ID: 1161740685

View in Genome Browser
Species Human (GRCh38)
Location 19:6019177-6019199
Sequence TATTCAAAGGACAAGAGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 242}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161740685_1161740695 10 Left 1161740685 19:6019177-6019199 CCCGCCCTCTTGTCCTTTGAATA 0: 1
1: 0
2: 0
3: 20
4: 242
Right 1161740695 19:6019210-6019232 AAAACAAAGGACCCTGAGAAGGG 0: 1
1: 0
2: 2
3: 43
4: 421
1161740685_1161740694 9 Left 1161740685 19:6019177-6019199 CCCGCCCTCTTGTCCTTTGAATA 0: 1
1: 0
2: 0
3: 20
4: 242
Right 1161740694 19:6019209-6019231 TAAAACAAAGGACCCTGAGAAGG 0: 1
1: 0
2: 1
3: 28
4: 302
1161740685_1161740697 20 Left 1161740685 19:6019177-6019199 CCCGCCCTCTTGTCCTTTGAATA 0: 1
1: 0
2: 0
3: 20
4: 242
Right 1161740697 19:6019220-6019242 ACCCTGAGAAGGGCCCGGAGTGG 0: 1
1: 0
2: 1
3: 30
4: 218
1161740685_1161740693 -3 Left 1161740685 19:6019177-6019199 CCCGCCCTCTTGTCCTTTGAATA 0: 1
1: 0
2: 0
3: 20
4: 242
Right 1161740693 19:6019197-6019219 ATAAGGGGCAGTTAAAACAAAGG 0: 1
1: 0
2: 0
3: 12
4: 185
1161740685_1161740696 15 Left 1161740685 19:6019177-6019199 CCCGCCCTCTTGTCCTTTGAATA 0: 1
1: 0
2: 0
3: 20
4: 242
Right 1161740696 19:6019215-6019237 AAAGGACCCTGAGAAGGGCCCGG 0: 1
1: 0
2: 1
3: 34
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161740685 Original CRISPR TATTCAAAGGACAAGAGGGC GGG (reversed) Intronic
900208326 1:1440977-1440999 AATGCAGAGGACAAGGGGGCTGG + Exonic
900515462 1:3079892-3079914 CTTTCAAGGCACAAGAGGGCAGG - Intronic
902388633 1:16090024-16090046 TGTTCAAAAGACAAGAGGGATGG - Intergenic
904062263 1:27720981-27721003 TATAAAAAAGACATGAGGGCTGG - Intergenic
904109003 1:28110569-28110591 TATTCACATGACAAGATGTCTGG + Intergenic
904527456 1:31144649-31144671 TTTTCAAAGGAAAAGAGGCCAGG + Intergenic
906933415 1:50190975-50190997 TAATCAAAGGTTAAAAGGGCCGG - Intronic
908550739 1:65206446-65206468 TATTCAAAGAACAAGCAAGCAGG + Intronic
908863107 1:68512516-68512538 TAATAAAATTACAAGAGGGCTGG - Intergenic
910789157 1:91033238-91033260 TATTCAAATGCCAAGAGTTCTGG - Intergenic
912154992 1:106906911-106906933 TACTTACAGGACAAGTGGGCTGG + Intergenic
916214467 1:162383660-162383682 TATTCAAAGGACAGCAGGTCTGG - Exonic
918301024 1:183203992-183204014 CATTTAAAGGACAATGGGGCAGG + Intronic
918468013 1:184841599-184841621 TCTTCAATGGAACAGAGGGCTGG + Intronic
919205306 1:194414868-194414890 TAATGAAAGTACAAGAGGGGAGG + Intergenic
919377378 1:196810756-196810778 TATTCAAAGGAAAACAGAGTTGG + Intergenic
921052455 1:211520626-211520648 TAGTCAAGGGATCAGAGGGCAGG + Intergenic
921058744 1:211564606-211564628 GATTCCAGCGACAAGAGGGCAGG + Intergenic
921623687 1:217354505-217354527 GATTCACAGGACTTGAGGGCAGG + Intergenic
921907566 1:220511380-220511402 TATTCAAATGCCCAGAGGGCAGG - Intergenic
922299229 1:224281656-224281678 TATTAAAAGGAAAAAAGGGGTGG + Intronic
