ID: 1161746632

View in Genome Browser
Species Human (GRCh38)
Location 19:6064097-6064119
Sequence TGCTACGTAGGGTCTGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161746632 Original CRISPR TGCTACGTAGGGTCTGGGGT TGG (reversed) Intronic
901919513 1:12526128-12526150 TGCAGCAAAGGGTCTGGGGTGGG + Intergenic
902287750 1:15417586-15417608 AGCTAAGTGGGGTATGGGGTTGG - Intronic
902375443 1:16028114-16028136 TACTAGGTAGGCTCTGGGCTAGG + Exonic
902898769 1:19498775-19498797 TGCTACTCAGGGGCTGAGGTGGG - Intergenic
904462165 1:30686530-30686552 TGGAACGCAGGGGCTGGGGTGGG + Intergenic
904837552 1:33349303-33349325 TCCTAGGTTGGGGCTGGGGTGGG + Intronic
905756028 1:40509543-40509565 TGTAACCTAGGATCTGGGGTGGG + Exonic
907719053 1:56954398-56954420 TGCTATGCAAGGGCTGGGGTAGG - Intronic
908773294 1:67615646-67615668 AGCTACTTGGGGTCTGAGGTGGG - Intergenic
912541945 1:110423393-110423415 AGCTACTTAGGGGCTGAGGTAGG - Intergenic
912775910 1:112506487-112506509 TTCTACACAGGGCCTGGGGTTGG - Intronic
916154205 1:161828447-161828469 TGCGGCGTAGTGTCTGGGGATGG + Intronic
918029387 1:180789849-180789871 TCCTACGCAGCCTCTGGGGTAGG - Intronic
919619999 1:199853600-199853622 AGCTACGTGGAGGCTGGGGTGGG + Intergenic
919745685 1:201008016-201008038 TGGTAGGCAGGGGCTGGGGTTGG + Intronic
924805541 1:247358661-247358683 TGTTTATTAGGGTCTGGGGTTGG - Intergenic
1064564813 10:16629186-16629208 TGATGCGGTGGGTCTGGGGTGGG + Intronic
1064858741 10:19801299-19801321 AGCTACCTAGGGGCTGAGGTGGG + Intergenic
1070774724 10:79103051-79103073 TGTTACGGAGCGGCTGGGGTGGG + Intronic
1073469901 10:103716084-103716106 TGCTGCTTGGGGCCTGGGGTGGG - Intronic
1073671541 10:105596024-105596046 AGCTACTTGGGGTCTGAGGTGGG + Intergenic
1074755839 10:116623653-116623675 TGGTTCAGAGGGTCTGGGGTGGG - Intronic
1077136644 11:1002862-1002884 TGCTTCTTAGGCACTGGGGTGGG + Intronic
1085940436 11:81200714-81200736 TGTTTATTAGGGTCTGGGGTTGG - Intergenic
1092725880 12:11485231-11485253 TGCTACTCAGAGTGTGGGGTTGG - Intronic
1096495179 12:52035910-52035932 TGCTGCGTGGGGCCTGGGCTGGG + Intronic
1096746832 12:53734333-53734355 AGCTACTTAGGGGCTGAGGTGGG + Intergenic
1098166655 12:67705383-67705405 TGGTGCGTAGGGGCTGGGGAAGG + Intergenic
1104541059 12:129665134-129665156 TTTGAGGTAGGGTCTGGGGTAGG - Intronic
1105524241 13:21161008-21161030 TGCTACGTGGGGGCTGAGGTGGG + Intronic
1110600288 13:77364963-77364985 TGCTATGTATGTTCTGAGGTTGG + Intergenic
1113290303 13:108898506-108898528 AGCTACGTTTGGTCTGGGTTTGG - Intronic
1113736029 13:112679633-112679655 TGCCAGGTAGGGGCTGGGGAGGG + Exonic
1114178131 14:20342517-20342539 TGAATCGGAGGGTCTGGGGTGGG + Intergenic
1121114441 14:91333744-91333766 TACTCCCTAGGGTCTAGGGTGGG + Intronic
1121752356 14:96368289-96368311 AGCTACTTAGGGGCTGAGGTAGG - Intronic
1128124076 15:65177906-65177928 AGCTACTTAGGGGCTGAGGTAGG - Intronic
1130927806 15:88398266-88398288 TGCTCCCATGGGTCTGGGGTAGG + Intergenic
1132813833 16:1816689-1816711 TGCCTCGGAGGGTCTGGAGTAGG - Intronic
1134140490 16:11714151-11714173 AGCTACTTAGGGGCTGAGGTGGG - Intronic
1135837350 16:25838594-25838616 GGCTATTTAGGATCTGGGGTGGG + Intronic
1135940131 16:26815181-26815203 TGCTACTTGGGGGCTGAGGTGGG + Intergenic
