ID: 1161748273

View in Genome Browser
Species Human (GRCh38)
Location 19:6075035-6075057
Sequence GCTTCCCACCATGTGATGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 160}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161748265_1161748273 15 Left 1161748265 19:6074997-6075019 CCCTCCCTTATGGAAGGGACCCC 0: 1
1: 0
2: 2
3: 11
4: 141
Right 1161748273 19:6075035-6075057 GCTTCCCACCATGTGATGTGAGG 0: 1
1: 0
2: 0
3: 18
4: 160
1161748270_1161748273 -4 Left 1161748270 19:6075016-6075038 CCCCAGAGAGCTCTCTCTGGCTT 0: 1
1: 0
2: 3
3: 49
4: 397
Right 1161748273 19:6075035-6075057 GCTTCCCACCATGTGATGTGAGG 0: 1
1: 0
2: 0
3: 18
4: 160
1161748271_1161748273 -5 Left 1161748271 19:6075017-6075039 CCCAGAGAGCTCTCTCTGGCTTC 0: 1
1: 0
2: 2
3: 30
4: 332
Right 1161748273 19:6075035-6075057 GCTTCCCACCATGTGATGTGAGG 0: 1
1: 0
2: 0
3: 18
4: 160
1161748266_1161748273 14 Left 1161748266 19:6074998-6075020 CCTCCCTTATGGAAGGGACCCCA 0: 1
1: 0
2: 0
3: 13
4: 115
Right 1161748273 19:6075035-6075057 GCTTCCCACCATGTGATGTGAGG 0: 1
1: 0
2: 0
3: 18
4: 160
1161748267_1161748273 11 Left 1161748267 19:6075001-6075023 CCCTTATGGAAGGGACCCCAGAG 0: 1
1: 10
2: 87
3: 350
4: 848
Right 1161748273 19:6075035-6075057 GCTTCCCACCATGTGATGTGAGG 0: 1
1: 0
2: 0
3: 18
4: 160
1161748268_1161748273 10 Left 1161748268 19:6075002-6075024 CCTTATGGAAGGGACCCCAGAGA 0: 1
1: 10
2: 110
3: 367
4: 950
Right 1161748273 19:6075035-6075057 GCTTCCCACCATGTGATGTGAGG 0: 1
1: 0
2: 0
3: 18
4: 160
1161748272_1161748273 -6 Left 1161748272 19:6075018-6075040 CCAGAGAGCTCTCTCTGGCTTCC No data
Right 1161748273 19:6075035-6075057 GCTTCCCACCATGTGATGTGAGG 0: 1
1: 0
2: 0
3: 18
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161748273 Original CRISPR GCTTCCCACCATGTGATGTG AGG Intronic
900901575 1:5520022-5520044 GCTTCCCAGCTTGTGATGGGAGG + Intergenic
902114894 1:14113307-14113329 CCTGCCAACCTTGTGATGTGTGG + Intergenic
902362492 1:15949819-15949841 GCCTCCCACCACGTGATGTCTGG + Intronic
902833456 1:19032713-19032735 GCTTCCCACAATGTGACCTTGGG - Intergenic
903062947 1:20682993-20683015 GTTTCCCTCCCTGTGAAGTGGGG - Intronic
903263906 1:22145080-22145102 TCTTCCCTCCTTGTGATGAGAGG + Intergenic
903648610 1:24909841-24909863 GCCTCCCACCAAGTCACGTGAGG - Intronic
903934396 1:26885048-26885070 CCTTCCCACCATGTGATATATGG - Intronic
906480386 1:46195715-46195737 TCTTCCCACTATGTTATATGAGG + Intronic
907508776 1:54943135-54943157 GCTTCTCAGCCTGTGATGGGAGG - Intergenic
907685835 1:56610098-56610120 GCTTCCAAGCATGTGATGGGTGG + Intronic
911972113 1:104452156-104452178 GCTTCTGAGCCTGTGATGTGAGG - Intergenic
912503913 1:110142426-110142448 GCTTTCCACCATGACATGTCAGG + Intergenic
915719911 1:157977383-157977405 GCTTCTTACTCTGTGATGTGGGG - Intergenic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
918111146 1:181456426-181456448 GCGACCCTCCATGTGATCTGAGG + Intronic
