ID: 1161738636

View in Genome Browser
Species Human (GRCh38)
Location 19:6007014-6007036
Sequence GGGACCGGCCTCAGCACGTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 60}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161738629_1161738636 4 Left 1161738629 19:6006987-6007009 CCGGGCGGGGCCGTGGGTCACTT 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1161738636 19:6007014-6007036 GGGACCGGCCTCAGCACGTCGGG 0: 1
1: 0
2: 1
3: 2
4: 60
1161738633_1161738636 -6 Left 1161738633 19:6006997-6007019 CCGTGGGTCACTTACTGGGGACC 0: 1
1: 0
2: 0
3: 18
4: 104
Right 1161738636 19:6007014-6007036 GGGACCGGCCTCAGCACGTCGGG 0: 1
1: 0
2: 1
3: 2
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161738636 Original CRISPR GGGACCGGCCTCAGCACGTC GGG Exonic
900129127 1:1080216-1080238 AGGGGCGGCCCCAGCACGTCAGG - Intergenic
900202968 1:1419571-1419593 GGGGCCGGCCTCAGCCCGGTAGG + Intronic
900575852 1:3382147-3382169 GGGAGGGGCCTCACCACGTGGGG + Intronic
907324316 1:53626999-53627021 GGTAAGGGCCTCGGCACGTCAGG - Intronic
923107875 1:230868438-230868460 GGAACCGGCCTCTGGACGACCGG - Exonic
1073447874 10:103591954-103591976 AGGACCGACCTCAGCAGGTGGGG - Exonic
1074713739 10:116199292-116199314 GGGTCCGGCTGCAGCGCGTCAGG - Intronic
1081998256 11:47378103-47378125 GGGCCTGGCCTCAGCCCGCCAGG + Intronic
1089966045 11:122655812-122655834 GGGACCAGCCTCAGCCACTCGGG - Exonic
1090635911 11:128690417-128690439 GGGACCAGGCTCAGATCGTCAGG + Intronic
1091837057 12:3593425-3593447 GGGCCCAGCCACAGCACGCCAGG - Exonic
1092462499 12:8698416-8698438 GGGACCGGCCCGAGCGCGCCCGG + Intronic
1103126171 12:118424325-118424347 GGGACCTGCCTGAGCAGGTGGGG - Intergenic
1108708963 13:53015018-53015040 GGGCCCTGCCTCAGCCCGGCAGG + Intergenic
1112509657 13:99997964-99997986 GGGTCCGGCCTCCCCAGGTCCGG + Intergenic
1120780027 14:88479017-88479039 GAGTCCGACCTCACCACGTCAGG - Exonic
1122718375 14:103708405-103708427 GGGACCAGCCTCAGGGCGTGTGG - Intronic
1202918321 14_KI270723v1_random:5824-5846 GGGAACGGCCGGAGCACTTCTGG + Intergenic
1202926308 14_KI270724v1_random:28753-28775 GGGAACGGCCGGAGCACTTCTGG - Intergenic
1132592415 16:731713-731735 GGGAGGGGCCTCAGCACAGCTGG + Intronic
1132870250 16:2112601-2112623 GGGAGAGGCCTCAGCACAGCCGG - Intronic
1132906588 16:2285669-2285691 GGGACGGAGCACAGCACGTCTGG + Intronic
1134522289 16:14924334-14924356 GGGAGAGGCCTCAGCACAGCCGG + Intronic
1134709959 16:16322985-16323007 GGGAGAGGCCTCAGCACAGCCGG + Intergenic
1134717174 16:16362985-16363007 GGGAGAGGCCTCAGCACAGCCGG + Intergenic
1134949644 16:18345660-18345682 GGGAGAGGCCTCAGCACAGCCGG - Intergenic
