ID: 1161741031

View in Genome Browser
Species Human (GRCh38)
Location 19:6021423-6021445
Sequence TCCCAGGTGAATTTCTCTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 185}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161741031_1161741042 10 Left 1161741031 19:6021423-6021445 CCGTCAGAGAAATTCACCTGGGA 0: 1
1: 0
2: 2
3: 16
4: 185
Right 1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG 0: 1
1: 0
2: 0
3: 5
4: 75
1161741031_1161741041 5 Left 1161741031 19:6021423-6021445 CCGTCAGAGAAATTCACCTGGGA 0: 1
1: 0
2: 2
3: 16
4: 185
Right 1161741041 19:6021451-6021473 GATGGGGTCGCCGCCACGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 35
1161741031_1161741044 14 Left 1161741031 19:6021423-6021445 CCGTCAGAGAAATTCACCTGGGA 0: 1
1: 0
2: 2
3: 16
4: 185
Right 1161741044 19:6021460-6021482 GCCGCCACGGAGGGACTGGAGGG 0: 1
1: 3
2: 3
3: 28
4: 128
1161741031_1161741048 27 Left 1161741031 19:6021423-6021445 CCGTCAGAGAAATTCACCTGGGA 0: 1
1: 0
2: 2
3: 16
4: 185
Right 1161741048 19:6021473-6021495 GACTGGAGGGAGGACTGCAACGG 0: 1
1: 0
2: 2
3: 42
4: 325
1161741031_1161741046 17 Left 1161741031 19:6021423-6021445 CCGTCAGAGAAATTCACCTGGGA 0: 1
1: 0
2: 2
3: 16
4: 185
Right 1161741046 19:6021463-6021485 GCCACGGAGGGACTGGAGGGAGG 0: 1
1: 1
2: 11
3: 43
4: 494
1161741031_1161741043 13 Left 1161741031 19:6021423-6021445 CCGTCAGAGAAATTCACCTGGGA 0: 1
1: 0
2: 2
3: 16
4: 185
Right 1161741043 19:6021459-6021481 CGCCGCCACGGAGGGACTGGAGG 0: 1
1: 0
2: 3
3: 13
4: 135
1161741031_1161741040 4 Left 1161741031 19:6021423-6021445 CCGTCAGAGAAATTCACCTGGGA 0: 1
1: 0
2: 2
3: 16
4: 185
Right 1161741040 19:6021450-6021472 GGATGGGGTCGCCGCCACGGAGG 0: 1
1: 0
2: 0
3: 9
4: 73
1161741031_1161741039 1 Left 1161741031 19:6021423-6021445 CCGTCAGAGAAATTCACCTGGGA 0: 1
1: 0
2: 2
3: 16
4: 185
Right 1161741039 19:6021447-6021469 AGGGGATGGGGTCGCCGCCACGG 0: 1
1: 0
2: 0
3: 9
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161741031 Original CRISPR TCCCAGGTGAATTTCTCTGA CGG (reversed) Intronic
902082457 1:13830332-13830354 TCCGAGGTCGATTTCTCTGACGG - Intergenic
907686579 1:56617607-56617629 TCCCAGTTAAGCTTCTCTGAAGG - Intronic
908557604 1:65272462-65272484 TCACAGGTTAATCTCTCTCATGG - Intronic
909156537 1:72084767-72084789 TCCAACATGAGTTTCTCTGAAGG - Intronic
909267668 1:73581579-73581601 TTCCATTTGCATTTCTCTGATGG - Intergenic
913732866 1:121735820-121735842 TTTCAGTTGCATTTCTCTGATGG - Intergenic
914434581 1:147648615-147648637 GGCCAGGAGAATTTCTCTGGCGG - Intronic
915407194 1:155669614-155669636 TGCCAGTTTAATTTGTCTGACGG - Intronic
917627800 1:176863505-176863527 TCCCAGGTAGACTTTTCTGAAGG + Exonic
919533307 1:198752708-198752730 CCCCAGAAGAATTCCTCTGAAGG + Exonic
