ID: 1161740488

View in Genome Browser
Species Human (GRCh38)
Location 19:6018264-6018286
Sequence CATAAAAAGGAGATGAAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 672
Summary {0: 1, 1: 1, 2: 4, 3: 64, 4: 602}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161740488_1161740493 -7 Left 1161740488 19:6018264-6018286 CCGGCCTTCATCTCCTTTTTATG 0: 1
1: 1
2: 4
3: 64
4: 602
Right 1161740493 19:6018280-6018302 TTTTATGAAATAGTGCTATGGGG 0: 1
1: 0
2: 0
3: 22
4: 330
1161740488_1161740491 -9 Left 1161740488 19:6018264-6018286 CCGGCCTTCATCTCCTTTTTATG 0: 1
1: 1
2: 4
3: 64
4: 602
Right 1161740491 19:6018278-6018300 CTTTTTATGAAATAGTGCTATGG 0: 1
1: 0
2: 0
3: 23
4: 264
1161740488_1161740492 -8 Left 1161740488 19:6018264-6018286 CCGGCCTTCATCTCCTTTTTATG 0: 1
1: 1
2: 4
3: 64
4: 602
Right 1161740492 19:6018279-6018301 TTTTTATGAAATAGTGCTATGGG 0: 1
1: 0
2: 2
3: 23
4: 362
1161740488_1161740494 -4 Left 1161740488 19:6018264-6018286 CCGGCCTTCATCTCCTTTTTATG 0: 1
1: 1
2: 4
3: 64
4: 602
Right 1161740494 19:6018283-6018305 TATGAAATAGTGCTATGGGGTGG 0: 1
1: 0
2: 0
3: 11
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161740488 Original CRISPR CATAAAAAGGAGATGAAGGC CGG (reversed) Intronic
900239386 1:1607633-1607655 CTTAAGAAGGAAATCAAGGCCGG - Intergenic
901832957 1:11905176-11905198 CATAAAAAGGAGAGAAATTCTGG - Intergenic
901875574 1:12165371-12165393 CCTAAAATAGAGCTGAAGGCAGG - Intergenic
902315421 1:15615122-15615144 AATAAAAAGGAAATCAAGCCTGG + Intergenic
902831623 1:19017551-19017573 CATAAAAAGAAGAAGAGGCCGGG + Intergenic
904062263 1:27720981-27721003 TATAAAAAAGACATGAGGGCTGG - Intergenic
904547035 1:31283115-31283137 CATGGCAAGGAGTTGAAGGCAGG + Intronic
905932963 1:41802549-41802571 AATAAAAAGGTGATGGAGGGTGG + Intronic
906111710 1:43328104-43328126 CAAGAAAAGGGAATGAAGGCTGG + Intergenic
907513225 1:54977877-54977899 AAAAAAAAGAAGAAGAAGGCAGG + Intergenic
908403159 1:63789660-63789682 AAAAAAAAGGAGAGGAAGGATGG - Intronic
910480544 1:87653938-87653960 AATAAAAAGAAAAAGAAGGCTGG + Intergenic
911034473 1:93526318-93526340 GATGAAAAGGAGATGGAGCCTGG - Intronic
911318768 1:96386924-96386946 CATATAAAGGAGGTGACGGTGGG - Intergenic
912262446 1:108122721-108122743 GATAAGGAGGGGATGAAGGCTGG - Intergenic
912811875 1:112801181-112801203 CATAAAAAAGAGGTGAGGGCCGG + Intergenic
912923063 1:113887793-113887815 CATAAACAGAAGTTGAACGCTGG - Intergenic
914703824 1:150155631-150155653 CACAGAAAGAAGATCAAGGCAGG - Intronic
915144322 1:153786236-153786258 CATAAAAAAGGAATGAAGCCAGG - Intergenic
915319238 1:155047201-155047223 CATAAACTGGAGGTGAAGGTCGG + Exonic
915376744 1:155402885-155402907 CATAAAAAGACATTGAAGGCCGG + Intronic
915594644 1:156889224-156889246 CAGGTAAAGGAGATGAAGGCAGG - Intergenic
915884739 1:159710564-159710586 AATAGAAAGGAGGTGAAAGCGGG - Intergenic
917820795 1:178761805-178761827 TAAAAACAGGAGGTGAAGGCGGG - Intronic
918270089 1:182889890-182889912 CTAAGAAAGGAAATGAAGGCGGG - Intergenic
918560119 1:185855414-185855436 AATAAAAAGAAGAAGCAGGCAGG - Intronic
918665615 1:187146835-187146857 GAAAAAAAGGAAATGAAGGAAGG - Intergenic
918901066 1:190418343-190418365 CATAAAAAGAATAAGAAGGCTGG - Intronic
919046810 1:192463135-192463157 GATAGAACGGAGATGAAGGCCGG + Intergenic
919225774 1:194698910-194698932 AAAAAAAAGGAAATGAAGGACGG + Intergenic
920145904 1:203861048-203861070 CAGAAAATGGAGATACAGGCCGG + Intergenic
920222064 1:204411401-204411423 AAGAAAAAGGAGATGGAGCCGGG - Exonic
921407251 1:214793995-214794017 CCAAAAGAGGAGAGGAAGGCAGG - Intergenic
922553549 1:226515688-226515710 TATAAAAAGGAAATGAGGCCAGG - Intergenic
922990060 1:229900036-229900058 CATAACAATGAGAAAAAGGCAGG + Intergenic
923245841 1:232131193-232131215 CAAAAAAAGGGGATGCAGGCAGG - Intergenic
923432944 1:233941166-233941188 TACAAAAATGAGAGGAAGGCAGG - Intronic
923881033 1:238104419-238104441 GATAAAAAGAAAATGGAGGCTGG - Intergenic
924098938 1:240583896-240583918 AATAAAATAGAGATGAAGGCTGG - Intronic
924215966 1:241822884-241822906 CATAGAATGGAGAAGAAGGATGG - Intergenic
924817709 1:247457153-247457175 CATAAAAAGGCGATGACGTGTGG - Intergenic
924837816 1:247672152-247672174 CAGAATAGGGAGATGCAGGCAGG - Exonic
1063058634 10:2528124-2528146 CACTAAAAGGAAATGAAGACAGG - Intergenic
1063654539 10:7974777-7974799 TTTAAAAGTGAGATGAAGGCCGG + Intronic
1063656988 10:8000411-8000433 CATAAAAAAAAGAAAAAGGCCGG - Intronic
1063706568 10:8436575-8436597 CAAAAAATGGAGAGGAAAGCAGG - Intergenic
1064587151 10:16850767-16850789 CATTAAAAGTAAATAAAGGCTGG - Intronic
1064647088 10:17470863-17470885 CATAAAACTAAGATCAAGGCCGG + Intergenic
1064662408 10:17618753-17618775 AAAAAAAAGGAAAGGAAGGCTGG + Intergenic
1064725471 10:18275012-18275034 ACAAAAAAGGAGATGAAAGCTGG + Intronic
1064738038 10:18403179-18403201 CATAAATAGCAGATGCAGGGAGG + Intronic
1064937109 10:20690117-20690139 AATAAAAATGAAATGAAGACTGG + Intergenic
1065435287 10:25699168-25699190 CAGAAGTAGGAGATGAAGTCAGG + Intergenic
1065483744 10:26217399-26217421 CAGATAAAGGAAATGAGGGCTGG + Intronic
1066007554 10:31159458-31159480 CTTAAGAAAGAGATGGAGGCAGG + Intergenic
1066400916 10:35074781-35074803 TCTTAAAAGCAGATGAAGGCCGG - Intronic
1067105975 10:43366640-43366662 CATAAAAAGCACAGCAAGGCTGG + Intergenic
1067411405 10:46068040-46068062 TAGAAAAAGGATATGAAGGAGGG + Intergenic
1067467252 10:46510433-46510455 CATAAAAAGGGATTGATGGCTGG - Intergenic
1067619934 10:47874172-47874194 CATAAAAAGGGATTGATGGCTGG + Intergenic
1067682211 10:48448331-48448353 GTTAAAAGGGAGATGAAGGAGGG - Intronic
1067853485 10:49769930-49769952 AAAAAAAAGGAAATGAAGGGAGG + Intergenic
1068972023 10:62969023-62969045 GATCCAAAAGAGATGAAGGCAGG - Intergenic
1069226045 10:65945642-65945664 GATAAAAGGGAGATGCAGGATGG + Intronic
1070307744 10:75249690-75249712 CAAGAAAAGGAGAGGAAGGCTGG - Intergenic
1070326353 10:75391927-75391949 CATAAAGAGAATATGATGGCAGG + Intergenic
1070466369 10:76727658-76727680 CAAAAAGAGGAGATTTAGGCTGG - Intergenic
1072063222 10:91838208-91838230 GATAAAGAGGAGATGAAGTTGGG + Intronic
1072234293 10:93439768-93439790 TATAAAAAGCATATGAAGACAGG + Intronic