1139796128 16:69484441-69484463 TGCTGCAAAGGTTCTGGGGTTGG + Intergenic
1143164524 17:4891379-4891401 TGCGAATTGGGGTCTGGGGTGGG - Intronic
1143772798 17:9179244-9179266 TGCAAAGTAGGGTCAGGTGTTGG + Intronic
1147239766 17:39083125-39083147 TGATACAGAGGGTCTGGGATGGG + Intronic
1147880387 17:43649792-43649814 GGCTATGCAGGGGCTGGGGTGGG - Intronic
1148343585 17:46888739-46888761 TGCTGCCTTGGGTCTGGGGCAGG - Intergenic
1150704770 17:67476940-67476962 TGATTCAGAGGGTCTGGGGTGGG - Intronic
1151339491 17:73461265-73461287 GGCCAGGTAGGCTCTGGGGTAGG + Intronic
1151536741 17:74743220-74743242 TGCTACCAAGGGGCTGGGGTAGG - Intronic
1151834623 17:76574569-76574591 CGTTAGGTAGGGGCTGGGGTGGG + Intronic
1154390373 18:13931608-13931630 GGCAACGTTGGGTCTGGGGCTGG + Intergenic
1157840209 18:50950431-50950453 TGATGCATAGGGCCTGGGGTGGG + Exonic
1160061726 18:75535052-75535074 TCCTAGGTAGGATGTGGGGTTGG + Intergenic
1160742716 19:694903-694925 TGCCATGTAGGGCCTGGAGTGGG + Exonic
1161090800 19:2359159-2359181 TGCCACGTGGGATCTCGGGTGGG + Intergenic
1161746632 19:6064097-6064119 TGCTACGTAGGGTCTGGGGTTGG - Intronic
1162298227 19:9828036-9828058 AGCCACCCAGGGTCTGGGGTCGG + Exonic
1166340056 19:42132129-42132151 TGTTCCGAAGGGTCTGGGGACGG - Intronic
1168697944 19:58416206-58416228 TGCTAGGAAAGGTCTGGGTTGGG - Intronic
925422597 2:3724966-3724988 TGCTAAGTTGGGTCTGGGTTGGG + Intronic
925875506 2:8308271-8308293 TGGAACGTAGGCTCTGGGGGGGG + Intergenic
927215016 2:20663524-20663546 TGCAAGGAAGGGTCTGGGGCGGG + Intergenic
929165586 2:38877906-38877928 TGCTACTTGGGGGCTGAGGTGGG - Intronic
934988985 2:98908114-98908136 TGCTACGGAGTGGCTGGGCTGGG - Intronic
935740198 2:106140570-106140592 TGCTATGGAGGGCCGGGGGTGGG - Intronic
935977107 2:108589046-108589068 TGCTGCCTAGGGTCTTTGGTGGG + Intronic
937191445 2:120104123-120104145 TTCTATGTGCGGTCTGGGGTGGG - Intronic
943338216 2:186645012-186645034 TGGTACGTAGGGTCTGTGATAGG + Intronic
943953195 2:194156630-194156652 TGTTTACTAGGGTCTGGGGTTGG + Intergenic
944854526 2:203753925-203753947 TGCTGGGAAGGGTATGGGGTAGG - Intergenic
946045462 2:216817449-216817471 TGCTACTTGGGGTAGGGGGTGGG + Intergenic
946384585 2:219374826-219374848 TGCCAGAGAGGGTCTGGGGTGGG + Intronic
948308475 2:236967913-236967935 TGATTCAGAGGGTCTGGGGTGGG - Intergenic
948765105 2:240215502-240215524 AGCTGCTTAGGGTCTGGGGCAGG - Intergenic
1171255688 20:23687724-23687746 TGCCACGTAGTGTCTGGGAGAGG - Intronic
1173995585 20:47336207-47336229 TGCTAATTAAGGTCTGGGGCTGG + Intronic
1175605189 20:60307034-60307056 GGCTAAGCAGGGCCTGGGGTTGG + Intergenic
1175740286 20:61415197-61415219 TGCTTCGGCAGGTCTGGGGTAGG - Intronic
1175878646 20:62243666-62243688 AGCTCGGGAGGGTCTGGGGTGGG + Intronic
1175987127 20:62769785-62769807 TGCCACATAGTGACTGGGGTGGG - Intergenic
1176381605 21:6116665-6116687 AGGCACGGAGGGTCTGGGGTGGG + Intronic
1179741867 21:43421574-43421596 AGGCACGGAGGGTCTGGGGTGGG - Intronic
1183054956 22:35299683-35299705 CACGATGTAGGGTCTGGGGTCGG - Intronic
954962119 3:54575873-54575895 TCCTTCTTAGGGGCTGGGGTAGG - Intronic
957289616 3:78262177-78262199 TGCTAGGTGGGGAGTGGGGTGGG - Intergenic
957576119 3:82010506-82010528 TGCTAGGAAGGCTGTGGGGTGGG + Intergenic