922588380 1:226753133-226753155 TATTTAAAGAAAAAGATGGCTGG - Intergenic
922918698 1:229281448-229281470 TAATCAAAGAAAAACAGGGCTGG - Intronic
923190564 1:231616299-231616321 TAGTCAGAGCACATGAGGGCAGG - Intronic
1063076176 10:2719080-2719102 TATTATAGGGACAAGAGGGGAGG - Intergenic
1065225372 10:23538340-23538362 TATTGAAAGGACAAAAGGGATGG + Intergenic
1067897534 10:50200418-50200440 TATGCAAAGGTCCAGAGGGCAGG - Intronic
1067951440 10:50741619-50741641 TATGCAAAGGTCCAGAGGGCAGG + Intronic
1068533842 10:58218071-58218093 TAGTCAAAGAAGAAGAGAGCAGG + Intronic
1069694400 10:70376213-70376235 CAGTCAAAGGACAAGCAGGCAGG + Intronic
1071584543 10:86806911-86806933 TATCCAAAGGACACGAGAGCCGG - Intronic
1072064730 10:91855465-91855487 TATTCAAAGAATATGAGGGCTGG - Intronic
1073030724 10:100523613-100523635 AATTTAAAGGATAAGAGGGTGGG - Intronic
1073097735 10:100990000-100990022 TTTTCAAAGAATGAGAGGGCAGG + Intronic
1075308497 10:121390543-121390565 AATTGAAAGAACAAGAGAGCAGG - Intergenic
1077873445 11:6282555-6282577 TATTAAGAGAACAACAGGGCCGG - Intergenic
1078983134 11:16561474-16561496 AATTCAAAGGTCATGAGGGCAGG + Intronic
1079953383 11:26832487-26832509 GTTTAAGAGGACAAGAGGGCTGG - Intergenic
1081487001 11:43538495-43538517 TCCTCCAAGGAAAAGAGGGCAGG + Intergenic
1089339825 11:117749785-117749807 GATCCAAAGCACAGGAGGGCAGG + Intronic
1089372248 11:117969640-117969662 TGTTAAAAAGGCAAGAGGGCAGG + Intergenic
1090580130 11:128150510-128150532 TGTTCAAAGCACAAGATAGCGGG - Intergenic
1090983531 11:131745574-131745596 TATTGAAAGGATCAGAGGACTGG + Intronic
1092278236 12:7079040-7079062 TATTAAAATAAGAAGAGGGCTGG + Intergenic
1092701864 12:11240786-11240808 TATTCAAAGGAATAAAGGGTTGG - Intergenic
1092819348 12:12338836-12338858 TCTTTAAAGGCCAAGAAGGCAGG + Intronic
1093881178 12:24406051-24406073 AATCCAGAGGACAAGAGAGCTGG + Intergenic
1094294452 12:28888726-28888748 TCTTTAAAGGCCAACAGGGCGGG + Intergenic
1094581530 12:31738099-31738121 TATTCAAAGTGCATGAGGACAGG + Intergenic
1095819604 12:46463075-46463097 TATTTGAAAGTCAAGAGGGCTGG - Intergenic
1096402715 12:51320571-51320593 TATTCAGAGGACAAAAGGATTGG - Intronic
1098869611 12:75802253-75802275 GATTAGAAGGACATGAGGGCCGG + Intergenic
1099581250 12:84449925-84449947 TATTCAGAGAACAAGAGCTCTGG + Intergenic
1100979102 12:100150835-100150857 TTTTTAAAGGATAAGAGGGCCGG - Intergenic
1101695890 12:107126128-107126150 TATTCAGAGAACAAAAAGGCAGG - Intergenic
1102398424 12:112607813-112607835 CATTTAATGGACAAGAGGCCAGG - Intronic
1102693820 12:114782477-114782499 TATTCAAAGGGAAAGAAGGTGGG - Intergenic
1103718308 12:122959504-122959526 TATGAAAAGGAAAAGAGGCCAGG - Intronic
1106187407 13:27421633-27421655 AGTTCAAAGGAAGAGAGGGCGGG + Intergenic
1106863325 13:33935142-33935164 TTTTCAAATGTCAAGGGGGCAGG + Intronic
1107760256 13:43670555-43670577 TATTTGAAGGAAAATAGGGCTGG + Intronic