1072238225 10:93471590-93471612 CCTAAAAACGAAATGAAGGCGGG + Intronic
1072313789 10:94182250-94182272 AATAAAAAAGAAATGAAGGCAGG - Intronic
1072525894 10:96271307-96271329 GAAAAAAAGGAGATGAAGAAGGG + Intronic
1072765884 10:98094965-98094987 AATTAAAAGGAAAGGAAGGCAGG + Intergenic
1072946613 10:99816260-99816282 CAAAAAACAGAGATGGAGGCCGG - Intronic
1073020198 10:100437080-100437102 GAAAAATAGGAGGTGAAGGCCGG + Intergenic
1073402581 10:103270948-103270970 AAAAAAAGGAAGATGAAGGCTGG - Intergenic
1073447171 10:103588648-103588670 GTTAAAAAGGAGAGGAAGGCCGG + Intronic
1074222687 10:111453789-111453811 CAGTAAAAGGGGATGAAGACTGG - Intergenic
1074932948 10:118147676-118147698 GATAGAAAGGAGAACAAGGCAGG - Intergenic
1074957833 10:118410028-118410050 CTTACATAGGAGATAAAGGCAGG + Intergenic
1074959337 10:118426331-118426353 AATAAAAAGGAGTAGAAGGTAGG - Intergenic
1075106867 10:119544971-119544993 CAAAAAAAGGAAAAAAAGGCCGG + Intergenic
1075145758 10:119881743-119881765 CATAAAAAGCAGACGAACACAGG - Intronic
1075165620 10:120065584-120065606 TATAAAAATGAGATGATGGCTGG - Intergenic
1075700533 10:124466751-124466773 CTTAAAAATGATATGCAGGCTGG - Intronic
1076463509 10:130662397-130662419 CATAAGAAAAAGCTGAAGGCTGG - Intergenic
1077092281 11:784574-784596 CATAAAAAGGAAGGGAAGGTTGG + Intergenic
1077256160 11:1584347-1584369 CAGGAAAAGGAGGTAAAGGCTGG + Exonic
1077996512 11:7457074-7457096 TATAAGGAGGAGATGGAGGCAGG - Intronic
1078252886 11:9631696-9631718 CATAAAAAGGAAATACAGGCCGG - Intergenic
1078792773 11:14561158-14561180 AATAAAAAGAAGAGGAAGGTTGG + Intronic
1079981118 11:27152392-27152414 AACCAAAAGGATATGAAGGCTGG + Intergenic
1080103420 11:28485923-28485945 TATAAAAAGAAGAGGAAGACAGG - Intergenic
1080775764 11:35385213-35385235 CATAAAAAGGAGGGGAGGGCAGG - Intronic
1081947631 11:47012257-47012279 CAAAAAAAGGAAATAAAGGAGGG + Intronic
1082020231 11:47526771-47526793 CATCAAAAGGAGTTCCAGGCCGG + Intronic
1082939337 11:58687480-58687502 ATTAAAAATGGGATGAAGGCTGG - Intronic
1083233923 11:61339969-61339991 AATAAAAAAAAGAGGAAGGCAGG - Intronic
1083373793 11:62203401-62203423 CAGAAACAGGATATGAAGCCAGG - Intergenic
1083545895 11:63549110-63549132 GATTAAAAGTAGCTGAAGGCTGG + Intergenic
1084048327 11:66583898-66583920 TTTAAAATGGAGATGGAGGCCGG - Intergenic
1084535569 11:69754333-69754355 CATAAAAAGGAAAGAAGGGCTGG - Intergenic
1085235672 11:75013418-75013440 CAGAAAGAGGGGAGGAAGGCAGG + Intronic
1086120395 11:83299565-83299587 CATGGAAAGGAGGTGAGGGCAGG + Intergenic
1086384726 11:86295487-86295509 GAGAAAAAGAAGATGAAGACAGG + Intergenic
1086560520 11:88163088-88163110 CATAAAAAGCAGTACAAGGCAGG - Intronic
1087278721 11:96186291-96186313 TATAAAAGTGGGATGAAGGCCGG + Intronic
1087687965 11:101286577-101286599 GATAAAAAGGTGATGAAGAGAGG - Intergenic
1087903381 11:103667861-103667883 CAAAAAAAGGAAAGTAAGGCTGG - Intergenic
1089602967 11:119626503-119626525 CTTCAAAAGGAGATCAAAGCTGG - Intronic
1089895918 11:121929879-121929901 CTTAAGAAGGAGGGGAAGGCGGG + Intergenic
1090641737 11:128735102-128735124 AATAAACTGGAGAAGAAGGCAGG - Intronic
1091107814 11:132939192-132939214 CATAAGAAGGAGCTGAAGGTAGG + Intronic
1091117240 11:133024845-133024867 CATAGAAGGGACATGAAAGCAGG - Intronic
1091537589 12:1427078-1427100 CACAAAGAGCAGATGAAAGCAGG - Intronic
1092764654 12:11841784-11841806 GTTAAGAAGGAGATGTAGGCCGG + Intronic
1092764713 12:11842100-11842122 AAGAAGAAGGAGATGTAGGCTGG + Intronic
1092880428 12:12883879-12883901 GATAAAAACAAGATGGAGGCAGG + Intergenic
1092961462 12:13600258-13600280 CACAAAAATGAAATGAAGGAAGG - Intronic
1093461101 12:19407596-19407618 AAGAAAAAAGAGATGGAGGCTGG - Intronic
1094397066 12:30019052-30019074 CAGAAAAAGGAGATGAAAGGAGG + Intergenic
1094478883 12:30864246-30864268 CAGAAAAAGAAGCTGAGGGCAGG - Intergenic
1095351717 12:41221552-41221574 CACAAAAAGGAAATGAACTCAGG + Intronic
1095703367 12:45213783-45213805 CATAAAAATGAGAACAAGGCCGG + Intergenic
1096378168 12:51131825-51131847 CAGAAAAAGGAGAGGAAAGAAGG - Intronic
1096758015 12:53816262-53816284 CATGAAAAGGAGAGGGAGGTAGG - Intergenic
1097564335 12:61249859-61249881 CATAGGAAGAAGATGTAGGCTGG + Intergenic
1097601050 12:61694216-61694238 CATTGAAAGGTGAGGAAGGCAGG - Intergenic
1099182924 12:79488280-79488302 CTTAAAAAGTAGAAGGAGGCCGG + Intergenic
1099205395 12:79720993-79721015 CTTAAAAAGGAGGTAGAGGCCGG - Intergenic
1099585398 12:84507294-84507316 CATAGGACAGAGATGAAGGCTGG - Intergenic
1100312096 12:93405621-93405643 GATAAAATGGAGATGAGTGCAGG + Exonic
1100455973 12:94752136-94752158 AAGAAAAAGGAAAGGAAGGCCGG - Intergenic
1100614980 12:96224029-96224051 AATACAAATGAGATGCAGGCAGG + Intronic
1101358332 12:104002253-104002275 CATGAAAAGGTGTTGTAGGCTGG - Intronic
1101614622 12:106324415-106324437 GCTGAAAAGGAGATAAAGGCAGG + Intronic
1102275749 12:111580752-111580774 AATAAAAAGGAGAGAAAGGAAGG + Intronic
1102459569 12:113091953-113091975 CATAAACAGGTGCTGAAGTCAGG + Intronic
1102633214 12:114300170-114300192 CAGAAAAAGGATATCTAGGCTGG - Intergenic
1102688563 12:114742695-114742717 CAGAAAAGAGAGATGGAGGCAGG + Intergenic
1102808078 12:115799650-115799672 CAAAAAAAGAAGAAGAAGGGGGG + Intergenic
1103259888 12:119577639-119577661 GATCAAAAGGAGATGAATGAAGG + Intergenic
1103307106 12:119973893-119973915 AAAAAAAAAGAGATGAAGGAAGG + Intergenic
1103365496 12:120379747-120379769 CATTAAAAAGACATAAAGGCCGG - Intergenic
1103510285 12:121468895-121468917 CAAAAAAAGGAGAGTAAGGAAGG - Intronic
1103552315 12:121746656-121746678 TAGAAAAATGAGAAGAAGGCCGG + Intronic
1104024977 12:125019152-125019174 GCTAAAAAGGAGTAGAAGGCCGG - Intronic
1105425445 13:20291024-20291046 CATAAAGAGGAGAGGCAGGGAGG - Intergenic
1105586048 13:21743733-21743755 CATATGGAGGAGATGAAGTCAGG - Intergenic
1105983809 13:25545929-25545951 CATAAAAAACAGAAGTAGGCTGG - Intronic
1106048782 13:26170432-26170454 CACAAAACGGAAATGATGGCAGG - Intronic
1106133080 13:26955256-26955278 CATTAAAGGGAGATGAATGGAGG + Intergenic
1106927113 13:34624366-34624388 CACTAAAAGGAGAAGAAGACGGG + Intergenic