920344070 1:205294631-205294653 TCCCTGGGGAATTCCTTTGAGGG + Intergenic
921533966 1:216321890-216321912 TCCCAGGAGAGCTTCACTGAAGG - Exonic
921557045 1:216611524-216611546 TTCCAGGAGACTTTCTTTGAAGG - Intronic
1063497710 10:6525753-6525775 TCCCAGGTTGGTTTCTTTGAGGG + Intronic
1063585404 10:7347853-7347875 TCTTGGGTGAATTTCTATGAAGG - Intronic
1063949317 10:11207624-11207646 TCCCAGGGGAATTCCTGGGATGG + Intronic
1067468406 10:46518510-46518532 GCCCAGGTGACTCTCTCTGCTGG + Intergenic
1069061282 10:63897222-63897244 TTCCAGGTGGATTTGGCTGATGG + Intergenic
1073800909 10:107040271-107040293 TGCCATGTTAATTTCTCTGGGGG + Intronic
1075044147 10:119132918-119132940 TCCTAGGAGAATTTCCCTGGAGG + Intronic
1075622582 10:123938861-123938883 GCCCAGGTGACTTTCACTGGGGG + Intronic
1081860692 11:46332089-46332111 GCCCTGGTGAACTTCTCTGATGG - Intergenic
1083631440 11:64097469-64097491 TGCCTGCTGAGTTTCTCTGATGG + Intronic
1085618747 11:78021986-78022008 TCCCAGAGGAATTCATCTGAAGG - Intronic
1085997311 11:81934934-81934956 TACCAGGTGAATTTCCCAGTTGG + Intergenic
1086466081 11:87054770-87054792 TCCCATGTGTATTTCTTTCAAGG - Intronic
1086535223 11:87836211-87836233 TCAGAGGTGAAATTGTCTGAAGG - Intergenic
1086889327 11:92238200-92238222 TATCAGGTGGATTTCTTTGAGGG + Intergenic
1090089997 11:123687732-123687754 TCTCAGGAAAGTTTCTCTGAGGG + Intergenic
1092285988 12:7129628-7129650 TTCCAGATGTATTTCTGTGAAGG + Intergenic
1092595291 12:9997101-9997123 CCCCTGGAGCATTTCTCTGATGG - Intronic
1092599317 12:10041341-10041363 CCCCTGGAGCATTTCTCTGATGG + Intronic
1095818278 12:46449025-46449047 ACCCAGCTGAGTTTCCCTGAAGG - Intergenic
1096782089 12:53997424-53997446 TCCCAGGAGACTTGCTCGGATGG - Intronic
1099097724 12:78396322-78396344 ACCCAAGTTAATTTCACTGAGGG - Intergenic
1099982599 12:89623999-89624021 CACCAGTTGAATATCTCTGAAGG - Intronic
1101447894 12:104750910-104750932 GCCCAGGTGAATTTCTCTCTTGG + Intronic
1103365707 12:120381403-120381425 GCCGTGGTGAATTTCTCTGCTGG - Intergenic
1104071186 12:125347078-125347100 TCCTAGGTGAATTCCTGGGATGG + Intronic
1104572310 12:129935731-129935753 TCGCAGGTGCATTTCGGTGAGGG + Intergenic
1106212670 13:27665064-27665086 GCCCTGGTGAATTTCTGTGCAGG - Intronic
1107161554 13:37235091-37235113 TCCCTGGTGGATTTCTCTGGTGG - Intergenic
1108829671 13:54461696-54461718 TCTCATTTGAATTTCTCTGAGGG - Intergenic
1111698428 13:91655865-91655887 TCCCAGAGGAATCTCTCTTATGG + Intronic
1114807280 14:25852665-25852687 TTCCATTTGCATTTCTCTGATGG + Intergenic
1115381207 14:32741698-32741720 ACCAAGGGGAATTTATCTGAAGG - Intronic
1115419921 14:33182914-33182936 TGCCAGAAGAATTTCCCTGAAGG - Intronic
1116018886 14:39437975-39437997 TCAGATTTGAATTTCTCTGACGG + Intergenic
1118503532 14:66386505-66386527 GCCCAGGATAATTTCTCTGCTGG - Intergenic
