ID: 1161747906

View in Genome Browser
Species Human (GRCh38)
Location 19:6072775-6072797
Sequence CTCTTCAGTGCTGCCTACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 105}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161747899_1161747906 24 Left 1161747899 19:6072728-6072750 CCTTCCAAGGACATAACAAAGAA 0: 1
1: 1
2: 5
3: 71
4: 831
Right 1161747906 19:6072775-6072797 CTCTTCAGTGCTGCCTACGGAGG 0: 1
1: 1
2: 0
3: 9
4: 105
1161747900_1161747906 20 Left 1161747900 19:6072732-6072754 CCAAGGACATAACAAAGAAAAAA 0: 1
1: 0
2: 6
3: 164
4: 1574
Right 1161747906 19:6072775-6072797 CTCTTCAGTGCTGCCTACGGAGG 0: 1
1: 1
2: 0
3: 9
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161747906 Original CRISPR CTCTTCAGTGCTGCCTACGG AGG Intronic
901054616 1:6443407-6443429 CTCTTATCTGCTGCCTACAGGGG + Intronic
902106269 1:14038625-14038647 CTCTTCAGTGGAGCCCAGGGAGG - Intergenic
902479743 1:16705197-16705219 CTCTTATCTGCTGCCTACAGGGG - Intergenic
903171456 1:21557043-21557065 CTCATCAATGCTGCCTCCTGAGG + Intronic
910291882 1:85607375-85607397 CTCTGCTGTGCTGCCTTCTGTGG - Intergenic
914885151 1:151578583-151578605 CTCTTCAGAGCAGCCTACCAGGG + Intronic
916647135 1:166797274-166797296 CTGTTCAGTGCTGCCAACCGAGG + Intergenic
921913195 1:220575126-220575148 CTCTTCAGTGCTGCATCCCATGG - Intronic
922505201 1:226122071-226122093 CTCTTCAGTGCGGCTCTCGGCGG - Intergenic
922964020 1:229672914-229672936 CTCTACAGTGCAGCTTCCGGTGG + Intergenic
1063486748 10:6427306-6427328 ATCTTGAATGATGCCTACGGAGG + Exonic
1064991422 10:21259977-21259999 CTCTTCCGTGCTGCCTCCAGTGG - Intergenic
1069722112 10:70556438-70556460 CTCTGTAGTGCTGCCTACTCTGG - Intronic
1072475784 10:95758537-95758559 CTCATCAGTTATGCCTAAGGTGG + Intronic
1075001320 10:118800600-118800622 CTCTACAGTGCTGCCTGGGATGG - Intergenic
1075786808 10:125055553-125055575 CTCTGCAGTGCTGCTTCTGGGGG - Intronic
1076768779 10:132651652-132651674 CTCAGCACTGCAGCCTACGGGGG - Intronic
1078855883 11:15206269-15206291 CTCTTTGGTGCTGCCTACACCGG - Intronic
1081810271 11:45910430-45910452 CCCTGCAGTGCTGCCTCCTGGGG - Intronic
1082126069 11:48432542-48432564 CTCTTCATTGCTGCCAACAGTGG - Intergenic
1082128977 11:48464375-48464397 CTCTTCGTTGCTGCCAACAGTGG - Intergenic
1082248425 11:49953005-49953027 CTCTTCATTGCTGCCAACAGTGG + Exonic
1082559655 11:54603394-54603416 CTCTTCATTGCTGCCAACAGTGG - Exonic
1082562522 11:54635351-54635373 CTCTTCGTTGCTGCCAACAGTGG - Intergenic
1084297983 11:68225654-68225676 ATCTTCAGAGCTCCCCACGGGGG - Intergenic
1086076999 11:82865299-82865321 CTCTTAAGTGTCGCCTACCGAGG - Intronic
1087177489 11:95108879-95108901 CTTATCAGAGCTGCCTACAGGGG - Intronic
1087700243 11:101429284-101429306 CTCTTCATTTCTACCTAGGGAGG - Intergenic
1089450390 11:118591287-118591309 CAATTCTGTGCTGACTACGGTGG - Intronic
1096859760 12:54516823-54516845 TTCTTCTGTGCTGCCTGTGGAGG + Intronic
1097014330 12:55974429-55974451 CTCTTCAGCGCTGCTTAATGAGG - Intronic
