ID: 1161747933

View in Genome Browser
Species Human (GRCh38)
Location 19:6072951-6072973
Sequence TAGGGTTTGCAGAAGGTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 1, 2: 1, 3: 44, 4: 194}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161747930_1161747933 -6 Left 1161747930 19:6072934-6072956 CCCAGAGGTATTGACAATAGGGT 0: 2
1: 6
2: 12
3: 13
4: 89
Right 1161747933 19:6072951-6072973 TAGGGTTTGCAGAAGGTTCAAGG 0: 1
1: 1
2: 1
3: 44
4: 194
1161747924_1161747933 28 Left 1161747924 19:6072900-6072922 CCAACATGTCAAAATTAAGTGTA 0: 1
1: 0
2: 8
3: 15
4: 226
Right 1161747933 19:6072951-6072973 TAGGGTTTGCAGAAGGTTCAAGG 0: 1
1: 1
2: 1
3: 44
4: 194
1161747931_1161747933 -7 Left 1161747931 19:6072935-6072957 CCAGAGGTATTGACAATAGGGTT 0: 2
1: 6
2: 10
3: 16
4: 74
Right 1161747933 19:6072951-6072973 TAGGGTTTGCAGAAGGTTCAAGG 0: 1
1: 1
2: 1
3: 44
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161747933 Original CRISPR TAGGGTTTGCAGAAGGTTCA AGG Intronic
900215310 1:1478513-1478535 TAGTGTGTGCAGCAGGTTCAGGG - Intronic
900222570 1:1517180-1517202 TAGTGTGTGCAGCAGGCTCAGGG - Exonic
900769811 1:4531680-4531702 TAGGGGTTGCTGAAGTTTTAAGG - Intergenic
900965349 1:5953558-5953580 GTGTGTTTGCAGATGGTTCAAGG - Intronic
901079939 1:6578401-6578423 TAGGGTTTGCAAAACCCTCATGG + Intronic
901610865 1:10496797-10496819 TAGGGTTTGAAGACTGCTCAGGG - Intronic
905180579 1:36163158-36163180 TGGGGTCTGCAGAAAGATCAGGG - Intronic
908239776 1:62179028-62179050 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
908790794 1:67779378-67779400 AAGGATTTTCAGCAGGTTCAGGG - Intronic
909427771 1:75546788-75546810 AAGGGTCTTCAGAAGGTTCATGG + Intronic
912756702 1:112330102-112330124 TAGGATTTTCAGAATTTTCAGGG + Intergenic
913077653 1:115354397-115354419 TAGGGTTTGAAGAAGCAACAGGG - Intergenic
913143001 1:115960508-115960530 TTAGCTTTGCAAAAGGTTCAGGG + Intergenic
914245792 1:145885196-145885218 AAGGGTTAGCAGAAGGCACAGGG + Intronic
914774505 1:150723887-150723909 TAGAATTTGCAGAATGTTAAGGG + Intergenic
915333708 1:155128751-155128773 AAGGGGTTACAGAAGGTTCTGGG + Intronic
915470724 1:156124222-156124244 TGGGGTTTGGGGAAGGCTCAAGG + Intronic
916116743 1:161491281-161491303 TAAGGGTTGCAGAAGGATGAAGG - Intergenic
916712250 1:167422083-167422105 TGGGGTGTCCAGTAGGTTCAGGG + Exonic
917384928 1:174462012-174462034 TAAGGTATACAGAAGGTTCTTGG - Intronic
919521198 1:198590505-198590527 TATGCATTGCAGAAGTTTCAGGG - Intergenic
921266783 1:213427372-213427394 CAGGGTGTGCATATGGTTCAAGG - Intergenic
921427648 1:215022697-215022719 TATGGTTTGGGGAAGGTACATGG + Intronic
922889799 1:229052943-229052965 CTGAGTTTTCAGAAGGTTCAAGG - Intergenic
924855103 1:247868099-247868121 TGGGGTTTGAAGAAGTTCCAAGG + Intronic
1064809004 10:19172904-19172926 TAGGTTTTGAAGAAGGATCTTGG - Intronic
1065634812 10:27720670-27720692 TAATGTTTGCAGAAGGTTTCTGG - Intronic
1065644371 10:27819142-27819164 TTGGGTTTGCAGAAGGCTGGGGG - Intronic
1066100264 10:32111302-32111324 CAGGGTTTCCAGAAGCTTTATGG + Intergenic