1118659089 14:67987676-67987698 TCTCAGTTGATTATCTCTGAAGG + Intronic
1121113135 14:91326083-91326105 ACCCAGGTGCCTTTATCTGATGG - Intronic
1123579741 15:21704813-21704835 TGACAGGTGAGTTTATCTGAAGG - Intergenic
1123616368 15:22147324-22147346 TGACAGGTGAGTTTATCTGAAGG - Intergenic
1125881188 15:43197498-43197520 TCCCAGGTTCATTGCTCTGCTGG + Intronic
1126756009 15:51925451-51925473 TCCCAGGTCAATTTCACTCCAGG + Intronic
1131576514 15:93597183-93597205 TCCAAGTTGATTTTCTCTGTTGG + Intergenic
1132266967 15:100482673-100482695 TCCTTGGTGACTTTCTCTCATGG - Intronic
1202988611 15_KI270727v1_random:439058-439080 TGACAGGTGAGTTTATCTGAAGG - Intergenic
1134358228 16:13504684-13504706 GCCCAGTTGAAATCCTCTGAGGG - Intergenic
1134749366 16:16613692-16613714 TCCCAGGTGGATGTCTTTGAAGG + Intergenic
1134996105 16:18739931-18739953 TCCCAGGTGGATGTCTTTGAAGG - Intergenic
1135714264 16:24747644-24747666 TTCCAGTTGGCTTTCTCTGAAGG + Intronic
1137764210 16:50965354-50965376 TCCCTGGTGATGTTTTCTGAAGG + Intergenic
1138653965 16:58479822-58479844 TTTCACGTGCATTTCTCTGACGG + Intronic
1143967123 17:10763681-10763703 TCCCATGAGAAATTCTCTGTTGG + Intergenic
1146130899 17:30274142-30274164 TCCCAGGTGAATGTCTCTGGTGG + Exonic
1146446621 17:32937351-32937373 TGCCACGTGAGTTCCTCTGAGGG + Intronic
1146762082 17:35487618-35487640 GCCCACGTGAATAGCTCTGAGGG + Intronic
1147122879 17:38346016-38346038 CCCCAGGAGAATCTCTATGATGG + Intergenic
1148699770 17:49580404-49580426 TCCAGGAAGAATTTCTCTGATGG + Intronic
1150801732 17:68288451-68288473 GGCCATGTGAATTTATCTGACGG + Intronic
1152166910 17:78715102-78715124 TCCTATGAGAATTTCTCTGTGGG - Intronic
1154411543 18:14144651-14144673 GCCCAGGTGCAGCTCTCTGATGG - Intergenic
1155211665 18:23607324-23607346 TACCAGGAGCATTTCTCTGCAGG - Intronic
1155779361 18:29811597-29811619 TGCCAGTTGAAGCTCTCTGATGG - Intergenic
1156636892 18:39042538-39042560 TCCAAGTGGAATTTCTCTGCTGG + Intergenic
1157550656 18:48579687-48579709 TCCCAGGTCCCTTTCTCAGATGG + Intronic
1157653010 18:49356292-49356314 TACCAGGAAAAATTCTCTGAAGG + Intronic
1158423020 18:57312881-57312903 GCCCAGGTGATTTCCTGTGAGGG - Intergenic
1158510714 18:58088099-58088121 TGCCAGGTGGACTTCTCTGAGGG + Intronic
1158512301 18:58101323-58101345 GCCCAGCTGTGTTTCTCTGAGGG + Intronic
1161565329 19:4998813-4998835 CCCCAGGTGGGTTTGTCTGATGG + Intronic
1161741031 19:6021423-6021445 TCCCAGGTGAATTTCTCTGACGG - Intronic
1163206226 19:15804946-15804968 TTCCATTTGCATTTCTCTGATGG + Intergenic
1163521564 19:17794987-17795009 GCCCAGGCGAAGTTCTCTGCCGG - Intronic
1164631339 19:29763720-29763742 TCCCAAGTGAATGACTCTGGTGG + Intergenic
1168130936 19:54318111-54318133 GCCCAGGTGAAGGTCTCTGCAGG - Intergenic