1107806875 13:44161532-44161554 CATAATCAGGAGAAGAATGCTGG - Intergenic
1108520515 13:51243321-51243343 TGAAAAAAAGAGATGAAGGCAGG + Intronic
1108568683 13:51728281-51728303 CCTGAAAAGGATATGAAGGAAGG - Intronic
1108730662 13:53232127-53232149 CATAAAGAGAAGAAGGAGGCGGG + Intergenic
1108749446 13:53432577-53432599 TATAAAGATGAGAGGAAGGCTGG + Intergenic
1108834401 13:54523293-54523315 GAGAAAAGGGAGAGGAAGGCAGG - Intergenic
1109795320 13:67304545-67304567 TATCTAAAGGAGAGGAAGGCAGG + Intergenic
1110609154 13:77469840-77469862 CATAAAAAGGGGATCAAGGCTGG - Intergenic
1111181012 13:84665106-84665128 GATAACAAGGAGAAGAAGACAGG + Intergenic
1111381572 13:87460411-87460433 GATAAAAAGTAGCTGAACGCAGG - Intergenic
1111449871 13:88400911-88400933 TATAAAAAGAAGATTCAGGCTGG - Intergenic
1111457231 13:88500534-88500556 CATAAAAAGGAAATGATTCCTGG - Intergenic
1112142501 13:96660957-96660979 CACAAAAGAAAGATGAAGGCTGG - Intronic
1112579876 13:100669459-100669481 CATACAAAGGAAAGGAAGGGAGG + Intronic
1113929802 13:113962105-113962127 ATTAAAAAAGAGATGGAGGCTGG + Intergenic
1114737774 14:25060173-25060195 CAGAAAAAGTAGATGAAGGGTGG + Intergenic
1114761782 14:25323959-25323981 TACAAAAAAGAGATGAAGGGTGG + Intergenic
1115475334 14:33807999-33808021 CATAAGAAGGAAATGAAAGTAGG + Intergenic
1116141195 14:40996237-40996259 CATAAAAATTAGATGAAGTGTGG - Intergenic
1117388365 14:55239159-55239181 CATAAAAAGGAGATCCAGGCCGG - Intergenic
1117981587 14:61347402-61347424 CAGAGAAAGCAGATGAAGGCAGG - Intronic
1118245287 14:64104350-64104372 CAAGAAAAGGAGATGGAGGAGGG - Intronic
1118259173 14:64231870-64231892 CATAAATAGGACATGAAGAAGGG - Intronic
1118413348 14:65505606-65505628 AATAAAACTGAGATGTAGGCCGG - Intronic
1119067687 14:71546636-71546658 CATTAAAAGCAAATGAATGCAGG - Intronic
1119260679 14:73236518-73236540 TAAAAAAAGAAGAAGAAGGCTGG + Intergenic
1119678184 14:76572082-76572104 CTTAATAAGAAGATGCAGGCTGG - Intergenic
1120015629 14:79470216-79470238 CACAAGGGGGAGATGAAGGCAGG + Intronic
1121069854 14:91008568-91008590 CAAAAAAATGAGAGGATGGCTGG + Intronic
1121160451 14:91734425-91734447 CATAAAAAGGATAAGAAGGCTGG - Intronic
1121172293 14:91864766-91864788 AAAAAAAAAAAGATGAAGGCAGG - Intronic
1121918327 14:97856528-97856550 TTGAAAAAGGAAATGAAGGCTGG + Intergenic
1122730062 14:103789947-103789969 CATTCAAAAGAAATGAAGGCCGG + Intronic
1122734259 14:103827026-103827048 AAAAAAAAGTAGATTAAGGCTGG + Intronic
1125382722 15:39104233-39104255 AATAAAAAGGAGATTAAGTAAGG + Intergenic
1126129946 15:45330982-45331004 TATAAAAATGAAATCAAGGCCGG + Intergenic
1126888430 15:53177435-53177457 CAAGAACAGCAGATGAAGGCTGG - Intergenic
1127149770 15:56061243-56061265 TAAAAAAAGGAAAAGAAGGCTGG + Intergenic
1127534256 15:59875132-59875154 CAAAAAAAGGAAAGGAAGGAAGG - Intergenic
1127628879 15:60806803-60806825 GACAAAAAGGAGAAAAAGGCAGG + Intronic
1127632738 15:60841757-60841779 AAAAAAAAGGAGATAAAGGGCGG - Intronic
1127968205 15:63939618-63939640 GACAGAATGGAGATGAAGGCTGG - Intronic
1128042551 15:64588130-64588152 CTTAAAAAGAAGGGGAAGGCCGG + Intronic
1129080279 15:73033359-73033381 CATAAAAAGGTGCTGTAGGCCGG + Intergenic
1129448331 15:75634454-75634476 CATAGAAAGGAGATGGAGGGAGG + Intergenic
1129496625 15:75988481-75988503 CATTAGAAGGAGTTGTAGGCTGG - Intronic
1129650582 15:77484751-77484773 CAGAAATAGCAGATGATGGCAGG - Exonic
1129947761 15:79556102-79556124 CAGAAAAAGGACATGAATCCAGG - Intergenic
1130095191 15:80850570-80850592 AATAACAAGAAGATGATGGCTGG - Intronic
1130643725 15:85704546-85704568 CAAAGAAAGAAGTTGAAGGCTGG + Intronic
1131110382 15:89761088-89761110 CTTAAGAAATAGATGAAGGCCGG + Intronic
1131334459 15:91534407-91534429 CATAAAAAGGAGAGGGAGAATGG + Intergenic
1132071611 15:98782071-98782093 CATAAACAGGAGACCAAGGCAGG - Intronic
1132246869 15:100304018-100304040 CATAAAGAGCTGATTAAGGCCGG - Intronic
1133120858 16:3606479-3606501 CCTCAAGAGGAGATGATGGCGGG - Exonic
1133464185 16:6014296-6014318 CTTATTAAGGGGATGAAGGCAGG + Intergenic
1133741107 16:8652160-8652182 GATAAAAGTGAGATGTAGGCCGG + Intergenic
1134016573 16:10892515-10892537 CATGACATGCAGATGAAGGCTGG - Intronic
1134167490 16:11941939-11941961 CATAAAAAACAAATGATGGCAGG + Intronic
1134329395 16:13236625-13236647 CAGAAAAAGAAGAGGAAGGAAGG - Exonic
1134398214 16:13884944-13884966 AAAAAAAAGAAGAAGAAGGCCGG - Intergenic
1134493209 16:14711773-14711795 CATAAAAAACAAATGATGGCAGG - Intronic
1134498590 16:14750897-14750919 CATAAAAAACAAATGATGGCAGG - Intronic
1134525144 16:14937527-14937549 CATAAAAAACAAATGATGGCAGG - Intronic
1134547750 16:15123392-15123414 CATAAAAAACAAATGATGGCAGG + Intronic
1134581984 16:15378188-15378210 CATAAAAAACAAATGATGGCAGG + Intronic
1134680684 16:16122892-16122914 CAAAAAAAGGAGATGGGGGTGGG + Intronic
1134712732 16:16336014-16336036 CATAAAAAACAAATGATGGCAGG - Intergenic
1134720596 16:16379329-16379351 CATAAAAAACAAATGATGGCAGG - Intronic
1134946831 16:18332556-18332578 CATAAAAAACAAATGATGGCAGG + Intronic
1134954095 16:18372679-18372701 CATAAAAAACAAATGATGGCAGG + Intergenic
1135266924 16:21035028-21035050 CAGAAATAAGAGAGGAAGGCTGG + Intronic
1135312920 16:21419591-21419613 CATAAAAAACAAATGATGGCAGG + Intronic
1135342435 16:21660690-21660712 AATAAAAACAAGATGGAGGCTGG - Intergenic
1135351572 16:21733752-21733774 CATGAAAAGGAGGTGAAGAAGGG - Intronic
1135365843 16:21851871-21851893 CATAAAAAACAAATGATGGCAGG + Intronic
1135432809 16:22400953-22400975 CAAGAAATGAAGATGAAGGCTGG - Intronic
1135445971 16:22519291-22519313 CATAAAAAACAAATGATGGCAGG - Intronic
1135450055 16:22549879-22549901 CATGAAAAGGAGGTGAAGAAGGG - Intergenic
1135451850 16:22565351-22565373 CATTAAACGGAGATGGGGGCCGG + Intergenic
1135633367 16:24053673-24053695 CTTTCAAAGGAGATGAAGGAGGG + Intronic
1135879953 16:26245530-26245552 CATAGAGAGGAGAAGGAGGCTGG + Intergenic
1136152076 16:28357322-28357344 CATAAAAAACAAATGATGGCAGG + Intronic
1136168329 16:28471190-28471212 CATAAAAAACAAATGATGGCAGG + Intergenic
1136194672 16:28643861-28643883 CATAAAAAACAAATGATGGCAGG - Intronic
1136211004 16:28757960-28757982 CATAAAAAACAAATGATGGCAGG - Intronic
