ID: 1161747365

View in Genome Browser
Species Human (GRCh38)
Location 19:6069264-6069286
Sequence CTATGTTATCTATACATTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 196}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161747365_1161747372 30 Left 1161747365 19:6069264-6069286 CCATCAATGTATAGATAACATAG 0: 1
1: 0
2: 0
3: 11
4: 196
Right 1161747372 19:6069317-6069339 CTAGAGCCACCAGTGTCTAGAGG 0: 1
1: 0
2: 2
3: 10
4: 154
1161747365_1161747368 -1 Left 1161747365 19:6069264-6069286 CCATCAATGTATAGATAACATAG 0: 1
1: 0
2: 0
3: 11
4: 196
Right 1161747368 19:6069286-6069308 GCTGGAACCATCAGTGTGTAGGG 0: 1
1: 0
2: 0
3: 4
4: 118
1161747365_1161747369 0 Left 1161747365 19:6069264-6069286 CCATCAATGTATAGATAACATAG 0: 1
1: 0
2: 0
3: 11
4: 196
Right 1161747369 19:6069287-6069309 CTGGAACCATCAGTGTGTAGGGG 0: 1
1: 0
2: 0
3: 6
4: 132
1161747365_1161747367 -2 Left 1161747365 19:6069264-6069286 CCATCAATGTATAGATAACATAG 0: 1
1: 0
2: 0
3: 11
4: 196
Right 1161747367 19:6069285-6069307 AGCTGGAACCATCAGTGTGTAGG 0: 1
1: 0
2: 0
3: 6
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161747365 Original CRISPR CTATGTTATCTATACATTGA TGG (reversed) Intronic
905494761 1:38376169-38376191 CTGGGTTATCTATAAAATGAGGG - Intergenic
907845922 1:58206605-58206627 GTATGTTGTCTAGAAATTGAGGG - Intronic
908026063 1:59952692-59952714 TTATATTTGCTATACATTGATGG - Intergenic
909033107 1:70565213-70565235 CTATCTTATTTATACTTTTAAGG + Intergenic
909132939 1:71762057-71762079 CTAAGTTTTCTATACTTTGCTGG + Intronic
909237215 1:73168154-73168176 GTATATCATCTATACATTAAAGG - Intergenic
909785199 1:79603479-79603501 GTATGTAAACTATACATTAAAGG - Intergenic
912895755 1:113586987-113587009 CTATGGTATCTATACATAAGAGG - Intronic
914739060 1:150448005-150448027 ATCTGTTATCTATAAATTAAAGG + Intronic
918580423 1:186120845-186120867 TTATGGTGTTTATACATTGATGG + Intronic
920905871 1:210167083-210167105 CTAAGTTATCTTTACAATGATGG + Intronic
921345258 1:214177059-214177081 CTAGGTTTTCTCTACAGTGAAGG + Intergenic
921440612 1:215182010-215182032 CCATGTTCTCTATACAGGGATGG + Intronic
921724693 1:218510910-218510932 CTAAGTAATCTATACAGTTAGGG + Intergenic
921883853 1:220284119-220284141 ATATTTTATCTATAGATTCATGG - Intergenic
922510290 1:226160446-226160468 CTTTGTTATCTATTAATAGATGG - Intronic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
924292482 1:242551333-242551355 CAATGTTTTTTATACATTGCTGG + Intergenic
1064816193 10:19265784-19265806 CTATATGATCTATCCATTGTTGG + Intronic
1065043665 10:21725007-21725029 GTATGTTTTCTATACAATGCAGG - Intronic
1065426311 10:25607938-25607960 ATTTCTTATCTATACATTAAAGG + Intergenic
1067420301 10:46139656-46139678 TTATGTTATCTATAGATTACAGG - Intergenic
1067425720 10:46209861-46209883 TTATGTTATCTATAGATTACAGG + Intergenic
1067505645 10:46846141-46846163 TTATGTTATCTATAGATTACAGG - Intergenic
1070017096 10:72544058-72544080 TTATGTTATCTATAGATTCCAGG + Intronic
1071851666 10:89578012-89578034 CTGTGTTTTCTACAAATTGAAGG - Intergenic
1071955418 10:90752476-90752498 ATATGGTATTTATAGATTGAGGG - Intronic
1073662256 10:105489385-105489407 ATATTTTATCTATACACTCATGG + Intergenic