925595464 2:5551734-5551756 TGCTAGGTGGATTTCCCTGATGG - Intergenic
925844891 2:8026330-8026352 TCTCAGGTGCAGTTCTCTGGAGG - Intergenic
926220522 2:10932915-10932937 TCCCAGGTGGCTTTCCCAGAGGG - Intergenic
926859656 2:17295490-17295512 TGCAAGGTGAATTTCTCATATGG - Intergenic
929071536 2:38036495-38036517 TCCCAGCTTAATTTCTCTTGGGG - Intronic
929664582 2:43823709-43823731 CACCAGGTGGATCTCTCTGAGGG - Intronic
929997576 2:46838421-46838443 TCCCAGCTAAATTTCTCAGGCGG - Intronic
932709743 2:74053719-74053741 TCCCATTTGAAATTCCCTGATGG - Intronic
933091455 2:78124174-78124196 TCAAAGGTGAATTCCTTTGATGG - Intergenic
934994195 2:98942019-98942041 TCCCATTTGAACTTCTGTGAGGG + Intergenic
935036652 2:99382931-99382953 TCCTAGGTTAATTTTTCAGAAGG - Intronic
935199137 2:100840764-100840786 GCACATGTGACTTTCTCTGATGG - Intronic
935309135 2:101765883-101765905 ACCCGGTTGAATTTCTCTAAAGG + Intronic
936850628 2:116893719-116893741 TTCCAGATGGATTTCTCTGCAGG - Intergenic
938789858 2:134666900-134666922 TCCCAGGACGATGTCTCTGAAGG - Intronic
940384523 2:153055203-153055225 TCCTAGGTCAATATCTCTGGAGG - Intergenic
943472560 2:188312843-188312865 TGGCATGTGCATTTCTCTGATGG + Intronic
944005054 2:194894731-194894753 TCTCTGGTGATTTTCTCTGGTGG + Intergenic
946552724 2:220821233-220821255 TCTCAGTTGAATTTGTCTGATGG + Intergenic
947058311 2:226133241-226133263 TCTCAGGTGAGGTTCTGTGAGGG - Intergenic
947660218 2:231860941-231860963 TCCCAGGTGACTGACTGTGATGG + Intergenic
947895906 2:233671916-233671938 TCTCAGCTGCAGTTCTCTGATGG + Exonic
1169473317 20:5907601-5907623 TCCCAGCTGGATTCCTCTGATGG + Intergenic
1170725566 20:18923316-18923338 TCTCAGGTATCTTTCTCTGATGG - Intergenic
1172092267 20:32441783-32441805 TCCCAGGAGAAATTGCCTGAGGG - Intergenic
1173141551 20:40489356-40489378 TCTCAGGTAAATTTCTCTTGTGG + Intergenic
1176291329 21:5046524-5046546 TGCCAGGTGACCTGCTCTGATGG - Intergenic
1176861512 21:14013773-14013795 GCCCAGGTGCAGCTCTCTGATGG + Intergenic
1178175021 21:30086734-30086756 TCCAAGATGAATCTCTTTGATGG + Intergenic
1179590089 21:42402195-42402217 TCCCATTTGTATTTCCCTGAGGG - Intergenic
1179865926 21:44217117-44217139 TGCCAGGTGACCTGCTCTGATGG + Intergenic
1179959156 21:44758593-44758615 TACCAGGTGAGTGTCTCTGCAGG - Intergenic
1180999049 22:19979461-19979483 TCCCAGGAGAGTTTCTGTGGGGG + Intronic
1182836887 22:33349436-33349458 TCCCACATGATTCTCTCTGAGGG + Intronic
951772721 3:26276630-26276652 TCCCTGGTGAATATCACAGAGGG - Intergenic
955431954 3:58855253-58855275 TCTGAGTTGCATTTCTCTGATGG - Intronic
955514435 3:59712791-59712813 TCTTAGGTGATTTTCTCTCAAGG - Intergenic
956729739 3:72185681-72185703 TCCCAGGTGGCTTACTCTTAAGG - Intergenic
957209667 3:77243503-77243525 ACCCAGATGATTTTCTCTTATGG - Intronic