1108501031 13:51070128-51070150 TATTCTAAGAACTAGAGGGCAGG + Intergenic
1114275810 14:21143011-21143033 TTTTAAATGGGCAAGAGGGCTGG - Intergenic
1114630649 14:24157498-24157520 TCTGCAAAGGACAAGAGGTCAGG - Exonic
1115948180 14:38688256-38688278 TATTCAAATCAAATGAGGGCAGG + Intergenic
1117733307 14:58745599-58745621 TACTCAAAGGAGAAAAGGGCAGG - Intergenic
1119403897 14:74383731-74383753 TATTGAAAGGAAAAGAGGCTGGG + Intergenic
1119523430 14:75303089-75303111 TCCTCAAAGGAAAAGAGGGTAGG - Intergenic
1120723158 14:87908910-87908932 TATTTAAAAGACAAAAGGGCAGG - Intronic
1120800747 14:88685744-88685766 TATTTAAAGCACATGGGGGCCGG - Intronic
1123985960 15:25646264-25646286 TATCCAAAGGAAATGAGAGCAGG + Intergenic
1126392046 15:48168732-48168754 TATTCAAAAGACAAGAATTCGGG - Exonic
1127777468 15:62277225-62277247 TGAACAAAGGAAAAGAGGGCAGG + Intergenic
1129627473 15:77217311-77217333 CATTCAAAGCAAAAGTGGGCTGG + Intronic
1130196916 15:81788358-81788380 TATTAAAAGTAAAATAGGGCCGG + Intergenic
1131346427 15:91653298-91653320 TAATCAAAGGAAAAGAGGCATGG - Intergenic
1131456463 15:92586010-92586032 AATGGAAAGGACAAGAAGGCTGG + Intergenic
1131977217 15:97959044-97959066 TAATGAAAGGACAAAATGGCAGG - Intergenic
1132247005 15:100305438-100305460 AATTCCAACGACAAGAGCGCTGG + Intronic
1134011892 16:10859960-10859982 TTTGAAAAGGAGAAGAGGGCTGG - Intergenic
1135066247 16:19312619-19312641 TAGACAAAGGAAAAGAGGGTTGG + Intronic
1139042522 16:63015154-63015176 TATTAAAAGATCAAGAGGCCAGG - Intergenic
1140241308 16:73203356-73203378 TATGTAAAGTACAAGAGGACTGG - Intergenic
1140980440 16:80103987-80104009 TAGTCAAAGAACACGTGGGCGGG - Intergenic
1141044447 16:80703781-80703803 GAATCAGAGGTCAAGAGGGCAGG - Intronic
1141419487 16:83903590-83903612 TTTTAAAAGGAAAAGTGGGCTGG + Intronic
1142884478 17:2904131-2904153 TATTAAAAGCCGAAGAGGGCCGG - Intronic
1143202491 17:5122489-5122511 TTTCCAAAGGACAAGCGGCCCGG + Intronic
1146846190 17:36183302-36183324 TTTCCAAAGGACAAGCGGCCCGG - Intronic
1147458019 17:40550673-40550695 TAATCAAAGGACAAGATGAACGG + Intergenic
1147701449 17:42398210-42398232 TAATCAAAGGCCAGGAGGACAGG - Intergenic
1148067846 17:44885938-44885960 TATTAAATGGACAATAAGGCTGG + Intronic
1148718653 17:49734294-49734316 TATTAAAAAGACACTAGGGCCGG + Intronic
1149312802 17:55411778-55411800 TATTCAAATGCCAAGCAGGCAGG + Intronic
1149804450 17:59602127-59602149 AATTCACAGGACAAGAGTTCAGG - Intronic
1149849536 17:60026722-60026744 TATCCAAAGGACAAGCGGCGCGG - Intergenic
1152449945 17:80372335-80372357 TATTTTAAGGACAAGAAGGAGGG - Intronic
1153835118 18:8956806-8956828 TATTCAAAGGGAAAAAGAGCAGG - Intergenic
1156776722 18:40798490-40798512 TATCCAAAGGAAAAGAGGTCAGG - Intergenic
1157885862 18:51365673-51365695 TCTGGAAAGGAGAAGAGGGCTGG + Intergenic
1160316648 18:77854078-77854100 CAGTCAACGGACAAGAGGGGTGG + Intergenic