1136255725 16:29037918-29037940 CATAAAAAACAAATGATGGCAGG - Intergenic
1136309585 16:29398318-29398340 CATAAAAAACAAATGATGGCAGG + Intronic
1136323033 16:29500099-29500121 CATAAAAAACAAATGATGGCAGG + Intronic
1136437717 16:30240067-30240089 CATAAAAAACAAATGATGGCAGG + Intronic
1137226407 16:46515610-46515632 TATAAAAAGCAGAACAAGGCTGG + Intergenic
1137925455 16:52536431-52536453 CAAAAAGATGGGATGAAGGCTGG + Intronic
1138084998 16:54125396-54125418 CTTAAAAAGGAGATCTGGGCAGG - Intergenic
1138420434 16:56895554-56895576 TGAAAAAAGGAAATGAAGGCTGG + Intronic
1138812540 16:60167607-60167629 CATGAAAAGGATTTGAAGGTGGG + Intergenic
1138958099 16:61995671-61995693 CATAAAAAGTAAAAGTAGGCCGG - Intronic
1139108916 16:63864641-63864663 ACAAAAAAGGAGATGCAGGCCGG + Intergenic
1139350213 16:66330238-66330260 CCTTAAAAGAAGAGGAAGGCCGG - Intergenic
1139857270 16:69990698-69990720 CATAAAAAACAAATGATGGCAGG + Intergenic
1139903791 16:70348641-70348663 AAAAAAAAAGAGGTGAAGGCTGG + Intronic
1139918230 16:70441164-70441186 TATAAAAAAGAAAAGAAGGCTGG + Intergenic
1140014572 16:71169127-71169149 CATACAAAGAAAATGTAGGCTGG + Intronic
1140127227 16:72128292-72128314 CACAAAAAGGAGATGAAAGGGGG - Intronic
1140302493 16:73771982-73772004 CACAAAAATGATATGAAGGTTGG - Intergenic
1140365403 16:74377223-74377245 CATAAAAAACAAATGATGGCAGG - Intergenic
1140513107 16:75522408-75522430 AATAAAAAGGAGAAAAAGGAAGG - Intergenic
1142236951 16:88926916-88926938 CAGAGAAAGGAGATGAGGGCAGG - Intronic
1203119507 16_KI270728v1_random:1524679-1524701 GAAAAAAAGGAGATGAAAGAAGG + Intergenic
1142973540 17:3629432-3629454 CATAAAAAGGATATGCCGGCCGG + Intronic
1143349705 17:6278260-6278282 CATAAAAATAAGCTGGAGGCCGG - Intergenic
1143591905 17:7890132-7890154 TGTAAAAAGTAGATAAAGGCCGG + Intronic
1144615355 17:16766443-16766465 TATAAAAAGCAGATGTAGGCCGG + Intronic
1144897346 17:18549219-18549241 TATAAAAAGCAGATGTAGGCCGG - Intergenic
1145135026 17:20396502-20396524 TATAAAAAGCAGATGTAGGCCGG + Intergenic
1145375969 17:22349055-22349077 CATATAAAGGAATAGAAGGCTGG - Intergenic
1145692642 17:26759240-26759262 CAGAAAAATGACATGAAGCCGGG + Intergenic
1146015182 17:29227495-29227517 CAAAAAAAGTACATGTAGGCCGG - Intergenic
1146134149 17:30304094-30304116 CTTAAAAAAGAAAGGAAGGCCGG + Intergenic
1147174475 17:38645296-38645318 CAAGAAAAGGATATGAAGACTGG + Intergenic
1147385451 17:40078716-40078738 AAAAAAAAAAAGATGAAGGCTGG - Intronic
1147752697 17:42745939-42745961 CTTAAAAAGAAGAGGGAGGCCGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148823162 17:50372653-50372675 CATATAAAGTAGATGTAGACTGG - Intronic
1148930374 17:51122251-51122273 CATAAAAACAATATGAAGGTTGG + Intergenic
1149686632 17:58539299-58539321 CAGAAAAAGGGGATGAAGGTGGG + Intronic
1149710071 17:58733309-58733331 TATAAAAATGAGATAAAGCCGGG - Intronic
1150562853 17:66309809-66309831 CAGAGAAAGGAGAAGAAGACAGG + Intronic
1150645774 17:66976616-66976638 GATAGAAAGAAGATGAAGGCAGG - Intronic
1150863020 17:68820925-68820947 CCAGAAAAGGAGATCAAGGCAGG - Intergenic
1151760549 17:76099801-76099823 CACAAAAATATGATGAAGGCAGG + Intronic
1152222404 17:79075788-79075810 CATGAAGATGGGATGAAGGCTGG + Intronic
1153051117 18:904502-904524 GATAAATAGGAGCAGAAGGCCGG + Intergenic
1153137725 18:1935686-1935708 CATAACAAGGAAATGAAGGAAGG + Intergenic
1153829399 18:8908354-8908376 CTTTAAAAGGAGGTGTAGGCCGG + Intergenic
1154118719 18:11633947-11633969 CATAAAAAACAAATGATGGCAGG + Intergenic
1154242868 18:12668293-12668315 CAAAAAAAGTGGATGGAGGCTGG + Intronic
1155521835 18:26676155-26676177 CTTAAAAAGGAGTTTAAGGCTGG - Intergenic
1155636940 18:27967212-27967234 CATAAAAATCTGATGATGGCAGG + Intronic
1156269050 18:35514332-35514354 CATCAAAGGGAGATGGAGGATGG - Intergenic
1157424536 18:47573521-47573543 TATAAAAAGTAGCTGCAGGCCGG + Intergenic
1158346572 18:56522172-56522194 AACCAAAAGGAGATGAAGGGTGG + Intergenic
1158516293 18:58132951-58132973 CATACTTAGGAGATGAATGCTGG + Intronic
1158701887 18:59755552-59755574 AAAAAAAAGAAGAAGAAGGCTGG + Intergenic
1158765972 18:60449751-60449773 TATAAACAGGAAATGAAGGTTGG + Intergenic
1159304652 18:66625448-66625470 TATAAAAAGCACATGTAGGCTGG + Intergenic
1159998872 18:74996465-74996487 TAGAAAAAGGAAATGAAGTCAGG + Intronic
1160339771 18:78079713-78079735 CATTCAAGGGAGATGACGGCAGG - Intergenic
1161195879 19:2986415-2986437 GCAAAAAAGTAGATGAAGGCTGG + Intronic
1161612138 19:5249013-5249035 TATAAAAAGGAAATGGAGGCAGG + Intronic
1161740488 19:6018264-6018286 CATAAAAAGGAGATGAAGGCCGG - Intronic
1162838897 19:13341163-13341185 TGTGAAATGGAGATGAAGGCGGG + Intronic
1163251327 19:16127944-16127966 CTAAAACAGGAGCTGAAGGCAGG - Intronic
1163460784 19:17436272-17436294 CAGAATGAGGAGGTGAAGGCTGG + Exonic
1164156958 19:22602875-22602897 GACAAGGAGGAGATGAAGGCAGG + Intergenic
1164658367 19:29941059-29941081 CATAAAAAGGAAAAAAAGGGTGG + Intronic
1164775473 19:30850222-30850244 TATAAAAAGGAAAAGAAGGAGGG + Intergenic
1164840429 19:31388920-31388942 CATAGAAGGGAGAGAAAGGCCGG + Intergenic
1165119597 19:33550672-33550694 CAAAAAGAGGAGGTGCAGGCTGG + Intergenic
1165482672 19:36074000-36074022 TTTAAAAAGGAGTTGAAGACGGG + Intronic
1165945324 19:39438198-39438220 GACAAAAAAGAGATAAAGGCAGG + Intronic
1166425078 19:42670347-42670369 CTTAAAAAGGAGTTCATGGCTGG - Intronic
1166695512 19:44849293-44849315 CATAGATACCAGATGAAGGCAGG + Intronic
1168110151 19:54187719-54187741 AAAGAAAAGCAGATGAAGGCCGG + Intronic
925668646 2:6289027-6289049 CAGAGAAAGGAGATGCAGGAAGG - Intergenic
925916196 2:8608195-8608217 CAAAGAATCGAGATGAAGGCTGG - Intergenic
925980778 2:9175455-9175477 CAGAAAATGGATATGAAGGCAGG - Intergenic
927359054 2:22210140-22210162 AAAAAAAACGAGGTGAAGGCTGG - Intergenic
928068671 2:28192816-28192838 TATAAAAAGGAGCTATAGGCCGG - Intronic
928150944 2:28828281-28828303 CATAAACACAAGATGAGGGCCGG - Intronic
928158980 2:28904098-28904120 TATAAAAAGGAGTTCTAGGCTGG - Intronic
928628769 2:33169040-33169062 AATAAAAAGGAGTTGTAGTCGGG + Intronic
929149049 2:38731597-38731619 TATAAGGAGGAGATGAAGGTAGG - Intronic
929388001 2:41434208-41434230 CATAGAAAGAAGATGTAGGCAGG + Intergenic