957374914 3:79343549-79343571 TCTCAGGTGCATTTCTGTGAAGG - Intronic
958547329 3:95571418-95571440 TGCCATATTAATTTCTCTGATGG + Intergenic
961199178 3:125030334-125030356 TCCAAATTGAATTTATCTGAAGG + Intronic
962178676 3:133182395-133182417 TCTCAGGCGGCTTTCTCTGAAGG - Intronic
963111330 3:141690719-141690741 TCAAAGATGAATTCCTCTGATGG - Intergenic
963843462 3:150131158-150131180 TCCCAGGTGAAGCCCTCAGATGG - Intergenic
967037150 3:185656353-185656375 ACCAAAGTGAAATTCTCTGATGG + Intronic
969641158 4:8399499-8399521 TCCCAGGTGCCTTCCTCTGCAGG - Intronic
972016623 4:34254358-34254380 TTCCAGGGGAATTTCTCAGCAGG + Intergenic
972156441 4:36169258-36169280 TTCCAGGTTATATTCTCTGACGG + Intronic
972888758 4:43527564-43527586 TTCGATTTGAATTTCTCTGATGG - Intergenic
976121380 4:81786483-81786505 TTCCTGGTGTCTTTCTCTGAAGG - Intronic
979673263 4:123383677-123383699 TTGCATGTGAAATTCTCTGAAGG + Intergenic
980597514 4:134973212-134973234 TCCAAGGTAATTTTCTCTGGTGG - Intergenic
981199277 4:141960244-141960266 TTCAATGTGAATTTATCTGAAGG - Intergenic
982184389 4:152780660-152780682 TGCCAGATGAATCTCTCAGAGGG - Intronic
986068934 5:4263640-4263662 TCCCAGGTGAATTTTTACAATGG + Intergenic
986133331 5:4950737-4950759 TCCAAGATGAATTTCTCGGCAGG + Intergenic
993636863 5:90354705-90354727 TCCCAGGTGAGTTTCTTAGGTGG + Intergenic
995286647 5:110396365-110396387 TCCCAGGTGAATATCTATATAGG - Intronic
997818425 5:137040001-137040023 TCCCAGGAGAGCTTCTCTGAAGG + Intronic
999660995 5:153862762-153862784 TCCTGGGTGAGTATCTCTGAAGG - Intergenic
1000146641 5:158459815-158459837 TTCCAAGTGAATTTCCCTGGAGG - Intergenic
1000157592 5:158567078-158567100 ACCCAGGTGAATTTTTATAATGG + Intergenic
1000891322 5:166805659-166805681 TCCCCAGTGAAATTCTCTCATGG + Intergenic
1003224266 6:4190266-4190288 TCGCAGGTGGAATGCTCTGACGG + Intergenic
1004001103 6:11598140-11598162 TCCCATGGGAATTTCTTTTAAGG - Intergenic
1004021475 6:11779724-11779746 TGTCAGGAGCATTTCTCTGAGGG - Intronic
1006683380 6:35813163-35813185 TTCCAGGTGATTTTCTCAGTAGG - Intronic
1007527530 6:42509568-42509590 TCCCAAGTGAGTTTCCTTGATGG + Intergenic
1007830487 6:44634619-44634641 ACACAGGTGAATTTCTCATAAGG - Intergenic
1009374142 6:62946855-62946877 TCCCAGTTGAATTTCTTCCAAGG + Intergenic
1009398044 6:63224993-63225015 TCCCTAGTGTATGTCTCTGAGGG + Intergenic
1009758012 6:67965626-67965648 CCCTTGGTGATTTTCTCTGAAGG - Intergenic
1009938447 6:70260873-70260895 TCCAAGGAGAATTCTTCTGATGG + Intronic
1010034064 6:71301609-71301631 CCCCAGATAAAGTTCTCTGAAGG - Exonic
1011038538 6:83004248-83004270 TACCAGGAGAATTTCTCTTGAGG + Intronic
1011933641 6:92745865-92745887 TCCCTGCTGAATATCTTTGATGG + Intergenic
1012279975 6:97316648-97316670 TGCCATGTTAATTTCTCTTAGGG - Intergenic