1160467795 18:79096587-79096609 AATGCAAAGGAAAAGAGGACTGG + Exonic
1161740685 19:6019177-6019199 TATTCAAAGGACAAGAGGGCGGG - Intronic
1161750067 19:6089404-6089426 AATCCAGAGGACATGAGGGCTGG - Intronic
1164272765 19:23687524-23687546 TACTCAAAGGACCAGAAGCCAGG - Intergenic
1167456943 19:49601418-49601440 TGTTTAAAGGACAAGAGGAAAGG + Intronic
1168574000 19:57492964-57492986 CCTTAAAAAGACAAGAGGGCAGG + Exonic
1168575658 19:57506466-57506488 CCTTAAAAAGACAAGAGGGCAGG + Exonic
926790038 2:16561538-16561560 AATTCAGAGGACAAGAGCGAAGG + Intronic
928046098 2:27933893-27933915 TATTAAAAGGACAAAAGATCTGG - Intronic
928315786 2:30244408-30244430 TTTCCAAAGGACATGATGGCAGG + Intronic
928364594 2:30691432-30691454 TGTGCAAAGGACCAGAGGCCTGG + Intergenic
928740641 2:34348047-34348069 TGTTAAAAAGACAAGAAGGCTGG - Intergenic
929200794 2:39233375-39233397 GAATAAAAGGACAAGAGGGAAGG + Intergenic
930981498 2:57531486-57531508 TATTAAAAAGTCAAGAGGCCTGG + Intergenic
932582288 2:72999810-72999832 AATTCAAAGGCAAAGAAGGCAGG - Intronic
933045720 2:77534242-77534264 GTTTCAAAGGACAAGTGGACTGG + Intronic
933218416 2:79658326-79658348 TATTGAAAGGACAAGTGAGATGG + Intronic
934496887 2:94810442-94810464 TTATCAAAGAAAAAGAGGGCTGG - Intergenic
934810766 2:97275108-97275130 TTTCAAAAGGACAAGGGGGCAGG + Intergenic
934826926 2:97432831-97432853 TTTCAAAAGGACAAGGGGGCAGG - Intergenic
934923154 2:98362001-98362023 TATTAAAAAGCCAAGAAGGCCGG - Intronic
935435601 2:103028637-103028659 TATTCAAATAAGAATAGGGCAGG + Intergenic
935713542 2:105919634-105919656 TATGCAAAGGCCCAGAGGCCAGG + Intergenic
936252772 2:110879846-110879868 GATTGAAAGGAAAAAAGGGCTGG + Intronic
940184106 2:150963371-150963393 TATTCAAAGGGAAGTAGGGCTGG - Intergenic
940972555 2:159909489-159909511 GATTCAAAGCAGAAAAGGGCAGG - Intergenic
941003502 2:160224423-160224445 TACTCACAGGACAAGGGTGCAGG + Intronic
941652963 2:168113085-168113107 TAGACAATGGAGAAGAGGGCTGG - Intronic
944788657 2:203100842-203100864 TTTTCAAAAGAAAACAGGGCTGG - Intronic
946297187 2:218794485-218794507 TATCAAAAGGAGAAAAGGGCGGG + Intronic
946416419 2:219542214-219542236 TATCAAAAGGACAACGGGGCGGG + Intronic
947459665 2:230292790-230292812 TATTCCAATGACAAGGGGCCAGG + Intronic
948957858 2:241308076-241308098 TCCTCAAAGGAGAAGAGGACAGG - Intronic
1170863346 20:20129313-20129335 TATTTAAAGGACAAGTTTGCTGG + Intronic
1170948175 20:20910623-20910645 TATTCAAAGAATAAAATGGCTGG + Intergenic
1171811923 20:29751318-29751340 TTTGCAAAGGAAGAGAGGGCAGG + Intergenic
1172403796 20:34672555-34672577 TATTCAAAAAAAAAGAGGTCAGG + Intronic
1176372939 21:6073503-6073525 TTTTCAATGGACTAGAGTGCGGG + Intergenic
1176905336 21:14493724-14493746 TCTTGAAGGGACAAGAGAGCAGG - Intronic
1177876989 21:26645659-26645681 TGTTAAAAGGCCAAGAGGCCAGG - Intergenic
1178275466 21:31232753-31232775 AATTCAGAGGCCAAGAAGGCAGG + Intronic