929472303 2:42206508-42206530 CATAAAAACTAAATGCAGGCTGG - Intronic
930146853 2:48016410-48016432 CATAAAAATGAAATGAACGATGG + Intergenic
930714084 2:54576348-54576370 CAGAAAGAAGAGCTGAAGGCCGG - Intronic
931043207 2:58320391-58320413 CATAAAAATGAAAGAAAGGCCGG - Intergenic
931270999 2:60702711-60702733 TATAAAAAGCACATAAAGGCTGG + Intergenic
931510275 2:62983836-62983858 CATAAAAAGGAGGCAAAGGCCGG - Intronic
931927236 2:67086728-67086750 CATAAAAAGCAGCTGAAGAAAGG + Intergenic
932615386 2:73228182-73228204 AAACAAAAGGAGCTGAAGGCAGG - Exonic
932873112 2:75423772-75423794 CATCCAAAGGAAATGAAGTCAGG + Intergenic
934494260 2:94783782-94783804 CATGAAAAGGAGCTGAGTGCTGG + Intergenic
934610782 2:95733771-95733793 CATAAAATGGAGGTGGAGGTGGG - Intergenic
934712556 2:96525547-96525569 CTTAAAATGGAGATGTAGCCTGG + Intergenic
935386390 2:102503897-102503919 AATCACAAGAAGATGAAGGCAGG - Intronic
935918056 2:107979398-107979420 CATAAATGGGAGATGAATGTTGG + Intergenic
936030125 2:109063976-109063998 CATGAAACGGACATGATGGCTGG - Intergenic
937369769 2:121289065-121289087 CATGAATAGGAGTTGAAGGATGG + Intergenic
937503327 2:122507955-122507977 AATTAAAAGGATATTAAGGCTGG + Intergenic
938172471 2:129091353-129091375 TATAAAGAGAAAATGAAGGCCGG - Intergenic
938732322 2:134156296-134156318 GCCAAAAAGGAAATGAAGGCTGG + Intronic
939287935 2:140156672-140156694 TATAAAAGGAAGAGGAAGGCAGG - Intergenic
939967367 2:148623682-148623704 CAAGAAAAGGAGAAGAAGGATGG - Intergenic
940075854 2:149741351-149741373 CATAAAATGGAGGAGAATGCTGG - Intergenic
940458127 2:153928023-153928045 CATAAAGGGGAGATGAAGAAGGG - Intronic
941341933 2:164317010-164317032 AATAAAAAGAAAATGAAGGCAGG + Intergenic
941370833 2:164662014-164662036 CATCAAAAGGAACTTAAGGCAGG + Intronic
942023700 2:171892519-171892541 CTTAAGAAGTAGATGTAGGCCGG - Intronic
942201847 2:173578898-173578920 CATGAAAAGGAAATGCACGCAGG + Intergenic
943056148 2:182983101-182983123 CATATAAGGGAGAAGAATGCAGG + Intronic
944115433 2:196180872-196180894 CATAGAAAGGAGATCCAGGCTGG - Intergenic
944125149 2:196284044-196284066 CATAAAAAGGAAAAGATGGTAGG - Intronic
944400425 2:199319822-199319844 CATAAAAGGGAGAAGATAGCAGG + Intronic
944944824 2:204671429-204671451 CATGAAAAGTAGACGAAGGTGGG - Intronic
945739486 2:213642869-213642891 CATGGAAAAGAGATGTAGGCTGG - Intronic
946076651 2:217079211-217079233 TACAAAAAGGAGAAGAAGGAGGG + Intergenic
947272225 2:228348591-228348613 CATAAAAAAGAAATGAAGTATGG - Intergenic
947829682 2:233130189-233130211 TTTAAAAAGGAGACCAAGGCTGG - Intronic
948006524 2:234613796-234613818 CAAAAAGTGGAGAAGAAGGCTGG + Intergenic
948066775 2:235087094-235087116 CAGAGAATGGAGATAAAGGCAGG - Intergenic
948499568 2:238381869-238381891 CAAAAAAATGACATGAAGACAGG + Intronic
1169087573 20:2836861-2836883 AAACAAAAGGAGATGAGGGCAGG - Intronic
1169449530 20:5699741-5699763 CATAACAAAGAAATGAAGACAGG - Intergenic
1170841613 20:19928765-19928787 CACAAGAGGGAGAGGAAGGCAGG - Intronic
1171984730 20:31651825-31651847 CACAAAATGAAGTTGAAGGCTGG + Intergenic
1172088807 20:32411935-32411957 CATAAAAAGGACACAAAAGCTGG - Intronic
1172481966 20:35276706-35276728 AATGAACAGGAGATGGAGGCAGG + Exonic
1172830924 20:37833692-37833714 GATAAAATGGAGGTGAAGGATGG - Intronic
1173117485 20:40259600-40259622 CAAAAGAGAGAGATGAAGGCCGG + Intergenic
1173391301 20:42636817-42636839 AATAAAATGGAGATGAAGGATGG + Intronic
1173782442 20:45767729-45767751 AATAAAAAGGAGAAGGAGGAAGG + Intronic
1174116063 20:48227074-48227096 CTTAAGCAGGAGATGGAGGCAGG - Intergenic
1174213161 20:48895890-48895912 CATAAAGATGAGAGAAAGGCTGG - Intergenic
1174275598 20:49401578-49401600 CTCAAAAAGTGGATGAAGGCTGG - Intronic
1174799037 20:53547520-53547542 CTTGAAAAGCAGATGAAGCCAGG - Intergenic
1174915128 20:54645650-54645672 CATAAGATGCAGATGATGGCCGG + Intronic
1174959694 20:55141506-55141528 TTTAAAAAGGAGATGATGACAGG + Intergenic
1175076312 20:56377490-56377512 CATAAAAAGATGTTCAAGGCCGG + Intronic
1176721412 21:10396801-10396823 AAAAAAAAGGAGAAGAAGGCTGG + Intergenic
1176932646 21:14831454-14831476 GATATAAAGGAAATAAAGGCAGG - Intergenic
1176948078 21:15008426-15008448 CATAAAGAGGACTTGAAAGCCGG + Intronic
1178424927 21:32471620-32471642 AAAAAAAAGGAAATGGAGGCTGG - Intronic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1178897469 21:36571134-36571156 GGTAAAAAGGAGATGCAGGCTGG - Intronic
1179477243 21:41654965-41654987 TATAAAAATGAAATGTAGGCCGG + Intergenic
1180302603 22:11049577-11049599 AAAAAAAAGGAGAGGAAGGCTGG + Intergenic
1181562842 22:23715631-23715653 CAGAAAAAGAGGATGTAGGCTGG + Intergenic
1181741299 22:24923916-24923938 CATAAAAAGGTGAGGTCGGCCGG - Intronic
1181879731 22:25968604-25968626 CAAAGAAAGGAAATGGAGGCCGG + Intronic
1182478832 22:30593189-30593211 GTTAAAAATGAGATGAAGCCGGG + Intronic
1182901569 22:33902833-33902855 TTTAAAAAGGTGATTAAGGCTGG + Intronic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1183312203 22:37116442-37116464 CATAAAAAGGATAAGGAGTCTGG + Intergenic
1183998708 22:41656222-41656244 AAAAAAAAAAAGATGAAGGCTGG + Intronic
1184137885 22:42560109-42560131 GATAAAAAGGAGAGGAGGGCCGG - Intronic
1184961143 22:47929645-47929667 AATAAAATGAAAATGAAGGCTGG + Intergenic
1185230068 22:49674922-49674944 CAGAAAGAGGAGAGGAAGCCAGG + Intergenic
949166157 3:943881-943903 CATAAAAAAGGAATGCAGGCTGG + Intergenic
949502323 3:4692822-4692844 CATAAAAATAAGATGGAGGCAGG + Intronic
949747616 3:7312905-7312927 AAAAAAAAGGAGGAGAAGGCAGG - Intronic
951049786 3:18081453-18081475 CATATAAAACAGATGAAGCCTGG + Intronic
951562787 3:23984859-23984881 CATAAAACAGAGAGGAAGTCAGG - Intergenic
951669326 3:25162749-25162771 CATAAAAAGGGAATGAAGTAGGG - Intergenic
952144938 3:30522106-30522128 TAATAAAGGGAGATGAAGGCAGG + Intergenic
952224176 3:31357240-31357262 CACAAGAGGGTGATGAAGGCTGG + Intergenic
952240457 3:31526984-31527006 CATTAGAAGCAGAGGAAGGCCGG - Intergenic
953762511 3:45700966-45700988 CATTAAAAAGAGATAGAGGCTGG - Intronic
953964133 3:47289620-47289642 TATTAAAAGGAGCTGTAGGCTGG + Intronic
954843749 3:53535703-53535725 CATAAAACTGAGATGAAAGCTGG + Intronic
