ID: 1161741042

View in Genome Browser
Species Human (GRCh38)
Location 19:6021456-6021478
Sequence GGTCGCCGCCACGGAGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 75}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161741031_1161741042 10 Left 1161741031 19:6021423-6021445 CCGTCAGAGAAATTCACCTGGGA 0: 1
1: 0
2: 2
3: 16
4: 185
Right 1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG 0: 1
1: 0
2: 0
3: 5
4: 75
1161741028_1161741042 17 Left 1161741028 19:6021416-6021438 CCGAGTGCCGTCAGAGAAATTCA 0: 1
1: 0
2: 1
3: 10
4: 104
Right 1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG 0: 1
1: 0
2: 0
3: 5
4: 75
1161741038_1161741042 -6 Left 1161741038 19:6021439-6021461 CCTGGGAAAGGGGATGGGGTCGC No data
Right 1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG 0: 1
1: 0
2: 0
3: 5
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161741042 Original CRISPR GGTCGCCGCCACGGAGGGAC TGG Intronic
900213533 1:1468779-1468801 GGTGGCTGCCACGGCGGGGCCGG + Exonic
901793035 1:11664423-11664445 GGTCGCGTCCCCGGGGGGACGGG + Intronic
916660744 1:166920763-166920785 GGTCGCGGCCGCGGTAGGACGGG + Exonic
921934732 1:220786389-220786411 GCTCGCCGGCGCGGAGGGCCTGG + Intergenic
922536268 1:226383091-226383113 CGTGGCCGCCACGGAGGCGCTGG + Exonic
1062970798 10:1646886-1646908 GGTCGCAGGCACGCAGGCACTGG - Intronic
1068544506 10:58330845-58330867 GCTCGCCACCACAGAGGGAAAGG - Intergenic
1076630176 10:131847589-131847611 GGCCGAGGCCAGGGAGGGACAGG + Intergenic
1077135391 11:995599-995621 GGTCCCCGCCAAGGAGTGCCAGG - Intronic
1077237575 11:1489075-1489097 GGTCGCAACCAAGGCGGGACGGG + Intronic
1101482118 12:105108035-105108057 GGTCCCAGCCACGGCGGGTCAGG + Intronic
1102678082 12:114672075-114672097 GGCCGCCGCCATGGAGGGCAGGG + Exonic
1108648160 13:52450612-52450634 GCTCGCGGCCTCGGAGGGCCGGG - Exonic
1114031530 14:18584240-18584262 CGCAGCCGCCAGGGAGGGACTGG - Intergenic
1128865940 15:71115369-71115391 GGTCGCCGCCAGGGGGCGGCAGG + Exonic
1131056702 15:89379177-89379199 GGCAGCCGCGACGGAGGGTCCGG - Intergenic
1131484592 15:92809359-92809381 CGTGGCCGGCCCGGAGGGACAGG + Intronic
1136276288 16:29181091-29181113 GGACGAGGCCACGGAGAGACTGG + Intergenic
1140857872 16:78993676-78993698 TGTGGCTGCCACGGGGGGACAGG + Intronic
1141957781 16:87383899-87383921 GGTCGCCGCCCCGCGGGGAGGGG - Intronic
1142080669 16:88147150-88147172 GGACGAGGCCACGGAGAGACTGG + Intergenic
1142303941 16:89275162-89275184 GGGCTCCGCCAGGGAGGGAGGGG + Exonic
1145059696 17:19724813-19724835 GCTCGCCGCCCCTGAGGGGCTGG - Intergenic
1145814171 17:27783578-27783600 CGGAGCTGCCACGGAGGGACTGG - Intronic
1146034059 17:29390718-29390740 CGTCGCCGCCTCGGGGGAACCGG - Exonic
1152642889 17:81456553-81456575 GGACGCAGCCACGGAGGGCTGGG - Exonic
1152757083 17:82091552-82091574 CGTTGCCGCCACGGACGGGCAGG + Exonic
1152758711 17:82097718-82097740 GGACGCCGCGAGGGAGGAACGGG - Intronic
1159040561 18:63319994-63320016 GGCCGCCGGCAGGGAGGGCCCGG + Exonic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1162926992 19:13935782-13935804 GATCCGCGACACGGAGGGACCGG + Exonic
1168154109 19:54463687-54463709 GCTCTCCACCAAGGAGGGACTGG - Exonic
931869774 2:66445450-66445472 GTTCAGCGCCCCGGAGGGACAGG - Intronic
932633097 2:73363662-73363684 GGTCTCCGCCACTGTGGGATAGG - Intergenic