1066792445 10:39080803-39080825 TAGGGGTTGCAGGAGGATGAAGG + Intergenic
1067974470 10:51008441-51008463 TAGGGTTTTCAGAAAGAGCATGG - Intronic
1070236439 10:74632448-74632470 TAGAGTTTTCAGAGGGTACAAGG - Intronic
1070909804 10:80108115-80108137 TAAGGGTTGCAGAAGGATGAAGG - Intergenic
1072008866 10:91286269-91286291 CAGGGTTTGCAGGAGGAGCAGGG - Intergenic
1072655850 10:97329983-97330005 TAGGAGTTGGAGAGGGTTCAGGG - Intergenic
1073944337 10:108732420-108732442 TAAGGGTTGCAGAAGGATGAAGG - Intergenic
1073945089 10:108741025-108741047 TAGGGGTTGGGGAATGTTCATGG + Intergenic
1076978538 11:193170-193192 TGGGGTTTCCAGAACATTCAGGG + Intronic
1079155730 11:17946216-17946238 TAGGTTTTGCAGTAGGATCAGGG + Intronic
1079254748 11:18818356-18818378 TAGGGGTTGCAGAAGAGTGAAGG + Intergenic
1081853337 11:46289064-46289086 GAGGCTCTGCAGAGGGTTCAAGG + Intronic
1082693043 11:56328405-56328427 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1083796855 11:65021891-65021913 TAGTGTTTGGTGAAGGTTGAGGG - Exonic
1084887621 11:72221354-72221376 TAGGGTTTGGAAAATCTTCAAGG + Intronic
1085448460 11:76616518-76616540 TGGGGTTTGCAGAAACTGCACGG - Intergenic
1086112327 11:83213133-83213155 CAGGGTTCGTAGAAGGTTCAAGG + Intronic
1087256634 11:95963344-95963366 CAGGGTATGCAGAGGATTCAAGG + Intergenic
1089373877 11:117980571-117980593 TAAGGTTTGCAGATTATTCAGGG + Intergenic
1089826827 11:121285214-121285236 TAAGGGTTGCAGAAGGATGAAGG - Intergenic
1090242222 11:125192254-125192276 TAGGGTTGGCAGAAGGCTCCAGG + Intronic
1092673678 12:10891523-10891545 TAGGATTTGCTGAAAGTCCATGG - Intronic
1093348768 12:18071223-18071245 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1093393600 12:18653054-18653076 TAGTTTTTGCAGAAGTTTCGAGG - Intergenic
1093495299 12:19749923-19749945 TAGGATGTACAGAAGGTACATGG + Intergenic
1093539356 12:20262747-20262769 TAAGATTTGCTGAAGGATCATGG + Intergenic
1096091316 12:48903672-48903694 CAGGGTTCGTGGAAGGTTCAAGG - Exonic
1098316991 12:69203134-69203156 TAAGGGTTGCAGAAGGATGAAGG - Intergenic
1098911019 12:76208730-76208752 TAGAGTTAGCATCAGGTTCAAGG - Intergenic
1098942234 12:76551185-76551207 TAGGGGTTGGGTAAGGTTCATGG - Intronic
1100190115 12:92181252-92181274 TAGAGTTTGCAGAGGGAACATGG + Intergenic
1100433160 12:94548266-94548288 TAGGGCTTGCAGAAGCTTCCAGG - Intergenic
1102092403 12:110202800-110202822 TAATGCTTGCAGAAAGTTCAGGG - Intronic
1109437733 13:62328116-62328138 CAGGGTTTGTAGAAGGTTCAAGG + Intergenic
1109606528 13:64704969-64704991 AGGGGTTTGCAGAAGGATGAAGG + Intergenic
1109751091 13:66693041-66693063 TAAAGTTTGGAGAAGATTCATGG + Intronic
1109917215 13:69005458-69005480 TATGGTTTCCAGAAGGTCTAAGG + Intergenic
1111806398 13:93044116-93044138 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1112111881 13:96310393-96310415 TTGGGTTTGCAGAAGGTGGAAGG + Intronic
1112749952 13:102572022-102572044 ATGGGTTTTCAAAAGGTTCAGGG + Intergenic
1113168492 13:107471399-107471421 TGGGGTTTGCAGTTGGGTCAGGG + Intronic
1119666746 14:76490545-76490567 TAAGGTTTGGAGAAGTTGCATGG + Intronic