918117088 1:181507098-181507120 TCTTCCCACTATCTGATGTGAGG - Intronic
919124338 1:193377819-193377841 GCTTCCCAGCCTGTGATGGGAGG - Intergenic
923789657 1:237100948-237100970 GTTTGTCACCATGTGATGTTGGG + Intronic
1062903894 10:1166738-1166760 GCTTCCCTCGATGTGATGCACGG + Intergenic
1064633875 10:17344390-17344412 GCCTGCCACCATGTGAGATGTGG - Intronic
1065189648 10:23197656-23197678 GATTCCCACGACGGGATGTGAGG + Intergenic
1066648268 10:37632786-37632808 GGCTCCCATGATGTGATGTGGGG - Intergenic
1066965882 10:42264240-42264262 GCCTCCAACCCTGTGATGGGAGG - Intergenic
1071169581 10:82848713-82848735 CCCTCCCACCATGATATGTGGGG - Intronic
1082765650 11:57165521-57165543 GCCTGCCACCATGTGAGATGTGG - Intergenic
1083315948 11:61815242-61815264 GCTTCCCGCAGTGTGATTTGGGG - Intronic
1083731512 11:64654900-64654922 GCTTCCCTCCATGTGAGCTGAGG + Intronic
1088807410 11:113365145-113365167 GCTTCCCACACTGTTCTGTGTGG - Intronic
1090992883 11:131836614-131836636 GCTTCTCTCCATGTCATGAGTGG + Intronic
1092785850 12:12025899-12025921 TCTTCCCACCATGTGACCTCTGG - Intergenic
1100577186 12:95903892-95903914 GCTTCACAGCATGAGTTGTGAGG + Intronic
1101427333 12:104598904-104598926 GCTGCCCAACCTGTGAGGTGAGG - Intronic
1101513701 12:105415313-105415335 TCTACCACCCATGTGATGTGAGG + Intergenic
1101967977 12:109293934-109293956 GCTTCCCCCTCTGTGAAGTGGGG - Intronic
1103624124 12:122205706-122205728 GCTTCCCCTCTTGTGGTGTGTGG + Intronic
1105776617 13:23667993-23668015 GCTCCCATCCATGTGCTGTGAGG + Exonic
1108634403 13:52318116-52318138 GCTTCATCCCATGTGATGGGGGG + Intergenic
1109614118 13:64808627-64808649 GCTTCCAGGCATGTGATGGGAGG - Intergenic
1109905157 13:68830798-68830820 GCCTCCCAGCTTGTGATGGGAGG - Intergenic
1110803830 13:79732225-79732247 GCTTCCCACCTTGTTCTGTGAGG - Intergenic
1112616352 13:101010318-101010340 GCTTCCCACAGTGTGACTTGCGG + Intergenic
1112734958 13:102406146-102406168 CCCTGCCACCATGTGAGGTGAGG - Intergenic
1112857288 13:103787009-103787031 GCCTCCCAGCTTGTGATGGGAGG + Intergenic
1115009054 14:28522320-28522342 GCTTCCCAGCTTGTGATAGGAGG - Intergenic
1116920759 14:50571127-50571149 GCTTCCAACAATGAGAGGTGGGG + Intronic
1120334979 14:83143093-83143115 GGTTCCTACCATGACATGTGGGG + Intergenic
1120947464 14:90011981-90012003 GCTTCCAGGCATGTGATGGGAGG - Intronic
1121317125 14:92968928-92968950 CCTTCCCAGCATGTGCTCTGTGG - Intronic
1122981911 14:105195889-105195911 ACTTCCCACCATGTGCCCTGGGG - Intergenic
1124722207 15:32120124-32120146 GCTTCCCGCCCTGAGATTTGTGG - Intronic
1124989207 15:34654125-34654147 CATCCCCACCATGTGATCTGAGG + Intergenic
1125674690 15:41495697-41495719 GCTTCCCAGGATGTGGAGTGTGG + Intronic
1127252313 15:57253174-57253196 GTTTCCTACTATGTGATATGTGG - Intronic
1127284725 15:57522300-57522322 TCTGCCAACCATGTGATGTGGGG - Intronic
1132948935 16:2549403-2549425 GCATCCCTCCAGGGGATGTGAGG + Intronic