1179750538 21:43464740-43464762 TTTTCAATGGACTAGAGTGCGGG - Intergenic
1180871973 22:19151253-19151275 TTTTCAAAGGTCAAGAGGAAAGG - Intergenic
949708852 3:6850836-6850858 TATTAAAAAGATAAGAAGGCGGG - Intronic
953102045 3:39839551-39839573 AATTAAAAGAACTAGAGGGCAGG - Intronic
955307925 3:57852812-57852834 TATTCACAGAACAAGAAGGTTGG - Intronic
956714367 3:72065230-72065252 CATTCAAAGGAAAAGAGAGAGGG + Intergenic
956745937 3:72311081-72311103 GATAGAAAGGACAAGAGGACAGG - Intergenic
960265196 3:115613675-115613697 TATTAAAAAGTCAAGAGGCCGGG + Intergenic
960270416 3:115667957-115667979 TGCTCAAAGGACAGAAGGGCTGG - Intronic
962235142 3:133700858-133700880 TGTTCAAAGGACAAAAGAGATGG - Intergenic
964799872 3:160544152-160544174 TATTGAAAGGTCAAGGAGGCCGG - Intronic
965075533 3:163970305-163970327 TATTGAAAGGAAAAGAGTTCAGG + Intergenic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
967589388 3:191255052-191255074 TTTTCCAAGGACCAGGGGGCAGG + Intronic
967633097 3:191770053-191770075 TATACAAAGAACAAAAAGGCAGG + Intergenic
967677313 3:192316061-192316083 CATTCAGAGGACAGGAGGTCTGG - Intronic
968239603 3:197064966-197064988 TATTAAAAGGAGATAAGGGCCGG - Intronic
970879465 4:20911493-20911515 TATACAAAGGAGAAAAGGGTGGG + Intronic
971265623 4:25094064-25094086 TTTTCAAAACAAAAGAGGGCAGG + Intergenic
971454365 4:26830200-26830222 TATTCAAAGGCAAAAAGGGGGGG - Intergenic
972293148 4:37710118-37710140 TATAAAATGGACAAAAGGGCCGG - Intergenic
972939330 4:44177954-44177976 TAGTCAATGGAAAAGACGGCTGG - Intronic
974772631 4:66435497-66435519 AATTCAAAGCAAAAAAGGGCTGG - Intergenic
975400362 4:73930255-73930277 TGTTAAAAGGACAAAATGGCAGG + Intergenic
975590173 4:75991686-75991708 CATACAAGGGAAAAGAGGGCTGG + Intergenic
976469037 4:85405558-85405580 AATTCATAGGACACCAGGGCAGG - Intergenic
977261390 4:94801150-94801172 TGTGCAAAGGGCAAGAAGGCAGG - Intronic
978543795 4:109848647-109848669 TATAGAAAGGCTAAGAGGGCAGG + Intronic
982819483 4:159928081-159928103 TTTTCAAAAGTCAAGAGGTCTGG - Intergenic
983527011 4:168769764-168769786 TGTTGAAAGGGCCAGAGGGCAGG + Intronic
984705289 4:182843317-182843339 TAATGAAAGGACAAAAGAGCTGG - Intergenic
984949400 4:184995572-184995594 TATTAAAAGGAAAAAAAGGCCGG - Intergenic
985756423 5:1721632-1721654 TATTCAAAGGGCAAGAGACTGGG + Intergenic
992883160 5:81130646-81130668 TGTTCAAAGGAAGAGAGTGCTGG + Intronic
994364811 5:98900746-98900768 TATTTACAGGAGTAGAGGGCTGG - Intronic
995106782 5:108383821-108383843 CATTCAAACTACAACAGGGCTGG + Intergenic
995485224 5:112633507-112633529 TAGACAAAGGACAAGAGCTCAGG + Intergenic
997802129 5:136874069-136874091 TATTTAAAGGAAAAGAGGTTGGG + Intergenic
999293253 5:150441421-150441443 TATTCTAAAGACAACAGGGAGGG + Intergenic
999324152 5:150632732-150632754 GATTCCAAGGGGAAGAGGGCAGG - Intronic