1120306221 14:82773770-82773792 GAGAGTTTTCAGAAGGGTCATGG - Intergenic
1120600508 14:86499757-86499779 TAGGGCATGCAGTAAGTTCAAGG + Intergenic
1121616701 14:95318667-95318689 TTGGGTTTCTAGAGGGTTCAAGG - Intronic
1123830982 15:24136879-24136901 CAGGGTATGCAGAAGGAACATGG + Intergenic
1123836064 15:24194254-24194276 CAGGGTATGCAGAAGGAACATGG + Intergenic
1125475229 15:40043419-40043441 TAGGGTTTGAATTAGGGTCAAGG + Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132896860 16:2233340-2233362 GAGGGTTTGCACAAGGCTCCTGG + Intronic
1133629721 16:7608543-7608565 TAGGGTTTGCAATATGATCATGG - Intronic
1134227753 16:12404561-12404583 AAGGGTTTGCAGAGAGCTCATGG - Intronic
1134262443 16:12662889-12662911 ATGGGTTTGCAGAAGGATAATGG - Exonic
1135224925 16:20647468-20647490 TAGGGGTTACAGAAGGATGAAGG - Intronic
1137876500 16:52001570-52001592 GAAGGTTTCCAAAAGGTTCATGG - Intergenic
1142465969 17:137661-137683 TGGGGTTTCCAGAACATTCAGGG + Intronic
1143919235 17:10317753-10317775 TGGGAGCTGCAGAAGGTTCAAGG + Intronic
1145827741 17:27889903-27889925 TCGGCTTTGCAGAAGGCTCTGGG - Intronic
1146277018 17:31522601-31522623 TAGGATTTGAAGAAGGGACAAGG - Intronic
1146626962 17:34442253-34442275 TAGGGTTTGCAGAGGAGTCGGGG - Intergenic
1146675496 17:34770931-34770953 TGGGGATTGCAGGAGGTCCATGG + Intergenic
1148753954 17:49962862-49962884 GAGGGTTTGCACTAGTTTCATGG - Intergenic
1151588852 17:75029923-75029945 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1152479707 17:80542331-80542353 CAGGGTTGGTAGAAGGTTCAAGG + Intergenic
1152512626 17:80800759-80800781 TAGGGTTTTCAGAAAGCTCCGGG + Intronic
1152940073 17:83164954-83164976 GAGGGTCTCCAAAAGGTTCATGG + Intergenic
1153878882 18:9403530-9403552 AAGGAGTTGCAGAAGGATCAAGG + Intergenic
1153930368 18:9873411-9873433 GTGGGTTTGCAGAAGGATGAGGG + Intergenic
1157835540 18:50898823-50898845 AAGGGTTTGCCAAAGTTTCATGG - Intronic
1158696568 18:59709079-59709101 TAGGGTATACAAAAGGTTCTGGG + Intergenic
1161617177 19:5277863-5277885 CAGGGTTCGCAGAACGTTCAAGG + Intronic
1161747933 19:6072951-6072973 TAGGGTTTGCAGAAGGTTCAAGG + Intronic
1163762807 19:19146423-19146445 TTAGGTTTGCAGAAGGCTTAAGG - Intronic
1163962592 19:20711216-20711238 TAGGGGTTGCAGAAGGATGAAGG + Intronic
1164322948 19:24167048-24167070 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1164438603 19:28253961-28253983 TATGGTTTGCACCAGGTTCATGG - Intergenic
1164511823 19:28903906-28903928 TAGGGAGTGCAGAAGGGTGATGG - Intergenic
1165794363 19:38510459-38510481 TAGGGTTCACAGTGGGTTCAAGG - Intronic
1166538839 19:43592702-43592724 GAGGGTTTGCAGCAGGTTGTCGG - Exonic
1166815425 19:45541923-45541945 TAGGGTGTGGAGTAGGTCCACGG + Intronic
1167754009 19:51399581-51399603 TAAGGCTTGCAGAAGGATGAAGG + Intergenic
926211536 2:10874421-10874443 CAGGGTTTGTAGAAGGTGCAAGG - Intergenic
926445972 2:12943486-12943508 TGTGGTTTGCACAAGGGTCAAGG + Intergenic
927467901 2:23350834-23350856 GAAGGGTTGCAGGAGGTTCAAGG - Intergenic
927911364 2:26902084-26902106 TAGGGTTTCCAGACGGTGCCAGG + Intronic
928282149 2:29957173-29957195 TAGGATTTGTAGGAGGGTCAGGG + Intergenic