1132965652 16:2652724-2652746 GCATCCCTCCAGGGGATGTGAGG - Intergenic
1140596085 16:76414533-76414555 GCTTCCCAGCTTGTTTTGTGAGG - Intronic
1140602379 16:76492729-76492751 GCTTGCCACCATGTAAGATGTGG + Intronic
1142624164 17:1181326-1181348 GCTCCCCAGCCTGTGATGAGTGG - Intronic
1145732717 17:27203992-27204014 CTTTACCACCATGAGATGTGGGG + Intergenic
1146226574 17:31071801-31071823 TTTTACCACCATGAGATGTGGGG - Intergenic
1147688868 17:42303265-42303287 ATTTCCTACCATGTGATCTGGGG + Intronic
1148460791 17:47838043-47838065 GCTTCCCGCCAGGTGAAGGGGGG + Intronic
1148823777 17:50377292-50377314 GTTTCCCCACCTGTGATGTGGGG - Intronic
1153727769 18:7975107-7975129 TCCTCCCAGCATTTGATGTGTGG - Intronic
1155368231 18:25070748-25070770 GCTTCCCACCAAGAGATATGTGG - Intronic
1155568661 18:27165480-27165502 ACTTCCCACCATGGGATGAGAGG - Intronic
1156547290 18:37977243-37977265 GCTTCCCACCCTTTGAAGTTTGG - Intergenic
1157583220 18:48785433-48785455 GCTCCCCAGCCTGAGATGTGAGG - Intronic
1159608568 18:70499860-70499882 TTTTCCTTCCATGTGATGTGAGG + Intergenic
1161748273 19:6075035-6075057 GCTTCCCACCATGTGATGTGAGG + Intronic
1162255066 19:9483233-9483255 GCTGCCCACCATCTGAGATGTGG + Intronic
1164256685 19:23533757-23533779 GCCGCCCATCATGAGATGTGGGG - Intronic
1165155674 19:33785900-33785922 GCTTGCCACCAAGTGAAGGGTGG - Intergenic
931144611 2:59503572-59503594 TCTTTCCTCCATGTGGTGTGTGG - Intergenic
931229951 2:60365704-60365726 GCTTCCACCCATGAAATGTGGGG + Intergenic
933919904 2:87034927-87034949 GTTTCACCACATGTGATGTGTGG - Intergenic
933928299 2:87121663-87121685 GTTTCACCACATGTGATGTGTGG - Intergenic
933931719 2:87158855-87158877 GTTTCACCACATGTGATGTGTGG + Intergenic
934003091 2:87734968-87734990 GTTTCACCACATGTGATGTGTGG + Intergenic
934314156 2:91901020-91901042 GCCTCCAACCCTGTGATGGGAGG + Intergenic
935385266 2:102492644-102492666 GCCTCCAGCCATGTGATGGGAGG + Intronic
936361398 2:111806578-111806600 GTTTCACCACATGTGATGTGTGG - Intronic
938147429 2:128848442-128848464 GCTTCCCAGCAGCTGCTGTGGGG + Intergenic
942907859 2:181205625-181205647 GCTTGCCACCATGTAAGATGTGG - Intergenic
943223545 2:185140288-185140310 GCTTCCAGCCCTGTGATGAGAGG + Intergenic
943449782 2:188033358-188033380 GCTTCCTGGCATGTGATGGGAGG - Intergenic
943560823 2:189459865-189459887 CCTACCCACCATGTCATGTTAGG - Intronic
944552211 2:200855055-200855077 GGTCCCAACCATGTGATGTCTGG - Exonic
946447723 2:219754099-219754121 GCTTCCTCCCATGACATGTGAGG - Intergenic
948271112 2:236673965-236673987 GCTTCACACCATGGCATCTGCGG - Intergenic
948551968 2:238778788-238778810 GCTTCCCAACTGGAGATGTGGGG - Intergenic
1170160509 20:13305449-13305471 GCTTCCCAGGAAGTGTTGTGGGG + Intergenic
1170196267 20:13692691-13692713 GTCTCTCACCATGTGATGTGTGG + Intergenic
1170316256 20:15044142-15044164 GGATCCGACCATGTGATGAGAGG - Intronic
1170859375 20:20088580-20088602 GCTTCCTCCCATGACATGTGGGG + Intronic
