ID: 1161751608

View in Genome Browser
Species Human (GRCh38)
Location 19:6101684-6101706
Sequence GACCCAATCCTTTTTCACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161751605_1161751608 -4 Left 1161751605 19:6101665-6101687 CCTTCTGCCTTTCTGTGGGGACC 0: 1
1: 0
2: 2
3: 18
4: 268
Right 1161751608 19:6101684-6101706 GACCCAATCCTTTTTCACATGGG 0: 1
1: 0
2: 2
3: 6
4: 109
1161751601_1161751608 23 Left 1161751601 19:6101638-6101660 CCAGGAGACAGGCGTTCATGAGT 0: 1
1: 0
2: 1
3: 6
4: 108
Right 1161751608 19:6101684-6101706 GACCCAATCCTTTTTCACATGGG 0: 1
1: 0
2: 2
3: 6
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161751608 Original CRISPR GACCCAATCCTTTTTCACAT GGG Intronic
906179559 1:43806658-43806680 TTCCCAATCCCTTTTCACATTGG - Intronic
908310798 1:62880936-62880958 GACCCTATCCATTTTCCCTTTGG + Intergenic
908995991 1:70154980-70155002 TACCCTATCCTGTCTCACATTGG + Intronic
917013640 1:170504302-170504324 GACCCAACACTTTTTGAGATGGG + Intergenic
921697904 1:218233306-218233328 TAACCAGTCCTTTCTCACATTGG + Intergenic
1064151889 10:12872256-12872278 GGCCCTCTCCTTTTTCACACAGG - Intergenic
1064316112 10:14258646-14258668 GACCCAATCATTTTATACCTAGG + Intronic
1064326218 10:14353929-14353951 AACCCAATGCTTTGTCACAGTGG - Intronic
1064421398 10:15193879-15193901 GACCCCATACATTTTTACATAGG + Intergenic
1065975650 10:30839682-30839704 GAACCAAGCCTTTTTGACAATGG - Intronic
1066333936 10:34457188-34457210 TGACCAATCCTTTTTCATATTGG - Intronic
1066600249 10:37097500-37097522 GGCCCACTCCTTTGTTACATGGG - Intergenic
1067246722 10:44553686-44553708 GGCCCATTCCTTTTTCCCTTTGG - Intergenic
1067723787 10:48750859-48750881 GACCCAGTCCATGCTCACATGGG - Intronic
1069299111 10:66884491-66884513 GCCCCAGTCCTTTGTCACATGGG - Intronic
1074654128 10:115562711-115562733 GAACACATCCTTATTCACATGGG - Intronic
1074676107 10:115853051-115853073 GACCCCATCATTTTTCACATGGG - Intronic
1074926979 10:118083516-118083538 GACCCACTCCTTTTACAAATGGG + Intergenic
1079660937 11:23035711-23035733 GACCCTCTGCTTTTTCACAAGGG - Intergenic
1081725968 11:45329412-45329434 GACCCAATCTTTCTACACTTGGG + Intergenic
1085262795 11:75217802-75217824 GAGAAAGTCCTTTTTCACATGGG - Intergenic
1085505546 11:77056663-77056685 CACCCAATCCCTGTTCAAATGGG + Intergenic
1086246643 11:84761057-84761079 GACCCTCTGCTTTTTCACAAGGG - Intronic
1087109188 11:94444636-94444658 GACCTAAGTCTTTTTCACCTGGG + Intronic
1088435611 11:109809680-109809702 GTCCCAATTCTCTTTCCCATGGG - Intergenic
1088993422 11:114974308-114974330 GACACAATCCTTGTTCTCAAGGG + Intergenic
1093939225 12:25034511-25034533 GACCCAGTACTTTATAACATGGG + Intronic
1096013971 12:48250073-48250095 TTCCCAATCCTTTTTGAAATTGG - Intergenic
1097730058 12:63118441-63118463 GATCCAAACCTTTGTCAGATAGG + Intergenic
1097796444 12:63867915-63867937 AACACAATACTTTTTAACATTGG - Intronic
1104186173 12:126434043-126434065 GACCCAATCCATCATCACAGAGG - Intergenic
1104283603 12:127401927-127401949 GACCCAACACTTTTACTCATAGG - Intergenic
1104912692 12:132247280-132247302 GTCCCAATCCATTGTCACCTGGG + Intronic
1110536976 13:76662025-76662047 GAGACAATTCTTTTTCACATAGG - Intergenic
1115778118 14:36738772-36738794 GAGCTAATACTTTTTTACATAGG - Intronic
1117370176 14:55070993-55071015 GACCCAATTCTATTACACTTGGG - Intergenic
1118122887 14:62865916-62865938 GATCCAATCTTGTTTTACATAGG - Intronic
1119624661 14:76162273-76162295 GTCTCAGTCCCTTTTCACATGGG + Intronic
1120068800 14:80078978-80079000 GACCCAATCCTTGCTCTCAATGG + Intergenic
1130735864 15:86548090-86548112 GACCCACTCATTTTACAGATGGG + Intronic