933286650 2:80391534-80391556 TATGATTTTCAGAAGGATCATGG + Intronic
933614665 2:84471423-84471445 TAGGAGTTGCAGAAGGATGAAGG + Intergenic
934164919 2:89285260-89285282 TAGGGTTTCAGGAAGGGTCATGG + Intergenic
934202354 2:89897206-89897228 TAGGGTTTCAGGAAGGGTCATGG - Intergenic
935015839 2:99181300-99181322 TAGGATCTGCAGAGGGTTCCCGG - Intronic
936480914 2:112884054-112884076 TAGGTCTTGGAGAAAGTTCAGGG + Intergenic
937229203 2:120387670-120387692 TAGTGTTTTCAGAAGATTCATGG - Intergenic
939831456 2:147077169-147077191 CTGGGTTTGCACAAGGTTGAAGG + Intergenic
940037302 2:149324266-149324288 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
940480250 2:154219826-154219848 TATGATTTGCAGAAGCTTTAAGG + Intronic
941349262 2:164412479-164412501 TAGGGAATGAAGAAGCTTCAGGG + Intergenic
942816700 2:180060867-180060889 TAGGGGTTGCAGGAGGATGAAGG - Intergenic
945400973 2:209382437-209382459 CAGGGATTGCAGAAGGTAGAGGG + Intergenic
1169394091 20:5214499-5214521 CAGGATTTCCAGAAGGTGCATGG + Intergenic
1169654011 20:7902325-7902347 TAGTGGTTGCTGAAGGTTTAAGG - Intronic
1173943139 20:46929074-46929096 GAGGGTTTGGAGCAGGCTCAGGG + Intronic
1175103724 20:56598909-56598931 TAGGGTTCGCAGCAGGATTAAGG + Intergenic
1178855184 21:36244845-36244867 TAGGTTTTACAGAATGTTCAAGG - Intronic
1181422567 22:22811885-22811907 TGGGCTTTGCACAGGGTTCAGGG - Intronic
1181812866 22:25414798-25414820 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1182491613 22:30676003-30676025 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1182922128 22:34089835-34089857 AAGAGTTTGCAGAAAGTTCATGG + Intergenic
1183499699 22:38171299-38171321 TTGGATTTGAAGAAGGATCAGGG - Intronic
950411279 3:12839476-12839498 CAGGGTTCGTAGAAGATTCAAGG - Exonic
956290386 3:67654539-67654561 TAGGGCTCGCAGAAGCTTCCCGG + Exonic
956420461 3:69081459-69081481 CAGGCTTTGCAGAAGGCTGAAGG - Intergenic
957508861 3:81161121-81161143 TAGGGTTTTCAGAAAGATTATGG - Intergenic
958684439 3:97374907-97374929 TGGGGTTTGAAGAATTTTCATGG + Intronic
959059051 3:101599494-101599516 CAGGGTTCATAGAAGGTTCAAGG - Intergenic
961179773 3:124867407-124867429 TAGGGTTTGCAGAAGTTGGGAGG - Intronic
961793977 3:129396366-129396388 CAGGGTTCATAGAAGGTTCAAGG - Intergenic
963308576 3:143682098-143682120 TAGGGTTTGCATAAAGCTCAAGG + Intronic
963778857 3:149466553-149466575 TAGGGATTTCAGAAGGCTCTAGG - Intergenic
966522360 3:180887925-180887947 CAGGGTTCATAGAAGGTTCAAGG - Intronic
967044388 3:185723502-185723524 TGGGGTGGGAAGAAGGTTCAGGG - Intronic
969053719 4:4388945-4388967 TAGGCTTTGCAGGAGGGGCAGGG + Intronic
969995693 4:11310234-11310256 TATGGCTTTCAGATGGTTCATGG + Intergenic
970246159 4:14065993-14066015 TAAGGTCTGCAGAAAGGTCAGGG + Intergenic
971474409 4:27058619-27058641 TGGGGTTTGCAGCAGCTTCTGGG + Intergenic
975655639 4:76638907-76638929 TAGGGTTAGCAAAAGTTTTAGGG - Intronic
975878005 4:78867298-78867320 TGGGGTTTGGACAATGTTCATGG + Intronic
976647731 4:87402749-87402771 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