954933269 3:54302852-54302874 CAGAAAGAGGAGATGAGAGCAGG - Intronic
954977693 3:54712174-54712196 CATAAACAGGAAATGAATACAGG - Intronic
955090259 3:55743498-55743520 GATAAAAAGGCAATGAAGGATGG + Intronic
955424682 3:58776036-58776058 CAGAAAAGGGAGAGGAAGGCTGG - Intronic
955648922 3:61171926-61171948 CATAAAAAAGAGATGAATAAGGG - Intronic
955884210 3:63580122-63580144 CATAAAAAAGTGATGAATACAGG - Intronic
956546859 3:70413557-70413579 CATAAAAAGAAACTGAAGGCTGG + Intergenic
957737933 3:84226242-84226264 CATAAGACAGAGATGAAGGTTGG - Intergenic
957758786 3:84527255-84527277 TTTAAAAATGAGAGGAAGGCAGG + Intergenic
957936887 3:86955684-86955706 CATAAAAGTGAGATGAGGCCAGG - Intronic
958729558 3:97947139-97947161 CACATAAAGGGGATGAAGGAAGG + Intronic
959269356 3:104186752-104186774 CATAGAAAGGAGGTGAAGAATGG - Intergenic
959615524 3:108342935-108342957 CATAATACAGAGATGCAGGCAGG - Intronic
960125184 3:113990803-113990825 AAAAAAAAGGAAATGCAGGCTGG + Intronic
960168884 3:114435542-114435564 CATGAAAAGCACATGAAGTCTGG - Intronic
961861652 3:129921202-129921224 CAGAACAAGGAGAAGACGGCTGG + Intergenic
963137636 3:141922354-141922376 CTTAAAAAGAAAATCAAGGCCGG + Intronic
963814614 3:149815524-149815546 CATAAAAAGGGGAAGAAAGTTGG + Intronic
964080697 3:152752539-152752561 CATAAAAATGATGTAAAGGCTGG - Intergenic
964837403 3:160954658-160954680 AATAAAAAGCAGATTAAGTCCGG - Intronic
964993952 3:162851002-162851024 CATAGAAAGAAGAGGGAGGCCGG - Intergenic
965298297 3:166976954-166976976 CATAAAAATGAGAGGAAGTTTGG + Intergenic
965406524 3:168276074-168276096 CATAAAAAGGATATTCTGGCTGG - Intergenic
965616554 3:170599414-170599436 CAGAAAAAGAAGTTGAAGGCAGG - Intronic
967694899 3:192519175-192519197 CAGAAAAAGGACATGAGGGTGGG - Intronic
968037208 3:195557852-195557874 CATAAAAAGCAAATGATGGATGG - Intergenic
968210619 3:196845648-196845670 AAAAAAAAGAAGAAGAAGGCCGG - Intergenic
968239603 3:197064966-197064988 TATTAAAAGGAGATAAGGGCCGG - Intronic
968485868 4:861292-861314 CGTCAAAAGCAGAGGAAGGCCGG + Intronic
968586041 4:1416495-1416517 CAGGAAAAGGAGAGGAAGGGTGG - Intergenic
968782746 4:2595343-2595365 CAGAAAAAGAAACTGAAGGCTGG - Intronic
969098328 4:4750927-4750949 CATAACAAGGTGGGGAAGGCTGG - Intergenic
969992153 4:11275711-11275733 AATAGAAAGCAGATGAAAGCAGG - Intergenic
970139503 4:12966287-12966309 CATAAACAGAAAATGAAGGCTGG - Intergenic
970964316 4:21910178-21910200 CAAAAGAAGGAGATGAGGTCAGG + Intronic
971400923 4:26274637-26274659 AAAAAAAAGAAGAAGAAGGCTGG + Intronic
972497520 4:39647792-39647814 CATAAAAAGCTGATGGGGGCTGG + Intergenic
973150734 4:46884351-46884373 CTTAAAAAGGAAATGCAGTCTGG - Intronic
973989109 4:56386495-56386517 CTTAAAAAGGAAAAAAAGGCCGG + Intronic
974069685 4:57112188-57112210 AATAAAAAGGAAATCAGGGCCGG - Intergenic
974756586 4:66217000-66217022 CTTAAAAAGCTCATGAAGGCGGG - Intergenic
974935841 4:68408918-68408940 CAAAAAAAGTAAATAAAGGCAGG - Intergenic
975228470 4:71902948-71902970 AAAAAGAAGGAAATGAAGGCAGG - Intergenic
976285123 4:83363835-83363857 CATAAAAACCCGATGAAGACTGG + Intergenic
977308022 4:95349786-95349808 GAGAAAAATGAGATAAAGGCAGG - Intronic
977346005 4:95817006-95817028 CATAAAAAAGAGAAGAAAACTGG - Intergenic
978336179 4:107672063-107672085 AATAAAAATGAGATGGAGGTGGG + Intronic
978833337 4:113116322-113116344 CAAAAGAGGGAGAGGAAGGCAGG - Intronic
979219538 4:118206163-118206185 CATGAAAAGGGGATGAATGTGGG - Intronic
979918295 4:126467791-126467813 CATAAAAACAAAATAAAGGCAGG + Intergenic
982799875 4:159692275-159692297 CACAAAAGAAAGATGAAGGCTGG - Intergenic
983321825 4:166204485-166204507 AATAAACAGGACATGAAGGAAGG + Intergenic
984107028 4:175560440-175560462 AATAAAAAAGAGAGGAAGGAAGG + Intergenic
985002031 4:185495018-185495040 AATAAAAGGGAGAGGAAGGAAGG + Intergenic
985085381 4:186307871-186307893 CATAGAAATGAGAGGAAGGCAGG + Intergenic
985179336 4:187239571-187239593 AAAAAAAAGGAAAGGAAGGCAGG - Intergenic
985269114 4:188177423-188177445 AAAAAAAAGGAGATGGGGGCAGG + Intergenic
986046928 5:4047524-4047546 CATAGAAAGGAAATAAAGGATGG + Intergenic
986056644 5:4143821-4143843 CATAAAATGAAAAAGAAGGCCGG + Intergenic
986415330 5:7522446-7522468 CAGAAACAGGAAGTGAAGGCTGG - Intronic
986533749 5:8765146-8765168 TATTAAGAGGAGATGAAGCCAGG + Intergenic
987584709 5:19839960-19839982 AATTAAAAGAAGTTGAAGGCCGG + Intronic
988023755 5:25656549-25656571 AATAAAAATGATATGATGGCTGG + Intergenic
988578184 5:32445993-32446015 CATTAAAAGGAAATGCTGGCCGG + Intergenic
989023799 5:37042493-37042515 CTTAAAAACTAGATTAAGGCTGG + Intronic
990140277 5:52695249-52695271 CTGAGAAAGGAGATGAAGGAAGG - Intergenic
990362473 5:55034716-55034738 AAGAAAGAGAAGATGAAGGCCGG + Intergenic
990717893 5:58659040-58659062 CATAAAAGGGGAATGAAGACGGG + Intronic
990743116 5:58932603-58932625 CAGAAGAAGCAGATGAAGGGTGG - Intergenic
991001989 5:61792128-61792150 CAGAAAAAAGAGATGAGTGCTGG + Intergenic
991297855 5:65100829-65100851 CTTCAAAAGGAGATGGAGGTGGG - Intergenic
991646597 5:68807537-68807559 CTGAAAAAGGAGATCAAGTCTGG + Intergenic
993373510 5:87120405-87120427 AATAAAAAGACCATGAAGGCAGG + Intergenic
993566651 5:89484357-89484379 CATTAGTAGGAGATGCAGGCAGG - Intergenic
994834028 5:104825590-104825612 CTTAATAATGAAATGAAGGCTGG + Intergenic
994941132 5:106325591-106325613 GATAAGACGGAGATGAAAGCAGG - Intergenic
995611004 5:113910269-113910291 AATTAAAAGGAGATTGAGGCTGG - Intergenic
995780891 5:115774276-115774298 AACAAAAAGTAGATCAAGGCTGG - Intergenic
995866550 5:116697864-116697886 CATAGAAAAGAGGAGAAGGCCGG + Intergenic
995866744 5:116699809-116699831 CATAAAAATGAAAAGAAGCCAGG + Intergenic
996236164 5:121132826-121132848 CATTAAAAAGAGAGGAAGGAGGG + Intergenic
996383121 5:122882534-122882556 CAGAACAAAGAGATGAGGGCAGG - Intronic
996388884 5:122938642-122938664 CTTTAAAAGGCAATGAAGGCCGG + Intronic
996402565 5:123078667-123078689 CATTACAAGGAGGTCAAGGCGGG + Intergenic
997336549 5:133112815-133112837 CATAAAAGAGACAAGAAGGCCGG + Intergenic
997608446 5:135193196-135193218 AATAAAAGGGAGATGATGGGAGG - Intronic
998225841 5:140325603-140325625 AATAAAAAGGACCTGAAGACAGG - Intergenic
