ID: 1161741028

View in Genome Browser
Species Human (GRCh38)
Location 19:6021416-6021438
Sequence TGAATTTCTCTGACGGCACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 104}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161741028_1161741037 -4 Left 1161741028 19:6021416-6021438 CCGAGTGCCGTCAGAGAAATTCA 0: 1
1: 0
2: 1
3: 10
4: 104
Right 1161741037 19:6021435-6021457 TTCACCTGGGAAAGGGGATGGGG 0: 1
1: 0
2: 6
3: 38
4: 383
1161741028_1161741046 24 Left 1161741028 19:6021416-6021438 CCGAGTGCCGTCAGAGAAATTCA 0: 1
1: 0
2: 1
3: 10
4: 104
Right 1161741046 19:6021463-6021485 GCCACGGAGGGACTGGAGGGAGG 0: 1
1: 1
2: 11
3: 43
4: 494
1161741028_1161741041 12 Left 1161741028 19:6021416-6021438 CCGAGTGCCGTCAGAGAAATTCA 0: 1
1: 0
2: 1
3: 10
4: 104
Right 1161741041 19:6021451-6021473 GATGGGGTCGCCGCCACGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 35
1161741028_1161741034 -10 Left 1161741028 19:6021416-6021438 CCGAGTGCCGTCAGAGAAATTCA 0: 1
1: 0
2: 1
3: 10
4: 104
Right 1161741034 19:6021429-6021451 GAGAAATTCACCTGGGAAAGGGG 0: 1
1: 0
2: 1
3: 36
4: 287
1161741028_1161741044 21 Left 1161741028 19:6021416-6021438 CCGAGTGCCGTCAGAGAAATTCA 0: 1
1: 0
2: 1
3: 10
4: 104
Right 1161741044 19:6021460-6021482 GCCGCCACGGAGGGACTGGAGGG 0: 1
1: 3
2: 3
3: 28
4: 128
1161741028_1161741043 20 Left 1161741028 19:6021416-6021438 CCGAGTGCCGTCAGAGAAATTCA 0: 1
1: 0
2: 1
3: 10
4: 104
Right 1161741043 19:6021459-6021481 CGCCGCCACGGAGGGACTGGAGG 0: 1
1: 0
2: 3
3: 13
4: 135
1161741028_1161741042 17 Left 1161741028 19:6021416-6021438 CCGAGTGCCGTCAGAGAAATTCA 0: 1
1: 0
2: 1
3: 10
4: 104
Right 1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG 0: 1
1: 0
2: 0
3: 5
4: 75
1161741028_1161741036 -5 Left 1161741028 19:6021416-6021438 CCGAGTGCCGTCAGAGAAATTCA 0: 1
1: 0
2: 1
3: 10
4: 104
Right 1161741036 19:6021434-6021456 ATTCACCTGGGAAAGGGGATGGG 0: 1
1: 0
2: 3
3: 25
4: 255
1161741028_1161741040 11 Left 1161741028 19:6021416-6021438 CCGAGTGCCGTCAGAGAAATTCA 0: 1
1: 0
2: 1
3: 10
4: 104
Right 1161741040 19:6021450-6021472 GGATGGGGTCGCCGCCACGGAGG 0: 1
1: 0
2: 0
3: 9
4: 73
1161741028_1161741035 -6 Left 1161741028 19:6021416-6021438 CCGAGTGCCGTCAGAGAAATTCA 0: 1
1: 0
2: 1
3: 10
4: 104
Right 1161741035 19:6021433-6021455 AATTCACCTGGGAAAGGGGATGG 0: 1
1: 1
2: 5
3: 27
4: 343
1161741028_1161741039 8 Left 1161741028 19:6021416-6021438 CCGAGTGCCGTCAGAGAAATTCA 0: 1
1: 0
2: 1
3: 10
4: 104
Right 1161741039 19:6021447-6021469 AGGGGATGGGGTCGCCGCCACGG 0: 1
1: 0
2: 0
3: 9
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161741028 Original CRISPR TGAATTTCTCTGACGGCACT CGG (reversed) Intronic
906875394 1:49532780-49532802 TGAATTTCTGTGCCATCACTTGG - Intronic