1134957578 16:18389174-18389196 GGGAGAGGCCTCAGCACAGCCGG - Intergenic
1139470680 16:67176598-67176620 GGGACCTGCAGCAGCATGTCTGG - Exonic
1139967764 16:70755155-70755177 GCCACCGGCCTCAGCGCTTCTGG + Intronic
1140067877 16:71626058-71626080 GGGGGCGGCCTGAGCGCGTCTGG - Intergenic
1141777406 16:86133659-86133681 GGGACCGGGCTCATCACGCAGGG - Intergenic
1142172948 16:88632332-88632354 GGGGCCTGGCTCAGCAGGTCTGG - Intergenic
1142282200 16:89154478-89154500 GGGAGGTGCCTCAGCACGTGGGG - Exonic
1148279113 17:46333751-46333773 GGGACCAGGCTCAGCAGGGCTGG - Intronic
1148365455 17:47052498-47052520 GGGACTAGGCTCAGCACGGCTGG - Intergenic
1148779275 17:50112482-50112504 GGGCCCGGCCTCAGGGCCTCTGG + Intronic
1153202014 18:2656197-2656219 GGGACCGGCCTCTGCAGGTCGGG + Exonic
1155054031 18:22169817-22169839 GGGAGCCGCCTCAGCCCGCCCGG - Intronic
1161738636 19:6007014-6007036 GGGACCGGCCTCAGCACGTCGGG + Exonic
1162932775 19:13965628-13965650 GGGATGGGCCGCAGCACGTCGGG + Exonic
1166296475 19:41892498-41892520 GGCAGCGGCCTCAGGACGTGTGG + Intronic
1167466719 19:49654061-49654083 GGGACTGGCCACAGCGGGTCAGG + Intronic
925369649 2:3335434-3335456 AGGACCAGCCTCAGCACAACAGG - Intronic
929947425 2:46381624-46381646 ATGGCCGGACTCAGCACGTCTGG - Exonic
933596788 2:84290653-84290675 GGAAGCGGTCGCAGCACGTCAGG + Intergenic
946231132 2:218291981-218292003 GAGACTGGCCTCAGCGCGTGTGG + Intronic
1179542111 21:42089889-42089911 TGGGCCAGCCTCAGAACGTCAGG + Intronic
1179909254 21:44439241-44439263 GGGACCTGCCCCAGCACCACTGG + Intronic
1184640484 22:45867618-45867640 GGGAACGGCCTGAACGCGTCCGG + Intergenic
953347500 3:42188460-42188482 AGGACCTGCCACAGCACCTCTGG - Intronic
961742429 3:129041019-129041041 GGGACCGGCCCCAGGACCCCTGG + Intergenic
983939817 4:173527298-173527320 CGGGCTGGCCGCAGCACGTCTGG - Exonic
985561021 5:585816-585838 GGGCGCAGCCTCAGCACCTCTGG - Intergenic
1008485033 6:52026157-52026179 GGGACCATCCTCAGCATCTCAGG - Exonic
1019298307 7:290464-290486 GGGAGGGGCCTCCGCAGGTCGGG + Intergenic
1020013080 7:4816864-4816886 GGGACCGGCGGCAGCACCTCTGG + Intronic
1032168134 7:129561931-129561953 GGGAAAGGCCTCAGCATGTGAGG - Intergenic
1036781553 8:11651324-11651346 GGGAACAGCCCCAGCAAGTCTGG + Intergenic
1048963565 8:139599187-139599209 GGAACTGGCCTCAGCAAGTGAGG - Intergenic
1049562590 8:143319161-143319183 GGGCCCGGCCTCAGGCAGTCTGG - Intronic
1054076960 9:60546026-60546048 CAGCCCGGCCTCAGCAAGTCAGG + Intergenic
1057297566 9:93858417-93858439 AGAACCGGCCTTAGCACATCTGG - Intergenic
1057302929 9:93896842-93896864 GGCACCAGCCTCAGCAGGCCGGG + Intergenic
1186428328 X:9483091-9483113 GGGACCTTCCTCTGCACTTCAGG - Intronic