGACAGAGGGGGGAAGG + Intergenic
1048215084 8:132486769-132486791 CAGGGAGACCACAGTCAGGATGG - Intergenic
1049029563 8:140024303-140024325 CTGGGACATCACAGGAAAGATGG - Intronic
1049472350 8:142782151-142782173 CAGGGACAACGAAGGCAGCATGG - Intergenic
1049620184 8:143594627-143594649 CAGGGAGAAGTCAGGGAGGTGGG + Intronic
1050290161 9:4145730-4145752 GAGGGGGAACAAAGGGAGGAGGG - Intronic
1050561076 9:6834858-6834880 CAGGGACAGCACGGGCTGGATGG - Intronic
1052502984 9:29316826-29316848 CAGGGACAAGAGATGGAGCAGGG + Intergenic
1052771631 9:32695738-32695760 CAGGGACAACACAGCCAAAATGG + Intergenic
1052972093 9:34382813-34382835 CTGGTACAACACATGGAGGATGG - Exonic
1053055572 9:34991458-34991480 CAGGGACACCAAAAGGAGGTGGG + Intronic
1053152845 9:35753941-35753963 CAGAGAGGGCACAGGGAGGATGG - Exonic
1055110836 9:72557671-72557693 CAGGGACAGCAGTGGGAGTAGGG + Intronic
1055659213 9:78485352-78485374 CAGGGAGAAAACAGGAGGGAAGG - Intergenic
1056762350 9:89424627-89424649 CAGGCAGGACACAGTGAGGAAGG - Intronic
1058670663 9:107358182-107358204 CACAGAAAACACAGGAAGGAAGG - Intergenic
1058935821 9:109768198-109768220 CAGGGAGAAAAAAGGAAGGAAGG + Intronic
1059432627 9:114259201-114259223 CAGGGTCAAAAGAGGGACGAGGG + Intronic
1059466255 9:114470627-114470649 CAGGGACAGAACAGAGAGGCTGG + Intronic
1060197993 9:121635607-121635629 CAGGGCAACCACAGGAAGGAGGG + Intronic
1061219640 9:129242767-129242789 CAAGGACAGCTGAGGGAGGATGG + Intergenic
1061848797 9:133402807-133402829 CAAGGACAACAGAGGCAGGAAGG + Intronic
1062095005 9:134698606-134698628 CAGGTACAACACTGGGAGGAAGG - Intronic
1062349661 9:136132734-136132756 CAGGAGCCGCACAGGGAGGATGG - Intergenic
1203747834 Un_GL000218v1:53457-53479 CAGGGACTACACTGGGAAAAGGG - Intergenic
1185727452 X:2433598-2433620 CAGTGAGAACACAGGGACGCAGG - Intronic
1186217732 X:7317822-7317844 CAGAGAGAACACAGTGAAGAGGG - Intronic
1186274937 X:7928334-7928356 CTTAGACAAAACAGGGAGGAGGG + Intergenic
1187854415 X:23623215-23623237 GAGGGACAACGAGGGGAGGAGGG - Intergenic
1188809303 X:34633250-34633272 CAGACAGAACACAGGGATGAGGG + Intronic
1188849296 X:35111949-35111971 TGGGGACAACATAGGGAGAAGGG + Intergenic
1189252248 X:39610375-39610397 CAGGGACAACAAAAGAAGTAGGG - Intergenic
1190594067 X:52035509-52035531 CAGGGACAACACTGGGAGTGGGG - Intergenic
1195152073 X:102082252-102082274 CAGGGACAAGATAGGGAGTGGGG - Intergenic
1197326915 X:125105691-125105713 CAGTGACAGCACAGAAAGGATGG + Intergenic
1198321575 X:135522289-135522311 CAGGGACAAGAAAGAAAGGAAGG + Intronic
1200009598 X:153111227-153111249 CAGGCACAACACAGAGATGAAGG - Intergenic
1200030002 X:153288695-153288717 CAGGCACAACACAGAGATGAAGG + Intergenic
1200301788 X:154983840-154983862 CAGAGACAAATGAGGGAGGAAGG - Intronic