ID: 1161741038

View in Genome Browser
Species Human (GRCh38)
Location 19:6021439-6021461
Sequence GCGACCCCATCCCCTTTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161741038_1161741042 -6 Left 1161741038 19:6021439-6021461 CCTGGGAAAGGGGATGGGGTCGC No data
Right 1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG 0: 1
1: 0
2: 0
3: 5
4: 75
1161741038_1161741051 30 Left 1161741038 19:6021439-6021461 CCTGGGAAAGGGGATGGGGTCGC No data
Right 1161741051 19:6021492-6021514 ACGGTATAGTAAGTTGAGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 65
1161741038_1161741049 26 Left 1161741038 19:6021439-6021461 CCTGGGAAAGGGGATGGGGTCGC No data
Right 1161741049 19:6021488-6021510 TGCAACGGTATAGTAAGTTGAGG 0: 1
1: 0
2: 0
3: 4
4: 68
1161741038_1161741044 -2 Left 1161741038 19:6021439-6021461 CCTGGGAAAGGGGATGGGGTCGC No data
Right 1161741044 19:6021460-6021482 GCCGCCACGGAGGGACTGGAGGG 0: 1
1: 3
2: 3
3: 28
4: 128
1161741038_1161741043 -3 Left 1161741038 19:6021439-6021461 CCTGGGAAAGGGGATGGGGTCGC No data
Right 1161741043 19:6021459-6021481 CGCCGCCACGGAGGGACTGGAGG 0: 1
1: 0
2: 3
3: 13
4: 135
1161741038_1161741046 1 Left 1161741038 19:6021439-6021461 CCTGGGAAAGGGGATGGGGTCGC No data
Right 1161741046 19:6021463-6021485 GCCACGGAGGGACTGGAGGGAGG 0: 1
1: 1
2: 11
3: 43
4: 494
1161741038_1161741050 29 Left 1161741038 19:6021439-6021461 CCTGGGAAAGGGGATGGGGTCGC No data
Right 1161741050 19:6021491-6021513 AACGGTATAGTAAGTTGAGGTGG 0: 1
1: 0
2: 0
3: 35
4: 153
1161741038_1161741048 11 Left 1161741038 19:6021439-6021461 CCTGGGAAAGGGGATGGGGTCGC No data
Right 1161741048 19:6021473-6021495 GACTGGAGGGAGGACTGCAACGG 0: 1
1: 0
2: 2
3: 42
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161741038 Original CRISPR GCGACCCCATCCCCTTTCCC AGG (reversed) Intronic
No off target data available for this crispr