998559220 5:143155461-143155483 CATAAAAATTGGATGAAGGCAGG - Intronic
998852430 5:146364002-146364024 CAGAAGAAGGAGATGAAGGGTGG + Intergenic
998858597 5:146420782-146420804 AATAAAAAAGAGACGGAGGCTGG + Intergenic
999408850 5:151332160-151332182 CTTAAAAATGAGATGGAGCCGGG - Intronic
1001103514 5:168833645-168833667 CATGAACAGGACATGAAAGCTGG + Intronic
1001861768 5:175062001-175062023 TATTAAAAGGAGATGTTGGCCGG - Intergenic
1001877307 5:175212776-175212798 CGTAAGAAGGAGTTGGAGGCCGG + Intergenic
1001894957 5:175370827-175370849 CTATAAGAGGAGATGAAGGCAGG + Intergenic
1003286597 6:4739655-4739677 CATAAAAAGGTGATTGAGGCCGG + Intronic
1004226514 6:13789672-13789694 TATAAAAAGTAAATGAAGACCGG + Exonic
1005045781 6:21640954-21640976 CAAAAAAAGGAAAAGATGGCCGG - Intergenic
1005478785 6:26234851-26234873 AAGAAAAAGGCGAAGAAGGCAGG - Exonic
1007042090 6:38732010-38732032 CATAAGAAAGAAATGTAGGCTGG - Intronic
1007221352 6:40281609-40281631 AATAATAAGGAGATGAGAGCAGG - Intergenic
1007671329 6:43556830-43556852 CAATAAAAAGAAATGAAGGCCGG + Intronic
1007742608 6:44021923-44021945 TATAAAAGGGAGATGAAGTGGGG + Intergenic
1007930884 6:45689756-45689778 CAAAAAAAGAAGAGGAAGGAAGG - Intergenic
1007962660 6:45974588-45974610 CATAGAGAGGAGTTGAGGGCAGG + Intronic
1008038672 6:46774218-46774240 CCTAGAAAGCAGATGAAGCCCGG + Intergenic
1009308193 6:62118726-62118748 CATAGAAGAAAGATGAAGGCTGG - Intronic
1010194441 6:73225252-73225274 AATAAAAAACAGATGAAGGAGGG + Intronic
1012551834 6:100470149-100470171 CAAAAAAGGGAGAGGAAGCCGGG + Intergenic
1012596003 6:101041050-101041072 AAAAAGAAGGAGAAGAAGGCAGG - Intergenic
1013413479 6:109903258-109903280 AATAAATGGAAGATGAAGGCTGG - Intergenic
1013499490 6:110733924-110733946 GATCAAAAGGAGAGGAATGCTGG - Intronic
1013507610 6:110815396-110815418 CAAAACAAGGAAATGAAGGAGGG - Intronic
1015435586 6:133182751-133182773 CAAAAGAAGGAAAAGAAGGCAGG - Intergenic
1015528568 6:134197527-134197549 CATAAAAAGCAAAAGTAGGCCGG + Intronic
1015944049 6:138482151-138482173 TAAAAAAAGAAGATGAAGCCGGG + Intronic
1016022958 6:139255115-139255137 CATAAAAAGAAAATGAGGCCGGG - Intronic
1016079020 6:139833287-139833309 TATAAAAATGAGATGAAACCTGG + Intergenic
1016239321 6:141910023-141910045 AATAAAAAGGAAATCAATGCTGG + Intergenic
1016305293 6:142677823-142677845 CATAAAAAGGAGAGGCAGGCAGG - Intergenic
1016709396 6:147152840-147152862 CAAACAAAGGAGAAGAGGGCAGG - Intergenic
1016740145 6:147518325-147518347 AATAAAAAGGTGCTAAAGGCAGG + Intronic
1016971363 6:149767354-149767376 CATAAAAAGGAGTGAACGGCTGG - Intronic
1017254746 6:152320811-152320833 AATAAAAATAAGATCAAGGCAGG - Intronic
1017324101 6:153127475-153127497 CATACAAGAGGGATGAAGGCAGG - Intronic
1018396140 6:163379497-163379519 GATAAACAGGAGCTGAGGGCCGG + Intergenic
1019346328 7:532586-532608 CGTGAAAGGGAGATGAGGGCAGG - Intergenic
1019494974 7:1333475-1333497 TAAAAAAAGGAGAAGAAGGAGGG - Intergenic
1019806371 7:3129230-3129252 CATAAAAGGGAGTTGATGGAGGG + Intergenic
1020747339 7:12094132-12094154 CATAAAAATGAGATGACAGAAGG + Intergenic
1020850763 7:13349575-13349597 TATCAAAAGAAGATGCAGGCTGG - Intergenic
1021088707 7:16455207-16455229 TATAAAAAGTAGACAAAGGCTGG + Intergenic
1021513126 7:21455738-21455760 CATAAGACAGAGATGAAGGTTGG - Intronic
1021664448 7:22962055-22962077 CATAAAAACAAGATAAAGCCAGG + Intronic
1021722258 7:23515840-23515862 AGTAAAAAGGACATGAAGGCTGG - Intronic
1022143223 7:27511722-27511744 TATAAAATGGAGAAGCAGGCTGG - Intergenic
1023254740 7:38301946-38301968 CATAAAATGGAGCTGAATGGAGG - Intergenic
1023363922 7:39444285-39444307 GAAAAAAACCAGATGAAGGCCGG + Intronic
1023541633 7:41272405-41272427 TATAAAAAGGAGTAGAAGCCAGG - Intergenic
1023556624 7:41430118-41430140 GAGAAACAGGAGAGGAAGGCTGG - Intergenic
1023566263 7:41526590-41526612 CATAAACTGGAGAGGCAGGCAGG - Intergenic
1023934192 7:44727526-44727548 AAGTAATAGGAGATGAAGGCAGG + Intergenic
1023981111 7:45070650-45070672 CATAAAAAGCTGTTGGAGGCTGG + Intronic
1024205483 7:47156020-47156042 CACAGGAAAGAGATGAAGGCTGG + Intergenic
1024431381 7:49291981-49292003 CACGAGAGGGAGATGAAGGCTGG + Intergenic
1024787668 7:52926931-52926953 GAAATAAAGGAAATGAAGGCAGG - Intergenic
1025767354 7:64468035-64468057 ATTAAAAAGGAGATGGGGGCTGG + Intergenic
1025784875 7:64635132-64635154 ATTAAAAAAGAGATTAAGGCCGG + Intergenic
1026027996 7:66762616-66762638 AAGAAATAGGACATGAAGGCTGG + Intronic
1026623384 7:71971151-71971173 CAAAGAAAGGAGATGAGGCCAGG + Intronic
1026814226 7:73496980-73497002 CAAAAAAAAGAGGTCAAGGCAGG + Intronic
1026890721 7:73980342-73980364 CAGAACAGGGAGATGAAAGCTGG + Intergenic
1027111444 7:75442872-75442894 CAGAAACAGGCGTTGAAGGCAGG - Intronic
1027283673 7:76627405-76627427 CAGAAACAGGCGTTGAAGGCAGG - Intergenic
1027900598 7:84109328-84109350 TATAAAAAAGAGAAGAAGGAAGG + Intronic
1028408408 7:90501194-90501216 TAGAAAAAGGAGATACAGGCAGG + Intronic
1028639344 7:93025939-93025961 GAAAAAAAGGAGAAGAAGGGTGG + Intergenic
1028742311 7:94289673-94289695 AATAAAAAGGAGAAGAAGATAGG + Intergenic
1028832688 7:95344325-95344347 CATAGGACAGAGATGAAGGCTGG + Intergenic
1029539752 7:101175629-101175651 AAAAAAAAGAAGAAGAAGGCTGG + Intronic
1030096586 7:105906234-105906256 TATAAAAAGGAGACTGAGGCAGG + Intronic
1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG + Intronic
1030398805 7:109021744-109021766 CTTAAAAATGAGATAAAGACTGG + Intergenic
1031190964 7:118550343-118550365 TACAAAAATGAGATGAAGGAAGG + Intergenic
1032044739 7:128595572-128595594 CATAAAAAGGAAATGACTGGAGG - Intergenic
1032263271 7:130353157-130353179 CATAAAAATGGGGTGATGGCTGG - Intronic
1033535471 7:142308246-142308268 CCTGAAAAGGAGAGGAAGGGAGG + Intergenic
1033553247 7:142466457-142466479 CATTAAAAGGTGATGGAGGCTGG + Intergenic
1033821627 7:145141361-145141383 CCAAAAAAGGAGATGGAGGTGGG - Intergenic
1033874938 7:145804426-145804448 AATAAAAATCAAATGAAGGCAGG - Intergenic
1033874981 7:145804734-145804756 AATAAAAATCAAATGAAGGCAGG - Intergenic
1034972141 7:155426052-155426074 CATGGAAAGGAAATGAAAGCAGG + Intergenic
1036408534 8:8477494-8477516 TCTAAAAAGGAGAAGAAGGCAGG + Intergenic