1172495227 20:35377358-35377380 GCTTCCCAAGATGTGTTCTGTGG - Intronic
1174039649 20:47689876-47689898 GCCTCCCACCAAGAGGTGTGTGG - Intronic
1174519695 20:51119943-51119965 GATTACCAACATGTGAAGTGAGG + Intergenic
1177296310 21:19180989-19181011 GGTACCCACCAGGTGGTGTGGGG - Intergenic
1181771410 22:25128380-25128402 GCTTCACACCAGGTGTTGGGTGG + Intronic
1182887625 22:33789081-33789103 GCCTCCAAGCCTGTGATGTGAGG - Intronic
1184279557 22:43429240-43429262 GATTCCCACCCAGTGCTGTGTGG + Intronic
951893180 3:27585784-27585806 GCTTTCTACCATAGGATGTGTGG + Intergenic
952635385 3:35523024-35523046 GCTACTCACCACGTGCTGTGTGG + Intergenic
953060222 3:39421792-39421814 TTTTACCACCATGTAATGTGAGG - Intergenic
953779340 3:45852638-45852660 TCTTCCCACATTTTGATGTGAGG - Intronic
954914743 3:54139177-54139199 GCGTTCCACCATGAGATGGGTGG + Intronic
955489639 3:59469507-59469529 GGTACCCACCACGTGGTGTGGGG - Intergenic
960044167 3:113180099-113180121 GCTTCTGCCCATGTGATATGAGG + Intergenic
961000478 3:123370848-123370870 CCTTCCCACCACGTGCTCTGGGG + Intronic
963706596 3:148696237-148696259 GCTTCTCACCACTTGCTGTGTGG - Intergenic
965074896 3:163963839-163963861 GCTTCCAAGCCTGTGATGGGAGG - Intergenic
967412547 3:189181173-189181195 GCCTCCCAGCCTGTGATGGGAGG + Intronic
971012525 4:22454361-22454383 GCCTCTGACCATGTGATCTGGGG - Intronic
974716834 4:65678809-65678831 GCCTCCCAGCTTGTGATATGAGG - Intergenic
976881670 4:89932788-89932810 GCTTCCCAGCTGGTGATGGGAGG + Intronic
979060933 4:116059438-116059460 ACTTCCAAGCATGTGATGGGAGG + Intergenic
980545834 4:134260310-134260332 GCCTCCCAGCTTGTGATGGGAGG + Intergenic
981755899 4:148141668-148141690 GCTGCCCACCACCTGCTGTGTGG - Intronic
981880439 4:149604853-149604875 GCTTCCCAGGAGGTGATGGGGGG + Intergenic
983789945 4:171783665-171783687 GCTTCCCAGCTTGTAATGGGAGG + Intergenic
984710238 4:182878824-182878846 GTGTCCCACCATGTCACGTGGGG + Intergenic
988579837 5:32459143-32459165 GCTTCCAGGCATGTGATGGGAGG + Intergenic
988893922 5:35651194-35651216 GCTTCCCACTCTGTCAGGTGTGG - Intronic
989515721 5:42340151-42340173 GCCTCCAAGCCTGTGATGTGAGG + Intergenic
990517043 5:56539952-56539974 GCCAGCCACCATGCGATGTGGGG - Intronic
992344242 5:75860072-75860094 GGTACCCACCAGGTGGTGTGGGG + Intergenic
992425241 5:76650104-76650126 GCTTCCCAGCCTGTGATGGCAGG + Intronic
993985792 5:94595510-94595532 GCTTCCCCACTTGTGATGGGAGG + Intronic
998161202 5:139813900-139813922 GCTTCCCACCCTGTGTCCTGAGG + Intronic
1001415663 5:171543397-171543419 GCTTCCCACCATGTTTGGTTTGG - Intergenic
1001970907 5:175954244-175954266 GCTTCCCACCCTGTGAACTGGGG + Intronic
1002246530 5:177889521-177889543 GCTTCCCACCCTGTGAACTGGGG - Intergenic
1003003050 6:2354691-2354713 ACTTCCCAAAATGTAATGTGTGG - Intergenic
1004396376 6:15248953-15248975 GCTTCCCACCAGGTGAGGGCCGG + Intronic
1004748166 6:18533700-18533722 ACTTCCCAAAATGTGATGTAAGG - Intergenic