911977341 1:104516027-104516049 TTAATTTCTCTACCGGCGCTGGG - Intergenic
915227258 1:154420135-154420157 AGCATTTTTCTGAGGGCACTGGG + Intronic
918171983 1:182006045-182006067 TGCATTTCTCTGATGGCAGAAGG + Intergenic
923814293 1:237358489-237358511 TGACTTTCTCTGTGGGCGCTTGG + Intronic
924575598 1:245277965-245277987 TCAATTTCACTGACGGCTCATGG + Intronic
1068848619 10:61709520-61709542 TGAATTTGTGTGAAGGCACTAGG - Intronic
1075979338 10:126723400-126723422 AGAATTTCTCCGGCTGCACTGGG - Intergenic
1076356068 10:129854789-129854811 TGAATTTCAATCACAGCACTCGG + Intronic
1078927607 11:15888655-15888677 TGAATTTTACTGAGGCCACTTGG - Intergenic
1083280439 11:61623709-61623731 GGAAATTCTCTGACTCCACTTGG + Intergenic
1085183814 11:74558707-74558729 AGAATTGCACTGAGGGCACTGGG - Intronic
1086328271 11:85726990-85727012 TGTATTTCTCTCTCTGCACTTGG + Intronic
1089985430 11:122808468-122808490 TGAATTTCCCTGAGGGAACTTGG + Intronic
1093003957 12:14032020-14032042 TGAATTCTTCTGAAGGCACTAGG - Intergenic
1094473921 12:30826905-30826927 TGCATTTCTTTGACGTCAGTTGG + Intergenic
1095398284 12:41786315-41786337 TGAATTTCTCTGGAGGCAAGAGG + Intergenic
1095630936 12:44376579-44376601 TGATTTTCTCTGACAGGACTGGG + Exonic
1098012113 12:66064309-66064331 TTTAGTTCTCTGATGGCACTTGG - Intergenic
1098446383 12:70569914-70569936 TGAATATTTTTGACAGCACTAGG + Exonic
1101417454 12:104520763-104520785 TGAATTCCCTTGAGGGCACTTGG + Intronic
1102668002 12:114592544-114592566 TTAATTCCTCTGACGCCACTGGG + Intergenic
1106646853 13:31644208-31644230 TTAATTTCTCTAGCGCCACTGGG + Intergenic
1108804402 13:54136132-54136154 AGCATTTCTCTGAAGGCTCTTGG - Intergenic
1110561716 13:76917133-76917155 TTGATTTCTCTGACGGATCTGGG + Intergenic
1113370923 13:109724771-109724793 TGAATTGCTCTGATGGCCCTGGG + Intergenic
1117237635 14:53795229-53795251 TTAATTTCCCTGAGGGAACTTGG - Intergenic
1122827958 14:104380642-104380664 TGAAAATGGCTGACGGCACTGGG + Intergenic
1127452682 15:59132030-59132052 TGAATTTCTCTGTCAGCAAGAGG - Intergenic
1129637525 15:77336740-77336762 TACATTTTTCTGATGGCACTTGG - Intronic
1129955376 15:79631440-79631462 TGCATTGCCCTGATGGCACTTGG + Intergenic
1133845732 16:9452060-9452082 TTAATTTCTCTGAGTGCACTGGG - Intergenic
1135621963 16:23963624-23963646 TGATCTTCTCTGATGTCACTAGG + Intronic
1137464139 16:48692619-48692641 TTCATATCTCTGACAGCACTAGG + Intergenic
1137598523 16:49740691-49740713 TCAATGTCTCTGACGGACCTTGG - Intronic
1141577964 16:84976843-84976865 TGAAATTTACTGACTGCACTGGG + Intronic
1145106971 17:20125963-20125985 TGACTTTCTCTGTTGGCACAAGG + Intronic
1146407671 17:32553284-32553306 TGAATTTCTCAGAGGTCCCTTGG - Intronic
1152302765 17:79505083-79505105 TGAACTTCTCTGCCTGCCCTGGG - Intronic