1036475237 8:9087205-9087227 AATAAAAATAAGATGAAGGTGGG - Intronic
1037381654 8:18291839-18291861 CATAAAGAGAGCATGAAGGCAGG + Intergenic
1037874811 8:22537714-22537736 CATAAAAAGGAATTAAATGCAGG + Intronic
1038077038 8:24087919-24087941 AAAAAAAAGGAGAGGAAGGTGGG - Intergenic
1038117921 8:24578843-24578865 CATAAGTGGGAGTTGAAGGCTGG + Intergenic
1038364653 8:26918916-26918938 CAAAAAAAGGAAAGGCAGGCCGG + Intergenic
1039393813 8:37205325-37205347 TTTAAAAAGGAGATGATGGCTGG - Intergenic
1041238212 8:55826500-55826522 CATAAAATGGATAAAAAGGCTGG + Intergenic
1041311173 8:56518108-56518130 CAGAAAAAGAAAATGGAGGCCGG - Intergenic
1041738461 8:61135076-61135098 CCTAAAAAGGAGATGGAAACAGG + Intronic
1041830066 8:62143865-62143887 CAGAAGATGGAGATGCAGGCAGG + Intergenic
1041978542 8:63828285-63828307 CAGAAAAGGGAGATGAAGAAGGG + Intergenic
1042041161 8:64591657-64591679 TATAAAATGGAGATGAAGTAAGG + Intronic
1042343496 8:67704520-67704542 CATAGGACAGAGATGAAGGCTGG + Intronic
1042814168 8:72860013-72860035 CAATAAAAAGAAATGAAGGCCGG - Intronic
1043227935 8:77757212-77757234 CAAAAAAAGAAAATGAAAGCTGG - Intergenic
1043336957 8:79187830-79187852 GAGAAAAAGGAAATGAAGGAAGG + Intergenic
1044842835 8:96352193-96352215 CATCCAAAGGAGTTGAAGTCAGG - Intergenic
1045504785 8:102770701-102770723 CATAGAAAGGAGATGCAGGTGGG + Intergenic
1045865468 8:106860517-106860539 AATAAAAAAGAGAAGGAGGCCGG + Intergenic
1045917307 8:107487263-107487285 AATAAAAAGGAGAGACAGGCCGG + Intronic
1045973176 8:108102647-108102669 CATGAAAAGAAGCTGGAGGCTGG + Intergenic
1046227395 8:111301509-111301531 CATAAAATTTATATGAAGGCTGG - Intergenic
1046546072 8:115651651-115651673 CATAAACAGGAGCACAAGGCGGG + Intronic
1046916042 8:119679502-119679524 CACAAAAAGTTGATGAAGGCTGG + Intergenic
1046971085 8:120224009-120224031 AAAAAAAAGGAGATGAGGGCAGG - Intronic
1047492731 8:125387816-125387838 AAAAAAAAGGAAATGTAGGCTGG + Intergenic
1047735548 8:127761936-127761958 CATAAAAAGTCTATGTAGGCAGG + Intergenic
1049980905 9:902783-902805 CATAAAAAGGAGCGGAAAGCTGG - Intronic
1050118251 9:2282440-2282462 CAGAAAAAGGATATCTAGGCAGG + Intergenic
1050347162 9:4702219-4702241 CATTAAAAGGAGAGGAAATCTGG - Intronic
1050771470 9:9206663-9206685 CACAAAAGACAGATGAAGGCAGG - Intronic
1051017333 9:12494647-12494669 AAAAAAAAGGAGCTGAAAGCAGG - Intergenic
1051053922 9:12960821-12960843 CAGAAAGAGGAAATGAAGGAGGG - Intergenic
1051594363 9:18809491-18809513 CATGAAAAGGAGCTTGAGGCCGG + Intronic
1052241128 9:26275075-26275097 CACTAAAAGGAGATAAAGGGTGG - Intergenic
1052994524 9:34544124-34544146 CAGAAGAGGGAGAGGAAGGCAGG + Intergenic
1054818968 9:69502964-69502986 AATAAAAAGTAGGTCAAGGCCGG - Intronic
1055096111 9:72415796-72415818 AATAAAAAGGAAAGGAAGACAGG - Intergenic
1057043122 9:91862025-91862047 TATAAGAAGAAGAAGAAGGCCGG + Intronic
1057912049 9:99026771-99026793 CATAGAAAGGGGAGGAAGGAGGG - Intronic
1057972051 9:99567830-99567852 TTTAAAAAGGGGAAGAAGGCTGG + Intergenic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1058832884 9:108835066-108835088 AATAGAAAGGAGAATAAGGCAGG - Intergenic
1058951864 9:109911414-109911436 CATGAAAAGGAGAGAAAAGCTGG + Intronic
1059063699 9:111060291-111060313 CATAAAAAGGGGATGAAAGAAGG + Intergenic
1059114706 9:111590653-111590675 CAGAAAAATTACATGAAGGCTGG - Intronic
1059155060 9:111982296-111982318 TATAAAGATGAAATGAAGGCAGG - Intergenic
1059357618 9:113712044-113712066 CATTGAAAGGAGGTGAAGGGGGG - Intergenic
1059646245 9:116270881-116270903 AATAAGAAGGATATCAAGGCAGG + Intronic
1059697654 9:116744097-116744119 CAGAAAAAGGAGGTGAGGGTGGG + Intronic
1059886459 9:118749861-118749883 TATAAAAAGGAATTCAAGGCCGG + Intergenic
1060359068 9:122937696-122937718 TATAAAAAGGAGCTGAGGCCAGG + Intergenic
1062646945 9:137552515-137552537 AATAGAAATGAGATGAGGGCAGG - Exonic
1185494449 X:543694-543716 CATAAAAAGGCCTTGAAGACTGG - Intergenic
1185538357 X:882046-882068 AAAAAAAAGGAGAGGAAGGCTGG - Intergenic
1186374649 X:8986418-8986440 AGAAAAAAGGAGATGAAGGGTGG - Intergenic
1186683239 X:11897881-11897903 AATTGAAAGGAGAGGAAGGCTGG + Intergenic
1186699468 X:12074341-12074363 CAACACAAGGAGATGAGGGCTGG - Intergenic
1187072872 X:15905660-15905682 CAGATAAAGGAGAAAAAGGCTGG - Intergenic
1187254574 X:17630431-17630453 CTTGTAAAGGAGATGTAGGCAGG - Intronic
1187879804 X:23836293-23836315 GAAAAAAAGGAAATTAAGGCCGG - Intronic
1187931946 X:24301748-24301770 CAAAAATAGGAGATCAAGGAGGG - Intergenic
1188559173 X:31448273-31448295 GATAAAAAGGAAAAGGAGGCAGG + Intronic
1188752616 X:33922836-33922858 CATAGAACAGAGATGAAGGGTGG - Intergenic
1189806079 X:44736990-44737012 TATAAATGGGAGCTGAAGGCCGG + Intergenic
1190306460 X:49085576-49085598 CATAAAAAGAAGCAGGAGGCTGG + Intronic
1190748418 X:53340713-53340735 CACAAAAATGAGAAAAAGGCTGG + Intergenic
1192432830 X:71124307-71124329 CATCAAAGGGAGAGGGAGGCCGG - Exonic
1193876728 X:86870279-86870301 GTTAAAAAGGAAAGGAAGGCTGG - Intergenic
1194122385 X:89976684-89976706 CATAGAAGAGAGGTGAAGGCTGG + Intergenic
1195106133 X:101603143-101603165 CATAAAAATAAAATGAAGGCAGG - Intergenic
1195479296 X:105324335-105324357 CAGAAAAAGCAGGGGAAGGCTGG - Intronic
1195695563 X:107664363-107664385 CATCAAAAGGAAATGCAGGCGGG - Intergenic
1197736322 X:129851521-129851543 AATAGAAAGGAGGTAAAGGCGGG + Intergenic
1197764301 X:130049953-130049975 CTTAAAAGGGAGAAGCAGGCTGG + Intronic
1198096114 X:133381374-133381396 CAGAAATAGGAGGTGAATGCAGG + Intronic
1198442356 X:136675438-136675460 AATTTAAAGGAGAGGAAGGCTGG - Intronic
1198744808 X:139878899-139878921 CATAGAAAGGAGACTAAGCCTGG + Intronic
1199134530 X:144234810-144234832 AAAAAAAAGGAAATGTAGGCTGG + Intergenic
1199594893 X:149499061-149499083 CATAAAAAGGAATGAAAGGCTGG + Intronic
1199998542 X:153043690-153043712 CATAAAGAGGTGAAGATGGCAGG + Intergenic
1200475245 Y:3634123-3634145 CATAGAAGAGAGGTGAAGGCTGG + Intergenic
1201448180 Y:14081051-14081073 TAAAAAAAGAAGATTAAGGCTGG - Intergenic
1201511362 Y:14768155-14768177 CAGAAAAAGGAGATGAGTGATGG - Intronic
1202055822 Y:20828437-20828459 CATAAAAGTCAGATGAGGGCTGG - Intergenic