ID: 1161748619

View in Genome Browser
Species Human (GRCh38)
Location 19:6077423-6077445
Sequence AGGCACACGCCCCTCTTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 78}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161748619_1161748623 -10 Left 1161748619 19:6077423-6077445 CCACCCAAGAGGGGCGTGTGCCT 0: 1
1: 0
2: 0
3: 12
4: 78
Right 1161748623 19:6077436-6077458 GCGTGTGCCTCTGCAGGAAATGG 0: 1
1: 0
2: 0
3: 22
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161748619 Original CRISPR AGGCACACGCCCCTCTTGGG TGG (reversed) Intronic
902629779 1:17697695-17697717 AGCCACACGCCCCTCCTGGAAGG + Exonic
902821361 1:18945309-18945331 AGGCAGAAGGCCATCTTGGGGGG - Intronic
902996370 1:20228636-20228658 AGGCATACACCCCTCCTGGCTGG - Intergenic
904735041 1:32625274-32625296 TGGCTCACGCCTCTTTTGGGAGG + Intronic
907774359 1:57498909-57498931 AGGCTCACTCTCCTCTAGGGAGG + Intronic
908150467 1:61295966-61295988 ATGCACACTCCTCTCTTAGGGGG + Intronic
915497505 1:156292292-156292314 ACACACACACCCCTCTTGGTAGG - Exonic
919529723 1:198701921-198701943 AGGCACACACCTCTCTGGGGAGG - Intronic
919796293 1:201323293-201323315 AGGCACACTCTGCTCATGGGAGG - Intronic
919858745 1:201724382-201724404 AGGCACACGTGCCTGATGGGAGG + Intronic
919931378 1:202223459-202223481 AAGCACACGCATTTCTTGGGGGG + Intronic
921069461 1:211646978-211647000 AGGCACACGCCCCCCATGCCCGG + Intergenic
922758397 1:228109371-228109393 AGATATACGCCCCTGTTGGGCGG + Intergenic
922764657 1:228150672-228150694 AGGCCCACACCCCTCTGGGAGGG + Intronic
1062820528 10:531356-531378 AAGCACACGCCCCTCAGGAGGGG - Intronic
1074753902 10:116610516-116610538 AGGGACACCCACCCCTTGGGTGG + Intergenic
1076183967 10:128432170-128432192 AGGAACACGCCCTTCTTGGCAGG + Intergenic
1076637711 10:131893186-131893208 AGGCCCACGCCCCTTTCTGGAGG + Intergenic
1076798962 10:132811908-132811930 GGGCCCACACCCCTCATGGGGGG + Intronic
1083125380 11:60560209-60560231 AGCCAGATGACCCTCTTGGGGGG - Intergenic
1083709915 11:64541522-64541544 AGGCAGATGCTCCTCTTGAGGGG - Intergenic
1084418505 11:69048776-69048798 AGGGCCCCGCCCCTCTAGGGTGG - Intergenic
1084666736 11:70580470-70580492 AGGCCCACGCCGCTCATTGGCGG - Intronic
1089399422 11:118155898-118155920 ATGCACACGCAGCTCTTGGGTGG + Intergenic
1090560083 11:127922563-127922585 AGGCACAGGCCCCTATTAAGGGG - Intergenic
1096502654 12:52074304-52074326 AGGGACACTCCCATCTTGGATGG - Intronic
1109651809 13:65336879-65336901 AGCCTCAGGCCTCTCTTGGGGGG - Intergenic
1112810921 13:103217518-103217540 AGGCAGAAGCCCCTCATTGGAGG - Intergenic
1119569600 14:75658836-75658858 AGGCACTCTTCCCTGTTGGGTGG + Intronic
1122740193 14:103867761-103867783 TGGCACGCGCCCCTCTGAGGAGG - Intergenic
1123048341 14:105528940-105528962 ATGCACACGCCGATCTTGCGCGG - Exonic
1125710092 15:41777847-41777869 AGGTACATGCCCCTTTTGGGGGG + Intronic
1128943697 15:71807890-71807912 AGGCAGCTGCCCCTCCTGGGAGG + Intronic
1132616103 16:841868-841890 AAGCACAGGCCCCTCCCGGGAGG - Intergenic
1132690717 16:1180743-1180765 AGCCACAGGCCCCTATTCGGCGG - Intronic
1140527234 16:75633005-75633027 AGCCAGATGGCCCTCTTGGGGGG + Intronic
1142221514 16:88857142-88857164 ATGCACACCGCCATCTTGGGAGG - Exonic
1144094684 17:11889488-11889510 AGGCACATGCCAATCTAGGGGGG - Intronic
1151099688 17:71542736-71542758 AGAGACACCCCCCTCTTGGGTGG - Intergenic
1153988786 18:10376734-10376756 AGGCACATCCCTCTCTTGGTGGG + Intergenic
1157283787 18:46363420-46363442 AGGCACATGCCCCTGATGGCCGG - Intronic