935347243 2:102119949-102119971 GGTGGCTGCCAAGGAGGGAAGGG - Intronic
938496666 2:131801553-131801575 CGCAGCCGCCAGGGAGGGACTGG + Exonic
940076362 2:149746598-149746620 GGTTGCTGCCACCGAGGGACTGG - Intergenic
946396999 2:219448240-219448262 GGTGCCCGCCAGGGAGGGCCCGG - Exonic
948620335 2:239230594-239230616 AGTGGCCCCCACGGAAGGACTGG - Intronic
948835467 2:240624132-240624154 GGCCGCCGTCAAGCAGGGACTGG - Intronic
1171997044 20:31739488-31739510 GGTCGCCGCCTAGGCGGGGCAGG + Exonic
1176076336 20:63250051-63250073 GGTCGCCGCCCTGGAGAGGCAGG - Exonic
1180455642 22:15511297-15511319 CGCAGCCGCCAGGGAGGGACTGG - Intergenic
1180831011 22:18906145-18906167 TGCAGCCACCACGGAGGGACGGG + Intronic
1183156703 22:36081338-36081360 GGCCGCTGCCACAAAGGGACAGG - Intergenic
1185268883 22:49919121-49919143 GGTCGACGCCACCGTGGGCCTGG + Intronic
1203281098 22_KI270734v1_random:131416-131438 TGCAGCCACCACGGAGGGACGGG + Intergenic
960684759 3:120285280-120285302 GGGCGGCGCCAGGGAGGGGCGGG - Intergenic
961236963 3:125375348-125375370 GGTCGCCGCCACTGCCGGCCCGG + Exonic
961340303 3:126213041-126213063 GGGCGCCCCCAGGAAGGGACAGG + Intergenic
967131358 3:186473595-186473617 GGTCTCCACCAAGGAGGCACAGG + Intergenic
967904143 3:194486922-194486944 GGGCGCCGCCGCGGAGGGGAGGG - Intronic
968603329 4:1520608-1520630 GGTCGCCGCCGCGTAGGGAGGGG - Intergenic
970332942 4:15003490-15003512 CGGCGCCGCCACGGAGGCGCGGG + Exonic
980130527 4:128812167-128812189 GGACGCCGCTGCGGAGGGAGCGG + Intronic
985126373 4:186698752-186698774 CGGCTCCGCCACGGAGAGACTGG + Intronic
985541308 5:488882-488904 GGGCGCGGCCAGGGAGGGGCAGG + Intronic
985764420 5:1769265-1769287 GGTCGTCGCCAGGGAGCGCCAGG - Intergenic
986206188 5:5627459-5627481 GGCTGCAGCCACGGAGGGGCAGG + Intergenic
1002600329 5:180350899-180350921 GGTCTCCGCCCCTGAGGGAACGG + Intronic
1006535593 6:34696591-34696613 GGTCCCCGCCATGGAGGGCATGG - Exonic
1006840000 6:37022522-37022544 GGTGGAGGCCTCGGAGGGACAGG - Intronic
1019313584 7:374540-374562 GGTAGCCGCCGCGGTGGGAGTGG - Intergenic
1024996695 7:55278046-55278068 GGACCCGGCCACAGAGGGACTGG - Intergenic
1029640624 7:101817017-101817039 GGGGTCCGCCACGGAGGAACAGG - Intronic
1033742351 7:144284741-144284763 TGTCTCCACCACGGAGGGATGGG + Intergenic
1033751551 7:144364873-144364895 TGTCTCCACCACGGAGGGATGGG - Exonic
1039469970 8:37807275-37807297 GAAGGCAGCCACGGAGGGACGGG + Intronic
1044306466 8:90645935-90645957 GGGCGCCGCGGCGGAGGGGCTGG - Exonic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1049439286 8:142601854-142601876 GGACGCTGCCAGGGAGGGACAGG + Intergenic
1049532293 8:143160491-143160513 GGGCGCCGCGAGGGAGGGAGCGG - Intronic
1053399029 9:37801137-37801159 GGCCGCCGGCACGGAGGGGAGGG - Exonic
1059234704 9:112751333-112751355 GGTCGCAGCCGCAGAGGGACAGG + Intronic
1061050343 9:128191461-128191483 AGTCGCCCCCACGGATGGGCCGG + Exonic
1061853632 9:133429701-133429723 GGGAGCGGCGACGGAGGGACGGG - Intronic
1062128768 9:134881280-134881302 GGTCGCCATCACAGAGAGACAGG + Intronic
1185466143 X:355461-355483 TGTCGTAGCAACGGAGGGACCGG + Intronic
1186669996 X:11758364-11758386 AGGTGCCGCCGCGGAGGGACAGG + Exonic
1187648291 X:21374025-21374047 GGTGGCGGCCACGGCGGGACGGG - Intergenic
1199336048 X:146620079-146620101 GGGCTCCGCCAGGGAGGGAGGGG + Intergenic