1074988211 10:118676198-118676220 AAATGTTATCTTTACCTTGAAGG - Intronic
1075287069 10:121195980-121196002 CTAAGTTCTTTCTACATTGAAGG + Intergenic
1079215377 11:18505792-18505814 CTATCTTTTCTATACATTGCAGG - Intronic
1080190182 11:29535679-29535701 CTAGGTAATGTATACATTGAAGG - Intergenic
1080350097 11:31374466-31374488 TTATTATATTTATACATTGAGGG + Intronic
1080541635 11:33271769-33271791 CTTTCTTTTTTATACATTGATGG + Intronic
1080686446 11:34519513-34519535 TTAGGTTATCTATTCCTTGAAGG - Intergenic
1082759038 11:57108452-57108474 TTATGTTATCTATTCATTTCTGG + Intergenic
1084999883 11:73022666-73022688 CAATATGATCTATACATTCAAGG + Intronic
1085582754 11:77669304-77669326 CTGTGTTATGAATAGATTGAAGG - Intronic
1092985094 12:13837536-13837558 CTATGTTAACCATACATGGCTGG + Intronic
1093291412 12:17327815-17327837 CTATATTTTTTATACATTTATGG + Intergenic
1094287415 12:28811134-28811156 CTCTGGTACCTATACTTTGAAGG + Intergenic
1095228948 12:39711316-39711338 ATATGTGATCTATACATATATGG - Intronic
1099347363 12:81518971-81518993 CTATTTGATCTACTCATTGAAGG + Intronic
1099542590 12:83931624-83931646 TTATGTTATCTTTTCATTGCTGG + Intergenic
1100678167 12:96890948-96890970 CTATGTGATCTAGTCATTGATGG + Intergenic
1101817457 12:108156535-108156557 CTACGTTGTCTATATATTTAAGG + Intronic
1103389947 12:120564975-120564997 CTGTGTTATGTATATATTGTTGG + Intronic
1105936790 13:25107775-25107797 CAAAGTTTTCTAAACATTGAGGG - Intergenic
1106456605 13:29933431-29933453 CTGTGTTTTGTACACATTGAAGG - Intergenic
1106607665 13:31245377-31245399 CTAAGTTTTTTAAACATTGAAGG - Intronic
1108938857 13:55923175-55923197 CTATACTATATATATATTGAAGG + Intergenic
1109021440 13:57098621-57098643 CTATTTTATCTGTATATTTAAGG + Intergenic
1110034432 13:70663479-70663501 CTATATTATATATACATTTTTGG + Intergenic
1110200210 13:72840885-72840907 ATTTGTTGTCTATACATTGGAGG + Intronic
1115831017 14:37341268-37341290 ATATGTTTTCTACATATTGAAGG - Intronic
1116162373 14:41285592-41285614 CTGTGTTAACTTTACATTTAAGG + Intergenic
1116223854 14:42122347-42122369 CTATGTTATGTTTACACTCATGG - Intergenic
1116300163 14:43169676-43169698 CTATGTAAGCAATACATTTATGG + Intergenic
1116507828 14:45706844-45706866 CTAAATAATCTATACATTCATGG + Intergenic
1116607192 14:47015363-47015385 CTGTGTTTTTTATAAATTGAAGG - Intronic
1117877352 14:60267593-60267615 CTAAGTTATCTATAGATTACAGG - Intronic
1119017304 14:71072208-71072230 CTGTGATATCTACAAATTGAAGG - Intronic
1119975251 14:79017654-79017676 CTATGCTATATATATAATGAGGG + Intronic
1120383823 14:83818462-83818484 TTATGTTATACATACATGGATGG - Intergenic
1124859295 15:33422699-33422721 CTCTGCTATCTATAAATTCATGG - Intronic
1125695097 15:41629488-41629510 GGATGTCATCGATACATTGATGG + Intronic
1126279126 15:46922526-46922548 CTATGTCATCCATCCATGGATGG + Intergenic
1126891387 15:53208307-53208329 CTCTATTCTCTATACTTTGAGGG + Intergenic
1127054918 15:55121607-55121629 CTATGCTATCTCTCCATTGCGGG - Intergenic
1127756919 15:62101760-62101782 TTATGATATCCATACATAGATGG + Intergenic
1137903118 16:52290608-52290630 ACATGTTATCTATTTATTGATGG + Intergenic
1138302231 16:55941207-55941229 CTATGTCATCTACAAATAGAAGG - Intronic
1139140063 16:64251028-64251050 CTGAGTTATAAATACATTGATGG + Intergenic