978404204 4:108362691-108362713 TATAATTTGGAGAAGGTTCAGGG + Intergenic
978556275 4:109984122-109984144 TGGGGTTTGCAGAAGCTCTAGGG - Intronic
978799190 4:112738800-112738822 CAGGGTTCATAGAAGGTTCAAGG + Intergenic
979381076 4:120007462-120007484 TAGGGATTGTAGAAGGTAGAAGG - Intergenic
980490481 4:133519654-133519676 TAGTTTTTGCAGAAGGTACTTGG + Intergenic
984938383 4:184909721-184909743 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
985427977 4:189848524-189848546 TAGTGTCTGCTGAAGCTTCAAGG - Intergenic
986555220 5:9003639-9003661 TAAGTTTTGCATAAGGTTTAAGG + Intergenic
987876810 5:23690479-23690501 TCGGGGTTGCAGAAGGATGAGGG - Intergenic
987956494 5:24748216-24748238 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
988456867 5:31394514-31394536 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
993247155 5:85465591-85465613 TCTGGTTTGCATAGGGTTCAGGG - Intergenic
996526178 5:124482234-124482256 TAGGGGTTGCTGAAGGTGGATGG + Intergenic
999035975 5:148350124-148350146 TAGGGTTTTCAGAGGGCTCCTGG + Intergenic
999866372 5:155704795-155704817 AAGGATTTGAAGATGGTTCAAGG + Intergenic
1001994342 5:176143450-176143472 TAAGGGTTGCAGAAGGATGAAGG + Intergenic
1002165097 5:177338968-177338990 TAACGTCTGCAGAAGGTTCCAGG - Intronic
1003225002 6:4195837-4195859 AAGGGTCTACAGAAGGTTCATGG + Intergenic
1005485778 6:26298003-26298025 TAGTGTTTGTAGAAGTATCAAGG - Intergenic
1005921592 6:30406672-30406694 TAAGGGTTGCAGAAGGATGAAGG - Intergenic
1006284040 6:33079579-33079601 TAGGGTTCGTAGAAGGTCCAAGG + Intronic
1007307417 6:40917937-40917959 TAGCGTTGGGAGAAGCTTCAAGG - Intergenic
1007355017 6:41308419-41308441 CAGGGTTCGTAGAAGGTTCAAGG - Intergenic
1009571427 6:65390412-65390434 TAGGGTTTTCAGAAGGAGAAGGG + Intronic
1010686264 6:78858065-78858087 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1011779838 6:90775475-90775497 TAGTGTTTGCAGCACTTTCACGG - Intergenic
1013637600 6:112043927-112043949 TAGGTTTTGCAGAAGGCTAAAGG - Intergenic
1013869561 6:114740849-114740871 TAGAGGTGGCAGAAGGTTAAAGG + Intergenic
1014813623 6:125911588-125911610 TAGGGGTTGCAGAAGGATGAAGG + Intronic
1015145940 6:129987058-129987080 TTGGGTTAGCTCAAGGTTCAGGG - Intergenic
1015455529 6:133423129-133423151 GAGGGTTTGCAGGAGGATCAGGG + Intronic
1015568839 6:134601370-134601392 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1015947457 6:138517328-138517350 TAGGGTTTGCAGAAACTGGATGG + Intronic
1017129959 6:151099654-151099676 CAGGGTTCGTAGAAGATTCAGGG + Intronic
1018687746 6:166317017-166317039 TAGGGGCTGCAGAAGGATGAAGG - Intergenic
1018691194 6:166345460-166345482 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1020508297 7:9020414-9020436 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1022454352 7:30545553-30545575 TAGGGGTTGCAGAAGGATGAAGG - Intronic
1023274429 7:38502774-38502796 TAGGGATGGCACCAGGTTCAAGG - Intronic
1023399831 7:39784559-39784581 TGGGGTTTGCAGAACTTTCAGGG - Intergenic
1023664315 7:42505908-42505930 TAGGATTTGAATAAAGTTCAGGG - Intergenic
1023899958 7:44468025-44468047 CAGGGTTCGTAGAAGATTCAAGG + Intronic