1000116107 5:158154822-158154844 TATTCAAAGGAGCAGATAGCTGG + Intergenic
1000963799 5:167631138-167631160 AATGCAAGCGACAAGAGGGCAGG - Intronic
1001067033 5:168543755-168543777 TATTTAAAAGACAATTGGGCTGG + Intergenic
1001453678 5:171845204-171845226 GAATCAAAGGACAAGAGGCCAGG + Intergenic
1002589739 5:180282112-180282134 TACTCCAAGGACAGGAGGACAGG + Intronic
1003790326 6:9539086-9539108 TTTTCAAAGGTCTAGAGGGTTGG + Intergenic
1003895225 6:10601086-10601108 TATTAAAACTACCAGAGGGCTGG - Intronic
1004530531 6:16450924-16450946 GATTAAAAGGACAACAGGGGCGG + Intronic
1004684650 6:17931194-17931216 TATTCTAAGGTCACGAGAGCTGG + Intronic
1006153879 6:32003743-32003765 TATACAAAGGCCCAGAGGCCGGG + Intergenic
1006160187 6:32036480-32036502 TATACAAAGGCCCAGAGGCCGGG + Intergenic
1007739187 6:44000719-44000741 CAGTCAAAGGAGAAGGGGGCAGG + Intronic
1008310804 6:49970890-49970912 TACACAAAAGACAAGAGGACTGG - Intergenic
1009936654 6:70242186-70242208 TATTCTCAGGAGAAGAGGGCGGG + Intronic
1010506176 6:76662067-76662089 TTCTCCATGGACAAGAGGGCAGG + Intergenic
1011489277 6:87874116-87874138 TCTTCAAGGGAGAAGAGGGAGGG + Intergenic
1011915178 6:92495389-92495411 TGTTGAAAGGACAAAAGAGCAGG + Intergenic
1012411071 6:98957675-98957697 TTCTCAAAGGGCAAGAGGCCAGG - Intergenic
1013489235 6:110629150-110629172 CATTCAAAGGACAAGAGCCAGGG + Intronic
1013738424 6:113254766-113254788 TATTCAAAACACAAGTTGGCTGG + Intergenic
1014794983 6:125714555-125714577 AAGTGAAAGGACAAGAAGGCAGG - Intergenic
1016709396 6:147152840-147152862 CAAACAAAGGAGAAGAGGGCAGG - Intergenic
1018996240 6:168712393-168712415 GAGTCAGGGGACAAGAGGGCAGG + Intergenic
1020263633 7:6545913-6545935 AATTCAAAGGAGAACATGGCTGG + Intronic
1020925587 7:14319954-14319976 TATACAAAGGATAACTGGGCAGG + Intronic
1022591496 7:31667909-31667931 TATTCAAAGGGCAAGCAGGAGGG + Intergenic
1022758903 7:33326242-33326264 GATTCAAGGGAGAAGAGGGGAGG - Intronic
1023563088 7:41496093-41496115 TGTGCCAAGGACAAGGGGGCAGG - Intergenic
1024060882 7:45697684-45697706 TTTTAAAAGGTAAAGAGGGCTGG - Intronic
1024549618 7:50551527-50551549 TAGTCAAAGTACAATGGGGCCGG - Intronic
1024762319 7:52613269-52613291 TAATTAAAGGCTAAGAGGGCAGG - Intergenic
1026279392 7:68908624-68908646 TATTCTAAGGACTTGATGGCAGG - Intergenic
1026403753 7:70043325-70043347 TATTCAAGGGAGAGGAGGGGAGG - Intronic
1026439910 7:70435120-70435142 TATGCCAAAGACAAGAGGTCAGG - Intronic
1029971183 7:104791075-104791097 AGCTCAAAGGAAAAGAGGGCAGG - Intronic
1031414175 7:121476121-121476143 TTTTTAAAGGAAAAGAGGGGTGG - Intergenic
1031485514 7:122318446-122318468 TATTGAAAGGAAAAGAAGGGTGG + Intronic
1032524292 7:132567984-132568006 TATCTAATGGACAAGAGAGCAGG + Intronic
1033774680 7:144594817-144594839 TTTTCAAAAGACAAGATTGCTGG - Intronic
1034091462 7:148368160-148368182 TATTCAAAGGATAAGAGACAAGG - Intronic
1034674401 7:152882226-152882248 TCTTTAAAGTGCAAGAGGGCTGG + Intergenic