1139299763 16:65935015-65935037 CTATGTGATATATGCATGGAAGG - Intergenic
1141275672 16:82585710-82585732 CAATCTCACCTATACATTGAGGG - Intergenic
1142830812 17:2547704-2547726 TTATGTTATCTATAGATTACAGG + Intergenic
1143414829 17:6738709-6738731 TTATGTTATCTATAGATTCCAGG - Intergenic
1143596043 17:7914808-7914830 CTGTGTTATCTTTACAGTCACGG - Intergenic
1146129613 17:30260011-30260033 TAATGTTATCTATAGACTGACGG - Intronic
1146556824 17:33832179-33832201 CTACGTTATTTCTACATTGAGGG - Intronic
1147216687 17:38903697-38903719 CAATGTTATCAATACTTTAAAGG + Intronic
1153891200 18:9517239-9517261 CTACGTAATCTATACATTCACGG - Exonic
1155292257 18:24354110-24354132 CTATGTTATCTATAAACAGGAGG + Intronic
1155430945 18:25757022-25757044 CTAAGTTATCTATGCCATGATGG - Intergenic
1155838514 18:30618462-30618484 CTATGTTTTTTACAAATTGAAGG + Intergenic
1155869388 18:31006728-31006750 CTCTGTTATATATAAAATGAAGG - Intronic
1156100868 18:33593361-33593383 CTATGTTTCCCATCCATTGAGGG + Intronic
1158170351 18:54591868-54591890 TTATGATAACTATACACTGAAGG - Intronic
1159854768 18:73572543-73572565 CTATGATACCCATACAGTGAGGG - Intergenic
1161747365 19:6069264-6069286 CTATGTTATCTATACATTGATGG - Intronic
1161747377 19:6069353-6069375 CCATGTTCTCTATACACTGATGG - Intronic
1161747383 19:6069383-6069405 CCATGTCATCTATACACTGATGG - Intronic
1161747386 19:6069412-6069434 TCATGTTCTCTATACACTGATGG - Intronic
1163985635 19:20946158-20946180 CAATGTAATCTACACATTTAAGG - Intronic
1164993016 19:32698135-32698157 CTAAGTTTTCTTTTCATTGAAGG - Intronic
926602176 2:14856372-14856394 CTTTGTTGTCTGTTCATTGAAGG - Intergenic
928799763 2:35073436-35073458 ATTTGTTTTCTTTACATTGATGG - Intergenic
929515106 2:42599850-42599872 CTCTGTTCTCTATACAGTTAGGG + Intronic
930460971 2:51675318-51675340 CTCTGTTTTTCATACATTGATGG - Intergenic
935789660 2:106579648-106579670 CTAAGTTATCGATACAGTGTAGG + Intergenic
937446040 2:121958855-121958877 CCATGTTAATTATATATTGAAGG + Intergenic
937560386 2:123217344-123217366 CAAGGATATATATACATTGATGG + Intergenic
937565114 2:123275962-123275984 CTATTTTAATTATACATTTAGGG - Intergenic
940562164 2:155312621-155312643 CTATATTATTTATATATTCAGGG + Intergenic
940645175 2:156384454-156384476 CTATGATATCTATATATTCCTGG + Intergenic
941875202 2:170424825-170424847 CTATGTTTTCTATACTTAGCAGG - Intronic
943106667 2:183552290-183552312 GTCTGTTATGTATACATTGTAGG + Intergenic
943611162 2:190036445-190036467 CTATTTTAACTCTACATAGAAGG - Intronic
945592238 2:211747805-211747827 ATATATTATATATACATAGATGG - Intronic
945601567 2:211872503-211872525 CTATTTTATCTGTAAACTGAGGG - Intronic
946836387 2:223776715-223776737 TTATCTCATCTATAAATTGAGGG + Intronic
1169812238 20:9620047-9620069 CCATGTTATCTGTACACTAAAGG - Intronic
1169837980 20:9901900-9901922 CTTTATTATATAGACATTGATGG + Intergenic
1173340898 20:42151893-42151915 CTATTTTACCTATACCTAGAGGG - Intronic
1176928043 21:14774395-14774417 CCATGTTGTTTATACAATGAAGG - Intergenic
1179154441 21:38837912-38837934 CTAAATTATCTATACACTAAAGG + Intergenic
1184873806 22:47259669-47259691 CTATTTGATCTATGCCTTGAAGG - Intergenic
951176764 3:19610683-19610705 TTATGTTATCTGTAAAATGAGGG - Intergenic