1005711132 6:28503670-28503692 CCTTCCCTTCATGTGAGGTGGGG + Exonic
1006899212 6:37489440-37489462 GGTTCCCACCATGCCATGTCTGG - Intronic
1008430909 6:51415635-51415657 GTTTCACCTCATGTGATGTGAGG + Intergenic
1011101446 6:83727396-83727418 GCTGCCCATCCTGTGAAGTGTGG - Intergenic
1013580285 6:111527315-111527337 GCTTTCCACCATGTGAAGACAGG + Intergenic
1016639699 6:146334670-146334692 GCTTCCCACCAGCTTATGTCTGG + Intronic
1023811654 7:43916720-43916742 GCTTTCACCCATGTTATGTGGGG - Intronic
1024865867 7:53904542-53904564 GCCTCCCACCCTGCGATGGGAGG + Intergenic
1028811758 7:95095879-95095901 TTTTCCCACCATGTGATGTCTGG + Intronic
1028814610 7:95130132-95130154 GCCTCCCAGCCTGTGATGGGAGG - Intronic
1032632538 7:133669339-133669361 TTCCCCCACCATGTGATGTGTGG - Intronic
1034163237 7:149007416-149007438 GCTTCCCACCAGGAGCTGTGGGG + Intronic
1037592000 8:20320790-20320812 ATTTCCTTCCATGTGATGTGTGG - Intergenic
1037989056 8:23307587-23307609 GGTTCCTACCATGTAATCTGTGG + Intronic
1038129118 8:24709364-24709386 AATTCCCACCATCTGATGGGTGG + Intergenic
1042062586 8:64837095-64837117 CCTTCCCTCCCTGTGATGTTAGG - Intergenic
1043533677 8:81176712-81176734 GCTTCAGAGCCTGTGATGTGAGG + Intergenic
1044523599 8:93226805-93226827 GCTTCCCTACAAGTGCTGTGAGG + Intergenic
1044851400 8:96432434-96432456 GCTTCCCAACCTGTGATGGGAGG - Intergenic
1048527081 8:135213051-135213073 GCTGCCCAGCATGGGCTGTGAGG + Intergenic
1049541104 8:143209394-143209416 GCTGCCCACCATGTGCACTGAGG - Intergenic
1050485024 9:6125140-6125162 GCTTTCCACCACGTGTGGTGTGG - Intergenic
1053064772 9:35060348-35060370 GCTGCTCACCATGTGGTTTGGGG - Exonic
1057332462 9:94128747-94128769 GCCTCCCAGCCTGTGATGGGTGG - Intergenic
1058009055 9:99955036-99955058 GCTTTCCACCAAGTGAAGTGAGG + Intronic
1059423668 9:114207616-114207638 GCTTCCCACCCAGGGCTGTGTGG - Intronic
1061500129 9:130997298-130997320 ACCTCCCACCATGTCATTTGAGG - Intergenic
1061840054 9:133353443-133353465 GCTTGCCATCATCTAATGTGTGG + Intronic
1062206529 9:135340759-135340781 GCTTCTCACCATGTGTGCTGTGG + Intergenic
1062422057 9:136487396-136487418 GCTTGCCACCCTGTGAGGTCAGG - Intergenic
1187670961 X:21665394-21665416 GCTTCAAGCCATGTGAGGTGTGG - Intergenic
1188660891 X:32757492-32757514 AATTCCCACCATGTCATGGGAGG + Intronic
1189912689 X:45827068-45827090 GCATCCCACTTTGGGATGTGAGG + Intergenic
1192569106 X:72188081-72188103 GCATCCAATCATGTGAAGTGGGG + Intronic
1193167789 X:78301921-78301943 GCCTGCCACCATGTAAGGTGTGG - Intronic
1194048603 X:89039190-89039212 GCCTCCCAGACTGTGATGTGAGG - Intergenic
1194982295 X:100453114-100453136 GCCTCCCAGCCTGTGATGGGAGG - Intergenic
1196653122 X:118188911-118188933 GCTGCCCCAGATGTGATGTGGGG - Intergenic
1199309548 X:146307240-146307262 GCTTCTCAGCCTGTGATGGGAGG - Intergenic
1202342972 Y:23888779-23888801 GGTACCCATCAGGTGATGTGGGG + Intergenic
1202527796 Y:25781306-25781328 GGTACCCATCAGGTGATGTGGGG - Intergenic