1036098280 8:5749448-5749470 TACTAAAAGTACAAAAGGGCAGG + Intergenic
1037842135 8:22252284-22252306 TATTTAAAGGAAGAAAGGGCTGG - Exonic
1039251943 8:35675677-35675699 AATTCAAAGGTCAAGGGGCCTGG + Intronic
1039340296 8:36641480-36641502 GATTCAAAGGACAGAAGGGGAGG + Intergenic
1041445992 8:57951410-57951432 AATACAAAGGAAAAGAGGGGAGG - Intergenic
1042137631 8:65646933-65646955 TATTCAAAGGACAGTAGAGAAGG + Intronic
1044642264 8:94395737-94395759 TATCCAAAGGAGAACAGGACTGG - Intronic
1045083793 8:98657445-98657467 TAATGAAAGGAAATGAGGGCAGG + Intronic
1045084655 8:98669494-98669516 TAGTCAAAGAATAAGAAGGCAGG + Intronic
1045237079 8:100361619-100361641 TTTTCATGGGATAAGAGGGCAGG - Intronic
1046517249 8:115279069-115279091 TATTCAAAAGAGAACAGGGGTGG + Intergenic
1047582142 8:126227728-126227750 TAATCAAGGGACAAGAGATCTGG - Intergenic
1048265330 8:132980461-132980483 GGTGCATAGGACAAGAGGGCCGG - Intronic
1049715803 8:144090751-144090773 TATTCAAATGCAAACAGGGCTGG - Intergenic
1049829439 8:144690952-144690974 TTTTAAATGGACAAAAGGGCTGG - Intergenic
1050304002 9:4288039-4288061 TACTCATGGGAGAAGAGGGCAGG - Intronic
1053610137 9:39704730-39704752 TATTGAAAGAACAAGAGAGTAGG - Intergenic
1053660260 9:40270003-40270025 TTATCAAAGAAAAAGAGGGCTGG + Intronic
1053910636 9:42899357-42899379 TTATCAAAGAAAAAGAGGGCTGG + Intergenic
1054088116 9:60766417-60766439 TATTGAAAGAACAAGAGAGTAGG + Intergenic
1054243387 9:62637665-62637687 TATTGAAAGAACAAGAGAGTAGG + Intergenic
1054372392 9:64416304-64416326 TTATCAAAGAAAAAGAGGGCTGG + Intergenic
1054524338 9:66106216-66106238 TTATCAAAGAAAAAGAGGGCTGG - Intergenic
1054557511 9:66672186-66672208 TATTGAAAGAACAAGAGAGTAGG + Intergenic
1054680010 9:67906002-67906024 TTATCAAAGAAAAAGAGGGCTGG + Intergenic
1054834360 9:69660851-69660873 TTTTGAAAGGACAAGAGAGATGG + Intronic
1055894669 9:81161611-81161633 TATTCAAACAAGAACAGGGCAGG + Intergenic
1059527399 9:115005332-115005354 GATTCAAAGCACAAGAGAGAAGG - Intergenic
1185740330 X:2526830-2526852 TATTTCTAGGGCAAGAGGGCAGG + Intergenic
1186389633 X:9145976-9145998 TATTCAAATGTCAAGAGCGCTGG - Intronic
1193769666 X:85573791-85573813 TATAGAAAGGACAAAAGGGTGGG + Intergenic
1194433734 X:93844050-93844072 TTTTCAAAGGACAAAAAGTCAGG + Intergenic
1195504021 X:105636159-105636181 GATTCAGAGGACAAGGGGGAAGG + Intronic
1196327882 X:114429454-114429476 TATCAAAAGGACAAGAGGCCGGG - Intergenic
1196769213 X:119276926-119276948 TATCCAAAAGACAACAGGCCAGG - Intergenic
1197170760 X:123431211-123431233 TAGTGGAAGGACTAGAGGGCTGG - Intronic
1197665998 X:129224129-129224151 TGGACGAAGGACAAGAGGGCAGG + Intergenic
1198556104 X:137795060-137795082 AATTAAAAGAACTAGAGGGCTGG + Intergenic
1199916076 X:152342165-152342187 TATTAAAAAGTCAATAGGGCCGG - Intronic
1201966249 Y:19739775-19739797 TATCCAAAGAACAAGAGGAGTGG - Intronic