951378511 3:21953634-21953656 CTGTGTTTTCTAAACATTCAAGG + Intronic
953436015 3:42877848-42877870 CTATGTTTTTTACAAATTGAAGG + Intronic
955107499 3:55912343-55912365 CTATGTTCCCTATAAAATGATGG - Intronic
956999586 3:74869829-74869851 CAATGTTATATATACATGGGTGG - Intergenic
957453393 3:80409938-80409960 GTAAGTGATATATACATTGATGG + Intergenic
958617312 3:96511757-96511779 TAATGTTATCTATAAAGTGATGG - Intergenic
958800651 3:98751306-98751328 CTATACTTTCTATACATTTAAGG + Intronic
960838400 3:121931178-121931200 CTGTGTTAACTATACAGAGATGG - Intronic
963927542 3:150966914-150966936 CTCTGTGATCTATACAACGAGGG - Intronic
964587295 3:158320428-158320450 TTATTTTATCTACACATTGTAGG + Intronic
964933447 3:162052548-162052570 TTATGTTATCTATAGATTCCAGG - Intergenic
969561877 4:7953877-7953899 CTATATTATCTACACATTTTTGG - Intergenic
971445825 4:26747194-26747216 CTATGTTATTTCTATATTGGTGG + Intronic
973995507 4:56454718-56454740 CTATATTTTCTATAAACTGATGG + Intronic
974452181 4:62079404-62079426 CTACTTTATCTATCTATTGAGGG + Intergenic
974553714 4:63414853-63414875 CTATGTTATGTTTATATTTAAGG - Intergenic
974930784 4:68358819-68358841 CTATGTTAACCCTACATAGAGGG - Intergenic
976926668 4:90506167-90506189 GTAGGTTATCTGTATATTGAAGG + Intronic
978600830 4:110425947-110425969 CTTTGTCATCTGTAAATTGAGGG - Intronic
980382634 4:132044297-132044319 CTATGTTATCTTTACTGTGGTGG - Intergenic
980522451 4:133951248-133951270 CTATGATATCTAAACAGTTATGG + Intergenic
980638930 4:135547342-135547364 CTATATTATCTATATATGGCAGG + Intergenic
982707102 4:158722762-158722784 CTGTGTTATTTATACGTTAAAGG - Intronic
984257156 4:177402598-177402620 TTATGTTATCTATAGATTACAGG - Intergenic
984911545 4:184677703-184677725 CTAGGTGATCTATAGATTCAAGG - Intronic
989225123 5:39018419-39018441 CTCTGTTTTTTACACATTGAAGG + Intronic
989476014 5:41873572-41873594 CTATGTTCTCCATATATTAAAGG - Intergenic
989767676 5:45105769-45105791 CTATCTGATCTCCACATTGAGGG - Intergenic
992677042 5:79115618-79115640 ATATTTTATATATACATTTATGG - Intronic
993046777 5:82875601-82875623 TTTTGTTATTTATTCATTGATGG + Intergenic
994440960 5:99802025-99802047 TTTTTTTATCTATCCATTGATGG + Intergenic
995205721 5:109478159-109478181 CTATCTTATCTTTATATTTAGGG - Intergenic
995664754 5:114528966-114528988 TTATGGTATGTATACATTTAAGG + Intergenic
998244498 5:140486431-140486453 TTATGTTACCTATACTTTCATGG - Intronic
999897081 5:156046409-156046431 CTGTGTTTTTTAAACATTGAAGG + Intronic
1000098461 5:157991977-157991999 CTGTATTTTCTGTACATTGATGG + Intergenic
1000576772 5:162984363-162984385 CTATGTTATGCATACATTATAGG + Intergenic
1000944720 5:167406986-167407008 CAATGTTAACTAAACATTCAAGG + Intronic
1001373119 5:171226877-171226899 CTGTGTTTTTTATAAATTGAAGG + Intronic
1003659857 6:8050070-8050092 CTATGTTTTTTACAAATTGAAGG + Intronic
1004361639 6:14976449-14976471 TTATGTTATCTATAGATTACAGG - Intergenic
1004849655 6:19685369-19685391 ATAGTTTATCTATAGATTGACGG - Intergenic
1014262422 6:119234810-119234832 CTGTGTTTTTTACACATTGAAGG + Intronic
1014476940 6:121885476-121885498 CTGTGTACTCTATAGATTGAGGG + Intergenic
1015198805 6:130554782-130554804 CTATTTTATCAAAACATTGTGGG - Intergenic