1099337388 12:81380697-81380719 CTCTTCCGTGCTGCCGAGGAGGG + Intronic
1105956962 13:25292577-25292599 ATCTTCAGGGCTGCCTCCAGAGG - Intergenic
1112414001 13:99189430-99189452 TTCTTCAGTGCTGGCTCCTGTGG - Intergenic
1117319403 14:54606875-54606897 GTCTTCAGTGCTCCCTTTGGAGG + Intronic
1117330197 14:54704836-54704858 CTCCTCTGTGTTGCCTATGGTGG + Intronic
1127002512 15:54526442-54526464 CTCTTCAGGGCCGGGTACGGTGG + Intronic
1128760824 15:70215049-70215071 CTCTCCAGTGCTCCGTGCGGTGG - Intergenic
1130868114 15:87949355-87949377 TTCTTCAGAGCTGACCACGGAGG - Intronic
1132664848 16:1076676-1076698 CTCTTCAGTGCTGTCCACACTGG + Intergenic
1142984569 17:3688152-3688174 CACATCAGTGCTGCCTAAAGAGG - Intronic
1144956086 17:19019637-19019659 CTCTTCCCTGCTGCCTGTGGGGG + Intronic
1148214544 17:45827276-45827298 CCCTTCAGTGCTGCCTTCCAGGG - Intronic
1149032669 17:52101733-52101755 CTCTTCAGTGCTACCCTCTGGGG + Intronic
1155497619 18:26458318-26458340 CTCTTCTGTGCTGCCTCTTGAGG - Intronic
1159855579 18:73583529-73583551 CTATTCATTGCTTCCTATGGTGG - Intergenic
1161747906 19:6072775-6072797 CTCTTCAGTGCTGCCTACGGAGG + Intronic
1164109716 19:22144705-22144727 CTTTTCAGTGTGGCCTAGGGTGG - Intergenic
1164194691 19:22945876-22945898 CTTTTCAGTGTGGCCTATGGTGG - Intergenic
1165479795 19:36055693-36055715 CTCTGCAGTGCTGCCTGGGGAGG + Intronic
1167454265 19:49590371-49590393 CTCTTCAGTGAGGCCTCCTGAGG - Exonic
1202713779 1_KI270714v1_random:31103-31125 CTCTTATCTGCTGCCTACAGGGG - Intergenic
925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG + Intronic
926001150 2:9333779-9333801 GTGTTCAGTGCTGCCTCTGGAGG - Intronic
926045653 2:9707902-9707924 CCCGTCAGTGCTGCCTTCTGTGG + Intergenic
929009372 2:37425671-37425693 CTCTTCACTGCTGTCAATGGAGG + Intergenic
934070127 2:88376268-88376290 CTGTTCAGGGCTGCCTACTTAGG + Intergenic
934817205 2:97337983-97338005 CCCTTCTGTGCTGCCTAGGATGG - Intergenic
934820491 2:97370501-97370523 CCCTTCTGTGCTGCCTAGGATGG + Intergenic
936441914 2:112561790-112561812 CACTTCAGTGCTGCACTCGGAGG + Intronic
937121340 2:119441748-119441770 CTCTTGTGGGCTGCCCACGGTGG + Intronic
939182810 2:138823887-138823909 CTCTTCAGTGCAGTCTGCTGAGG + Intergenic
940368430 2:152874717-152874739 GTCTTCACTGCTTCCTACTGTGG + Intergenic
947570999 2:231234302-231234324 GTCTTTAGGGCTGCCCACGGGGG + Intronic
948466808 2:238156190-238156212 ATCCTCAGTGTTGCCGACGGTGG + Intergenic
949007446 2:241657851-241657873 CTCTTCACTGCTGACTCAGGCGG + Intronic
1172054718 20:32146224-32146246 CACTACAGTGCTGCCTAGAGAGG + Intronic
1173344413 20:42185511-42185533 CCCTTCAGTGTTGGCTACAGTGG + Intronic
1175271499 20:57737180-57737202 CTGTTAAGTGCTGCCCACGTGGG - Intergenic
1178675418 21:34627369-34627391 CTCTTTAGTGCTCCCTAAGGTGG - Intergenic
1179436267 21:41364161-41364183 CACCTCAGTGCTGCCTAAGCTGG + Intronic
950411611 3:12841514-12841536 TTCCTCGGCGCTGCCTACGGAGG - Exonic
951725114 3:25749440-25749462 CTCCTCAGCACTGCCTACAGAGG + Intronic
954430508 3:50468336-50468358 CTCTTCAGAGGTCCCTAGGGAGG - Intronic