1155013905 18:21812814-21812836 TGAAATTCTCTTTTGGCACTAGG + Intronic
1155153134 18:23137286-23137308 TGAAGTTATCTGGCGGCATTAGG + Intronic
1157719415 18:49912329-49912351 TGAAATTCTTGGAGGGCACTGGG - Intronic
1159730575 18:72022432-72022454 GGAATTTCCCTCAAGGCACTAGG - Intergenic
1161741028 19:6021416-6021438 TGAATTTCTCTGACGGCACTCGG - Intronic
1161837787 19:6659746-6659768 TGAATTTCTCTGTCCGTGCTGGG - Intergenic
1165253494 19:34558719-34558741 TGAATTTCTCTGTCTGTGCTGGG - Intergenic
1165708914 19:37995743-37995765 TGAATTTGTCTTATGTCACTGGG + Intronic
1166580899 19:43898326-43898348 TGAATTTCTCTGATGACTCATGG - Intronic
1166899642 19:46049668-46049690 TGATTTTCTCTATCGGCCCTGGG + Intronic
925560165 2:5183175-5183197 TGAATTTCTCTGACGTGCCTTGG - Intergenic
927435365 2:23061644-23061666 TGAATTTCTGTGACGGCAGTGGG - Intergenic
928435119 2:31249836-31249858 TGAATTTCTCTGTATGCATTTGG - Intronic
929604421 2:43225632-43225654 GGGATTCCTCCGACGGCACTCGG - Exonic
931714721 2:65019953-65019975 TGATCTTCCCTGAGGGCACTGGG - Intronic
933011445 2:77069188-77069210 TTAATTTCTCTAGCGCCACTGGG + Intronic
934998244 2:98986930-98986952 TTAATTTCTCTGAAGACAATGGG + Intergenic
939230024 2:139412514-139412536 TCAATTTCTCTGACTTCCCTAGG - Intergenic
940100610 2:150034381-150034403 TAAATATCTTTGATGGCACTGGG + Intergenic
1178142806 21:29702824-29702846 TTATTTTCTCTGAAGGCTCTGGG - Intronic
1178307772 21:31504639-31504661 TCAATGTCTCTGACTGCACCAGG + Intronic
1181391642 22:22587585-22587607 TGAATATCTCTAAAGGTACTGGG + Intergenic
1182919749 22:34068451-34068473 TGAATTTCTCTGCCTCCAGTTGG + Intergenic
1182986245 22:34720105-34720127 GGAATTTCTGTGACCGGACTAGG + Intergenic
1184882593 22:47319977-47319999 TGAATTTCTTGGATGGCAGTTGG + Intergenic
956334876 3:68152513-68152535 TGAATTTAACTGACAGCATTAGG - Intronic
956394155 3:68806874-68806896 TGAATTTCTGTCAAGCCACTCGG + Intronic
957491186 3:80929319-80929341 TTAATTCCTCTAACGCCACTGGG + Intergenic
961620820 3:128223188-128223210 TGATTTTCCCTGACTGCACAGGG + Intronic
966230500 3:177646462-177646484 TGAATTTCACTCACAGTACTGGG - Intergenic
967594243 3:191311805-191311827 GGAATTTCTCAGAGGGCTCTGGG - Intronic
971976788 4:33699920-33699942 TGAATTCCTCTAGCGCCACTGGG + Intergenic
972337630 4:38121908-38121930 TAAATTTGTCTGATGACACTTGG - Intronic
973578597 4:52318114-52318136 GGAATTTCCCTTAAGGCACTAGG - Intergenic
976366418 4:84237757-84237779 TGATTTCCTCTGAAGGCTCTAGG - Intergenic
978607382 4:110495806-110495828 TGAATTTCTTTGGGGGCATTTGG + Intronic
979687101 4:123522935-123522957 TGCATTTCTCTTAAGGCATTAGG + Intergenic
980151703 4:129055895-129055917 TGAATTTCAAGGACAGCACTGGG - Intronic