1019194878 6:170275260-170275282 TTCTATGAGAATTTCTCTGAGGG - Intergenic
1020482630 7:8680928-8680950 TCCCAGGTGAAGTATTCAGAAGG - Intronic
1022051810 7:26682279-26682301 TCCTAGCTGAATTTGTCTGAAGG + Intronic
1023198631 7:37669104-37669126 TCCCAATAGTATTTCTCTGAAGG - Intergenic
1023585626 7:41726761-41726783 TCCCCAGCCAATTTCTCTGAAGG - Intergenic
1025617280 7:63131929-63131951 GTCCAGGTGATTTTCTCTGATGG - Intergenic
1026871376 7:73854563-73854585 TCCCATGTGAATTTCCATGTCGG + Intergenic
1029180180 7:98694952-98694974 TTCCAGGTGAATGCCACTGAGGG + Intergenic
1030108036 7:106003344-106003366 TTCCATCTGAATATCTCTGAAGG + Intronic
1033086536 7:138347352-138347374 TCCAAGGTAGTTTTCTCTGAGGG - Intergenic
1034634070 7:152553622-152553644 TACCAGGAGAATTTTGCTGAGGG + Intergenic
1035388174 7:158488564-158488586 GCCGAGGTGAATGCCTCTGAGGG - Intronic
1038484680 8:27925865-27925887 TCTCATTTGCATTTCTCTGATGG - Intronic
1040051971 8:43023844-43023866 TGACAGGTGAATTTTTGTGAGGG - Exonic
1041361094 8:57055240-57055262 TCCCAGGGGAAGTTCTCAGACGG - Intergenic
1043032363 8:75152535-75152557 TCCCAGGTTCATTTCTAAGAAGG + Intergenic
1043263794 8:78236612-78236634 TCCTATGTGTATTTCTCTGATGG - Intergenic
1043542252 8:81277388-81277410 TTCCAGGTGAAATTTTCTTAGGG + Intergenic
1044617488 8:94157143-94157165 TCACAGGTAAAATTCACTGAGGG - Intronic
1044623141 8:94210408-94210430 TCACCTGTTAATTTCTCTGATGG - Intronic
1046795588 8:118368090-118368112 TCCAAGGAGAATTTCTCTGATGG + Intronic
1046898261 8:119496470-119496492 TGGCAGGTTAATTTGTCTGAAGG - Intergenic
1047017598 8:120740024-120740046 TTCCTGCTGAATTTCTCTTAGGG - Intronic
1047472048 8:125185172-125185194 TCCCAGGTGGTTTTGTCTCAAGG + Intronic
1047689283 8:127334813-127334835 TCCCAGCTGACTTACTTTGATGG - Intergenic
1048434790 8:134406036-134406058 TTCCAGGGGAATTGCTATGATGG - Intergenic
1048701920 8:137101272-137101294 TCCCAGCTCAATTTAACTGAAGG + Intergenic
1053392589 9:37746371-37746393 TGCCAGGTGCACTTCTCTGGGGG - Exonic
1055571127 9:77617890-77617912 TGCCAGGAGTAATTCTCTGAAGG - Intronic
1058644691 9:107119759-107119781 TCCCAGTTGATTTTCTTTCATGG + Intergenic
1059593005 9:115683829-115683851 TCCCACTTGAATTTCTTTGTTGG + Intergenic
1059728549 9:117033275-117033297 TCTCAGGAGATTTTCTATGATGG + Intronic
1059814112 9:117892378-117892400 TCCCAGGTGGGGTTCTCTCAGGG + Intergenic
1062217555 9:135397465-135397487 TCCCAGGTGAGGCACTCTGAGGG - Intergenic
1186657204 X:11626297-11626319 TGACAATTGAATTTCTCTGATGG - Intronic
1186904362 X:14095510-14095532 ACCCAGGTGAATTTATTTGGGGG + Intergenic
1195461929 X:105137351-105137373 TCCAAGGGAAATTTCTGTGATGG - Intronic
1196136052 X:112210705-112210727 TCCCAGCTGAAATTTTCAGATGG + Intergenic
1201309480 Y:12583041-12583063 ACACAGGTAAATTTCTCTCATGG - Intergenic