958959923 3:100499762-100499784 AGCTACTTAGGGTCTGAGGCAGG + Intronic
961673062 3:128548895-128548917 TGCCACGTTGTGTGTGGGGTGGG - Intergenic
963571176 3:146998411-146998433 TGCCTCGTAGGGTCTGTGGATGG + Intergenic
969110530 4:4841422-4841444 TACTAGGGAGGGTGTGGGGTGGG - Intergenic
969277454 4:6146402-6146424 TACTACTTGGGGTCTGAGGTGGG - Intronic
971049019 4:22839547-22839569 TGATAGATAGGGTCTGGTGTGGG + Intergenic
976754346 4:88482471-88482493 GGCTACGGAGGGTCTGTGGTGGG - Intronic
976850662 4:89541685-89541707 TGCTGCCTAGGGTTTGGGGAGGG - Intergenic
996150286 5:120026449-120026471 TGCTTGCTAGGGACTGGGGTGGG - Intergenic
996655288 5:125927278-125927300 TACTTATTAGGGTCTGGGGTTGG - Intergenic
996694281 5:126376660-126376682 TGCTATGTAGAGGCTGGAGTGGG + Intronic
997610194 5:135210381-135210403 TGCTGCAGAGGCTCTGGGGTAGG + Intronic
999641902 5:153680691-153680713 TGCTAGATGGGGTCTGGGGTTGG + Intronic
1000498811 5:162021594-162021616 TGCTAGCTAGGGTCTGGAATGGG - Intergenic
1002067711 5:176660453-176660475 TGCTAAGTGGGGTCTTGGGCTGG + Intergenic
1006360401 6:33584184-33584206 TGCTGGGGAGGGTCTGGGGAGGG + Intergenic
1007794834 6:44339099-44339121 TGCTCTCAAGGGTCTGGGGTTGG + Intronic
1010440138 6:75884669-75884691 TGGTAGGTAGGGGCTTGGGTTGG + Intronic
1010733270 6:79413029-79413051 TGCTAAATAGGGGATGGGGTGGG + Intergenic
1013110569 6:107061711-107061733 TGATGCAGAGGGTCTGGGGTGGG - Intergenic
1017812206 6:157991355-157991377 TGCCTCGTTGGCTCTGGGGTGGG + Intronic
1020009762 7:4801601-4801623 TGCTGTGCGGGGTCTGGGGTGGG + Intronic
1022419373 7:30206259-30206281 TGCTAGGAAGGGTTTGGGGTTGG + Intergenic
1022528563 7:31053181-31053203 TGCTAGGTGGGGGTTGGGGTAGG + Intronic
1023716192 7:43046657-43046679 TGCTACCTGGGGTTGGGGGTGGG - Intergenic
1025910746 7:65826455-65826477 AGCTACTTGGAGTCTGGGGTGGG - Intergenic
1026485806 7:70819507-70819529 TGGTTCCTAGGGTCTGGGGGTGG + Intergenic
1035170535 7:157015048-157015070 TGCTCTGAAGGGGCTGGGGTTGG - Intergenic
1036806394 8:11837340-11837362 AGCTACTTGGGGACTGGGGTGGG - Intronic
1042268423 8:66931988-66932010 AGCTACATAGAGTCTGAGGTGGG + Intergenic
1045329393 8:101142407-101142429 TGCTACCTGGGGGCTGGGGATGG + Intergenic
1051335611 9:16063328-16063350 TGCCACGGATGGTCTGGGGATGG + Intergenic
1052195320 9:25706133-25706155 TGCAAAGTAGGGTCTGGAGTTGG + Intergenic
1053298101 9:36929493-36929515 TGATTCTTAGGGGCTGGGGTTGG - Intronic
1055977498 9:81969266-81969288 TGATAGGTAGGATCTGGGGTTGG - Intergenic
1056634865 9:88323177-88323199 TGCTCTGTAGAGTCTGGGATGGG + Intergenic
1062033065 9:134370788-134370810 GACCACGGAGGGTCTGGGGTTGG + Intronic
1186566362 X:10667029-10667051 TGCTACCTAGAGTTGGGGGTGGG + Intronic
1186883664 X:13891250-13891272 TGATTTGTTGGGTCTGGGGTGGG - Intronic
1186899071 X:14033593-14033615 TGAAACGAAGGGTCTGGGGCTGG - Intergenic
1187827232 X:23344049-23344071 TGATTCAAAGGGTCTGGGGTGGG + Intronic
1189247134 X:39571944-39571966 AGCTACTTGGGGTCTGAGGTGGG + Intergenic
1196483136 X:116174368-116174390 TGCTACATGGGGTCTGGGTGGGG + Exonic
1199765574 X:150939229-150939251 TGCAACATATGGTCTGGGATTGG - Intergenic
1199918230 X:152368283-152368305 TGGAAGGTATGGTCTGGGGTGGG - Intronic
1200108035 X:153725229-153725251 TGCCGCGTAGGGACTGGGGCTGG - Exonic