981933750 4:150217270-150217292 TGCATGTCTCTCAGGGCACTGGG + Intronic
984595552 4:181663361-181663383 TGAATTTCTCCAAAGGCACATGG + Intergenic
985599173 5:816903-816925 TGAATTTTTCTGACCCCAGTGGG + Intronic
987482816 5:18480146-18480168 TTAATTCCTCTGGCGCCACTGGG - Intergenic
987958800 5:24776384-24776406 TGAATTTCACTGATGGCATAAGG - Intergenic
988202396 5:28084135-28084157 TGGATTCCTCTGTGGGCACTGGG - Intergenic
991303330 5:65149836-65149858 TGAATGGCTAAGACGGCACTTGG + Exonic
991605717 5:68398642-68398664 TGCATCTCTCTGGAGGCACTAGG - Intergenic
994431217 5:99663695-99663717 AGAATTCCTCTGATGGAACTGGG - Intergenic
996612516 5:125399579-125399601 TGATTTTCTCTTAAGGGACTTGG - Intergenic
997810388 5:136962151-136962173 TGAGGTTCTCTGATGGCTCTTGG - Intergenic
998251966 5:140559470-140559492 TGAGTTTATCTGGAGGCACTAGG - Intronic
999896353 5:156038123-156038145 TGAAGTTCTCTAACAGCTCTGGG - Intronic
1001906257 5:175476068-175476090 TGAATTTATATGTAGGCACTGGG - Intergenic
1011572576 6:88755017-88755039 TTAATTTCTCTAGCGCCACTGGG + Intronic
1011908285 6:92401967-92401989 TGAATTTATCTGATGGATCTGGG - Intergenic
1015134287 6:129850302-129850324 TGCATGTCTCTGAAGGCCCTGGG + Intronic
1015932831 6:138379175-138379197 TGAATTTGTCTGATAGCACTGGG + Intronic
1016209216 6:141507627-141507649 TGGATTTCTCACATGGCACTTGG + Intergenic
1021085757 7:16420242-16420264 TGAACTTCTCTGAAGCCAGTGGG - Intronic
1028888565 7:95961541-95961563 TGCATTTATGTGAAGGCACTGGG + Intronic
1032218292 7:129974359-129974381 TTAATGTCTCTGATGGTACTGGG + Intergenic
1034183068 7:149153574-149153596 TGGATTTATCAGAGGGCACTAGG + Intronic
1035793152 8:2326075-2326097 TGAATATCTCTGAACACACTTGG + Intergenic
1035799652 8:2395630-2395652 TGAATATCTCTGAACACACTTGG - Intergenic
1035911977 8:3577352-3577374 AGAATGTCTCTGAAGGAACTGGG - Intronic
1041728161 8:61037763-61037785 TGAAGTTCTCTGACAGCTCTGGG - Intergenic
1042815467 8:72873678-72873700 TGTATTTGTGTGACAGCACTGGG + Intronic
1059631474 9:116128225-116128247 TGATTTTCTCTGATGCCACCAGG - Intergenic
1059747299 9:117215355-117215377 TGAATTTCTATAAGGGAACTGGG + Intronic
1192078796 X:68027608-68027630 TTAATTTCTCTGATGGACCTGGG + Intergenic
1192904985 X:75541750-75541772 TGAATGTCTCTGACTGACCTTGG + Intergenic
1193511065 X:82400247-82400269 GGAATTCCGCTGAGGGCACTGGG - Intergenic
1195706608 X:107742160-107742182 TGACTTTCTGTGAAGGCACCCGG - Intronic
1199246852 X:145615129-145615151 TGAATTTCCTTAAAGGCACTGGG - Intergenic
1201249939 Y:12046985-12047007 TGCATTTCTCTGACGGCCAGTGG - Intergenic
1201283348 Y:12359580-12359602 TGAATTTCTCTGTCAGTGCTGGG - Intergenic
1202337338 Y:23825909-23825931 TGAATTTCTCTGTCCGTGCTGGG + Intergenic
1202533428 Y:25844162-25844184 TGAATTTCTCTGTCCGTGCTGGG - Intergenic