1157569819 18:48704901-48704923 AGGCACAGGCCCCTCAGGGTGGG + Intronic
1160363877 18:78307953-78307975 AGGCACACGCACCTCTCTGCAGG + Intergenic
1160450994 18:78965986-78966008 AGGGTCACGCCCCTCTGGGCAGG + Intergenic
1161491934 19:4567020-4567042 CGACTCACGCCCCTCTTGGGCGG + Intergenic
1161715749 19:5875371-5875393 AGGCACAGGCCCCACTCTGGTGG + Intronic
1161748619 19:6077423-6077445 AGGCACACGCCCCTCTTGGGTGG - Intronic
1167116469 19:47491920-47491942 AGGAGCACGTCCCTCTTCGGGGG + Intronic
927928016 2:27026514-27026536 AGGCAGAAGCCCGTCCTGGGTGG + Exonic
937872967 2:126798932-126798954 AGGAACATGCCCCTCCCGGGTGG - Intergenic
946025812 2:216671089-216671111 AGGCACACCTCCTTCTGGGGTGG - Intergenic
948403251 2:237699856-237699878 AGGCACAGGGCACTCTGGGGTGG - Intronic
948857829 2:240738438-240738460 AGTCCCATGGCCCTCTTGGGAGG + Intronic
1168878399 20:1186013-1186035 AGGAGAACACCCCTCTTGGGCGG - Intronic
1170655862 20:18287676-18287698 AGGCCCACGTCACTCTTGAGAGG - Intergenic
1178303565 21:31471930-31471952 AGGCTCCCGCCCCTCTCAGGTGG - Intronic
1179410065 21:41155724-41155746 AGGAACTTGCCCCTCCTGGGTGG - Intergenic
1180788423 22:18559696-18559718 ATGCTCAGGCCCCTCTTAGGGGG - Intergenic
1181233315 22:21435622-21435644 ATGCTCAGGCCCCTCTTAGGGGG + Intronic
1181245335 22:21499221-21499243 ATGCTCAGGCCCCTCTTAGGGGG - Intergenic
1181495147 22:23283483-23283505 AGGCACAGGCCCCTGTGGTGGGG - Intronic
1184322383 22:43752464-43752486 AGACATCCGCCCTTCTTGGGTGG + Intronic
1185301615 22:50083950-50083972 AGGCAGACGCCTGTCTTGGTGGG + Intronic
950073966 3:10174073-10174095 ACACACACTCCCATCTTGGGAGG - Intronic
950202464 3:11054968-11054990 AAGGACATGGCCCTCTTGGGAGG - Intergenic
951234383 3:20217589-20217611 AGGCACTCCCAGCTCTTGGGTGG - Intergenic
952957660 3:38567028-38567050 TGGCACAGGCCCCACTTGGAAGG - Intronic
967135518 3:186509684-186509706 AGGAACTAGCCCCTCCTGGGAGG - Intergenic
969225971 4:5798578-5798600 CAGCACACGCGCCTCCTGGGAGG - Exonic
970429831 4:15978559-15978581 AGGCCCACGCTCCACATGGGAGG - Intronic
976678925 4:87733633-87733655 TGGCAGCTGCCCCTCTTGGGTGG + Intergenic
978389810 4:108213631-108213653 AGATACAGGCCCCTCTTAGGAGG + Intergenic
986463241 5:7994659-7994681 AGGCAGAAGCCCCTCAAGGGTGG - Intergenic
986745189 5:10737464-10737486 AGGGACACGCCCCTCTTAAAAGG + Intronic
989101389 5:37826502-37826524 AGCCACAGGCCCGTCTTGGGAGG + Intronic
992361847 5:76046754-76046776 AGGCTCAAGCCCCTCCTGAGGGG + Intergenic
994720209 5:103371801-103371823 TGGCACAGGCTCCTCTTGGCAGG + Intergenic
1002966133 6:1968506-1968528 AGGCCCACTCCCCTCTTGCGGGG + Intronic
1005169113 6:22961235-22961257 AGGCAAACCCCCTTTTTGGGTGG - Intergenic
1012575111 6:100785978-100786000 AGGCATACCCTCTTCTTGGGAGG + Intronic
1019146855 6:169981269-169981291 ACGCACTCGCCCCTCTGGGGTGG + Intergenic
1019354687 7:572394-572416 AGGAGCAGGCCCCTCCTGGGTGG - Intronic
1024094448 7:45972951-45972973 AGGCACAAGCCCCTGTGGGCAGG + Intergenic
1025080360 7:55976512-55976534 TGCCACACTGCCCTCTTGGGAGG + Intronic
1040566410 8:48571702-48571724 TGGCAGAAGCCCCTCTTGGCAGG + Intergenic
1043981453 8:86645493-86645515 ATGCACACAACCCTTTTGGGGGG - Intronic
1047946373 8:129884918-129884940 AGGAACACGCCCTTCCTGGCCGG + Intronic
1052979588 9:34438238-34438260 AGGCACAGGCCTCACTGGGGAGG - Intronic
1203492272 Un_GL000224v1:118718-118740 AGGGACACGCCCCTCCTGGTAGG - Intergenic
1203504895 Un_KI270741v1:60590-60612 AGGGACACGCCCCTCCTGGTAGG - Intergenic
1188769098 X:34131050-34131072 TGGCACACTCCAGTCTTGGGAGG + Exonic