958600864 3:96295006-96295028 CTCTTCAGTGCTGCCTACGCTGG + Intergenic
961081971 3:124034434-124034456 CTCTTCAGTTCTGGGAACGGAGG + Intergenic
961125797 3:124416464-124416486 CTCTTCAGTGCCTCTTACTGAGG + Intronic
962502386 3:136008780-136008802 CTCTTCACTCCTGCCAAGGGTGG - Intronic
966910572 3:184557400-184557422 CTCTTCAGCACTGCCTTCTGGGG + Intronic
968555134 4:1243081-1243103 CTCATCAATGCTACCCACGGTGG + Intronic
968837118 4:2973162-2973184 CACGTCAGTGCAGCCCACGGGGG - Intronic
972537443 4:40011286-40011308 CTCCTCAGTGATGCCAACTGAGG - Intergenic
977737148 4:100430652-100430674 CTTTTCAGTGCAGACTAGGGTGG + Intronic
985832992 5:2249729-2249751 CTCTTCATTGCTGCCCAATGGGG - Intergenic
995046399 5:107653460-107653482 CTCTGGAGTGCTGACTAAGGAGG + Intronic
996750464 5:126883502-126883524 CCCTTCAGTGCTGATTACGGTGG - Intronic
1007355048 6:41308594-41308616 TTCCTCGGTGCTGCCTATGGAGG - Intergenic
1013827899 6:114236923-114236945 ATCTTCAGTACTGCCGACGCCGG + Intronic
1014121299 6:117728064-117728086 CTCTTCAGCGCTGCCTTTGTTGG + Intergenic
1014140025 6:117930861-117930883 CTCTTTAGTGCTGCATACAATGG - Intronic
1017030139 6:150213957-150213979 CTCTTCAGCTCTGCCTAACGTGG + Intronic
1021285544 7:18777050-18777072 CTCTTCAGAGCTGGCTATGGAGG + Intronic
1023899930 7:44467849-44467871 TTCCTCGGCGCTGCCTACGGAGG + Intronic
1024339695 7:48244619-48244641 CTCTTCAGTGCCGGCCACTGGGG - Exonic
1025093121 7:56079259-56079281 CTCTTCAGTGCTGTCTCTTGGGG + Intronic
1026900048 7:74031966-74031988 CTCTTCAGTTCTGCCTGCCAGGG - Intronic
1027046538 7:74994897-74994919 CCCTTGAGAGCTGCCTACGCTGG + Intronic
1029386446 7:100246705-100246727 CCCTTGAGAGCTGCCTACGCTGG - Intronic
1029857890 7:103537284-103537306 CTCTACATTGCTTCCTACAGAGG + Intronic
1032201864 7:129827830-129827852 CTCTTCAGCCCTGCCCATGGTGG + Intergenic
1032990378 7:137388437-137388459 CTCTTCAGTGCTGTCTCAGTAGG + Intronic
1034102893 7:148466053-148466075 GTCTTCAGCGCTGCCTCCAGAGG - Intergenic
1034115517 7:148580356-148580378 TTCCTCGGTGCCGCCTACGGAGG + Intergenic
1035613712 8:987151-987173 CTATTCAGTGGTGCCACCGGAGG + Intergenic
1038433657 8:27519768-27519790 CACTTCAGTGCTGGCACCGGAGG - Intronic
1041149299 8:54914567-54914589 CCTTTTAGTGCTGCCTACCGTGG + Intergenic
1060360747 9:122954294-122954316 CTCTTCACTTCTGTCTATGGAGG + Intronic
1062103677 9:134741160-134741182 CCCTGCAGTGCAGCCTGCGGTGG + Intronic
1189426664 X:40907936-40907958 TTCCTCAGCGCTGCCTACAGAGG + Intergenic
1190529329 X:51359589-51359611 ATATTCAGTGCTGCCCAAGGGGG - Intergenic
1193286956 X:79724556-79724578 CCCCTCTGTGCTGCCTACAGGGG + Intergenic
1195666137 X:107433012-107433034 CTCTTCAGAACTGCCCAGGGAGG - Intergenic
1196224157 X:113145940-113145962 CTTTTCAGAGCTACCTACAGTGG - Intergenic
1197793836 X:130280651-130280673 TTCTTAGGTGCTGCCTACTGAGG - Intergenic
1198073481 X:133172205-133172227 CTCTCCAGTGCTTTCTAGGGAGG + Intergenic
1199636006 X:149811862-149811884 CTCTTCCTTGCTGCCTCAGGAGG + Intergenic