1016579535 6:145614931-145614953 CTGTGTTTTCTATAAATTAAAGG - Intronic
1017055663 6:150433641-150433663 CCATGTTATTCGTACATTGATGG + Intergenic
1019048362 6:169164975-169164997 CTATGTTATATATACATGGGCGG + Intergenic
1021054493 7:16030102-16030124 GTATGTTAACTATGCATTAATGG + Intergenic
1021124949 7:16840973-16840995 CTTTCTTATCTATAAATTGGAGG + Intergenic
1022373728 7:29793720-29793742 CTCTGTTATCTACACTTTAAAGG - Intergenic
1023305163 7:38818367-38818389 CTCTGTTCTCTCTCCATTGATGG - Intronic
1025120734 7:56299461-56299483 CAATGTCATATATGCATTGATGG + Intergenic
1027410095 7:77906965-77906987 CAATGTTAAGTATACATTTACGG + Intronic
1028334348 7:89632874-89632896 CTTTATTATCTATCCATTGATGG + Intergenic
1030495048 7:110288389-110288411 TTATGTTTTTTACACATTGAAGG - Intergenic
1032692849 7:134306060-134306082 CTATGTTTTCAATGCTTTGAAGG + Intronic
1034616836 7:152425179-152425201 CTCAGTTATCTATAAAATGAGGG + Intronic
1035036015 7:155894425-155894447 TTATGTTTTCTATAAACTGAGGG + Intergenic
1035082723 7:156231302-156231324 CTATATTTTCTATAAATTTAGGG + Intergenic
1035987215 8:4447530-4447552 CTCTGTTATCTGTAGAGTGAGGG - Intronic
1039685234 8:39794592-39794614 TTATGTTATCTATAGATTCCAGG + Intronic
1040692939 8:49961895-49961917 CTATTTTTTCTATACTTGGATGG - Intronic
1040992462 8:53367422-53367444 TTATGTTATCTATAGATTCCAGG - Intergenic
1043305944 8:78795349-78795371 GAATGTTTTCTATACATAGAAGG - Intronic
1047112396 8:121805167-121805189 TTATGTTATCTATAGATTACAGG + Intergenic
1047857566 8:128928187-128928209 CTGTGTGATCCATACATTTATGG - Intergenic
1049904612 9:204118-204140 CTATGTAACCCATACAGTGAAGG - Intergenic
1050084180 9:1947324-1947346 CTATGTTATCTATAGATAAAGGG + Intergenic
1051559489 9:18424450-18424472 TTATGTTATATATTGATTGATGG - Intergenic
1052083460 9:24235419-24235441 CTATGGTTTGTATCCATTGAGGG - Intergenic
1052815362 9:33098925-33098947 CTATCTTGTTTATACGTTGAAGG + Intergenic
1056063955 9:82914326-82914348 CTCTGATGTCTATACATTTAAGG + Intergenic
1056675799 9:88675957-88675979 TTCTGTTATCTATCCATTCATGG + Intergenic
1062173112 9:135146211-135146233 CTCTGCTCTCTATAGATTGAAGG - Intergenic
1188114090 X:26222879-26222901 CTTTGTTATCTATTCAATGGTGG - Intergenic
1188561994 X:31479211-31479233 CTCTTTTATTTATACACTGATGG + Intronic
1188975155 X:36664005-36664027 CTGTGTTATCTAATCTTTGAAGG + Intergenic
1190974083 X:55382647-55382669 CTATCTTATCTATTCTTTCAAGG - Intergenic
1192784382 X:74322692-74322714 TTTTCTTATCTATACAATGAAGG - Intergenic
1192804251 X:74495616-74495638 TTTTCTTATCTATACAATGAAGG + Intronic
1193213147 X:78831437-78831459 CTATATTATTCATACATTGCTGG - Intergenic
1194934924 X:99937422-99937444 CTATGTTATTTCTTCACTGAAGG - Intergenic
1196308241 X:114129341-114129363 TTATGTTATTTCTACATTAATGG + Intergenic
1196640650 X:118056211-118056233 GTATTTTATGTTTACATTGATGG - Intronic
1198672572 X:139097100-139097122 TTTTGTTTTCTATACATTGCTGG - Intronic
1201378968 Y:13351874-13351896 CTATGTTTACTACAAATTGAAGG + Intronic
1201562678 Y:15334253-15334275 GTATGTTATCTTAACATGGATGG - Intergenic
1201688811 Y:16738301-16738323 CTATATTATGTATACATTCTGGG - Intergenic
1202135944 Y:21661633-21661655 CTCTGTTAACTATATATTAATGG - Intergenic