1025724262 7:64043239-64043261 TTGGGTCTGCAGCAGGTTCTGGG + Intronic
1025753320 7:64312069-64312091 TTGGGTCTGCAGCAGGTTCTGGG - Intronic
1027216295 7:76185953-76185975 TAGGGTTTGCAGCAGGAGCTGGG - Intergenic
1027697655 7:81431926-81431948 TAGGGTTGGTAGAAGGGTGAGGG - Intergenic
1029424274 7:100486672-100486694 CAGGGTTGCCAGAAGGTCCAGGG - Intronic
1033086317 7:138345267-138345289 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1033904482 7:146185109-146185131 TAGGGTTTATAGAATGTTTATGG - Intronic
1034115541 7:148580529-148580551 CAGGGTTTGGAGAACATTCAAGG + Intergenic
1034264507 7:149774353-149774375 AGGGGTTTGGAGAAAGTTCATGG - Intergenic
1041403120 8:57465440-57465462 TAAGGGTTGCAGAAGGATGAAGG - Intergenic
1043168520 8:76934597-76934619 TACGGATTGCAGAAGCTACAGGG + Intergenic
1044216786 8:89621275-89621297 TAGGGTTTGTATTAGGTTCTAGG - Intergenic
1046909102 8:119606359-119606381 GAGGCTTTGCAGCAGTTTCAGGG + Intronic
1049456975 8:142697994-142698016 TTGGGCTTGCAGATGGTTCTTGG - Intergenic
1050282549 9:4066295-4066317 TAGGGTTTCCAGAAGCATCCAGG + Intronic
1052349918 9:27447974-27447996 TAGAGTTTGCATCAGGTGCAGGG + Intronic
1052528786 9:29655743-29655765 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1054935219 9:70679943-70679965 AAGGCTTTGCAGAAGAATCACGG - Intronic
1055134145 9:72807769-72807791 AAGAGGCTGCAGAAGGTTCAAGG + Intronic
1056954937 9:91074180-91074202 GAGGGCTTGCAGAAAGCTCACGG + Intergenic
1058119612 9:101124260-101124282 TAGCGGTTGCAGAAGGATGAAGG + Intronic
1058930312 9:109712575-109712597 TATGGTTTGCAGAAAGATTAAGG + Intronic
1059417409 9:114170388-114170410 TGGCGTTTCCAGAAGGCTCAGGG + Intronic
1059516940 9:114904773-114904795 TAGGCATTGCAGAAAGTACAAGG + Intronic
1059532485 9:115048507-115048529 TAGGTTTTCCAGAAGGGGCAGGG + Exonic
1059748723 9:117228343-117228365 TAGGTTTTGAAAAAGGTTGATGG - Intronic
1059919981 9:119149306-119149328 TAGGATTTGGAGAAGTTTAATGG + Intergenic
1060018130 9:120104850-120104872 GAGGATGTGCTGAAGGTTCAAGG + Intergenic
1060075164 9:120584181-120584203 TAGGTTTGGCAGAAAGATCATGG - Intergenic
1189426688 X:40908112-40908134 TAGGGTTTGTAGAAGGTTCAAGG + Intergenic
1190382368 X:49852121-49852143 TAGGGGTTGAAGCAGGTTGAAGG + Intergenic
1190533630 X:51406268-51406290 TAGGGATTGCCTAAGGTTAAGGG - Intergenic
1191145815 X:57164122-57164144 TAGGATTTGGAGAAGGCACAAGG + Intergenic
1191889554 X:65926256-65926278 TCTGGTTTGCATAAGGCTCAGGG + Intergenic
1193453416 X:81699662-81699684 GAGGGTTTTTAGAAGGTTAAAGG + Intergenic
1193881048 X:86921353-86921375 GAGGATTTGTAGAAGGTTTAGGG + Intergenic
1194033422 X:88842850-88842872 TAGAGGTTGCAGAAGGATGAAGG + Intergenic
1195059870 X:101183825-101183847 TAGGGGCTGCAGAAGGATGAAGG + Intergenic
1196663549 X:118293640-118293662 TAGGGGTTGCAGAAGGATGGAGG + Intergenic
1197524609 X:127546285-127546307 TGGCCTTTGCACAAGGTTCAGGG + Intergenic
1198344542 X:135746803-135746825 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1199066759 X:143428359-143428381 TAAGGTCTTCAGAAAGTTCAAGG - Intergenic