1140045134 16:71435704-71435726 GATCCAACCATTTTTAACATAGG - Intergenic
1140218370 16:73025932-73025954 GTCTCAATCCTGTGTCACATTGG - Intronic
1140378442 16:74464317-74464339 GCCCACATCCTTGTTCACATTGG - Intronic
1143285265 17:5784489-5784511 GAGCCAAGCCTTTCTCTCATAGG + Intronic
1144793629 17:17876477-17876499 GACTAATTCCTCTTTCACATGGG - Intronic
1149188324 17:54028648-54028670 TATCCAATCCTGTTTCACAGTGG + Intergenic
1155058132 18:22203605-22203627 GACCCAATCATTTCTCAAAAGGG + Intergenic
1155605362 18:27599758-27599780 GACACATTGCTTTTACACATGGG - Intergenic
1155607786 18:27627708-27627730 GTCCCATCCCTTTTTCATATAGG + Intergenic
1158682416 18:59580696-59580718 GACCCAGTTCTTTTTTCCATGGG + Intronic
1161751608 19:6101684-6101706 GACCCAATCCTTTTTCACATGGG + Intronic
1162239840 19:9341733-9341755 CACTCAAGGCTTTTTCACATTGG - Exonic
1162662620 19:12182225-12182247 GACACAAAGCTTTTTCACAATGG - Intronic
1163908435 19:20167958-20167980 GACCCAAACTTTTTCCAAATAGG - Intronic
1163977043 19:20862545-20862567 GACCCAAACTTTTTCCAAATAGG + Intronic
1163977815 19:20869020-20869042 CACCCACTCCTTTCTCACAGTGG + Intergenic
1166360273 19:42250243-42250265 GACCCAATGCTTGTTCCCACAGG + Intronic
1168319593 19:55500986-55501008 GACCCCATCCTCTTTCTCAGAGG - Intronic
929831104 2:45347096-45347118 CACCCAATCACTTTTCACACTGG - Intergenic
930765744 2:55083703-55083725 GACCCAAGCCTATTTAAAATGGG + Intronic
935830953 2:107000169-107000191 GGCCCAATGCCTCTTCACATAGG - Intergenic
936647167 2:114385176-114385198 GTACCAATTCTTTTTCTCATAGG - Intergenic
937451024 2:122002144-122002166 AAACCAATTCTTCTTCACATTGG - Intergenic
939417890 2:141924492-141924514 GACCCTCTGCCTTTTCACATGGG - Intronic
941571708 2:167178223-167178245 CACTCAATCCTTTTTAATATAGG - Intronic
948253801 2:236551589-236551611 GACACAGTCCATTTTTACATTGG - Intergenic
948675796 2:239595887-239595909 GACCCAATCCTTGTACCCACGGG + Intergenic
948933289 2:241146233-241146255 ATCCAAATCCTTTTTGACATTGG - Intronic
1171141479 20:22747475-22747497 GACCCAAACTCTGTTCACATTGG - Intergenic
1173465755 20:43279963-43279985 GCCCCATTCCTTTTCCTCATGGG - Intergenic
1182214816 22:28707039-28707061 GACCCCACCCATTTTCAGATAGG - Intronic
955627727 3:60937113-60937135 GACACATTCCTTTGTCACTTTGG - Intronic
955638547 3:61056684-61056706 GACCCACACCTTTTTCAAACTGG + Intronic
957744484 3:84321237-84321259 AACCCACTCCTTTTTCCTATTGG - Intergenic
958915398 3:100044771-100044793 GGCACCAGCCTTTTTCACATTGG - Intronic
961443239 3:126965261-126965283 GACCCACTCCTTTACCACAGGGG - Intergenic
961764650 3:129199875-129199897 GAACCATTGCTTTGTCACATAGG - Intergenic
961968583 3:130933782-130933804 GTCCCAATCCTTCTTCACATCGG - Intronic
963388697 3:144630633-144630655 GCCCCAATCCATTTTCACAAAGG - Intergenic
963521060 3:146360439-146360461 GATCCAATCATCTTTCACACAGG - Intergenic
964848009 3:161064675-161064697 GCTCAAATCCTTTTTGACATGGG - Intronic
966835125 3:184043879-184043901 AACCCCCTCCTTTTTCAGATGGG + Intergenic
971095214 4:23393056-23393078 GAGCCAATCCTCTTTCGCAAGGG - Intergenic
971197174 4:24480673-24480695 GATCCAATCGTCTGTCACATTGG + Intergenic
975268256 4:72396989-72397011 AATCCACTCCTTTTTCACATTGG + Intronic
978064629 4:104381223-104381245 GACCCAAACATTTTGCCCATAGG - Intergenic
978247648 4:106594374-106594396 GACAAAATCATTTTTCACTTGGG + Intergenic
981440881 4:144780343-144780365 GACCCAATCCCTTGCCTCATGGG + Intergenic
982164941 4:152605633-152605655 GAGCCACTCCATTTTCAAATGGG + Intergenic
983094460 4:163544927-163544949 GACCCAGTTCTGTTTCTCATTGG - Intronic
984823333 4:183903783-183903805 GCCCCCAACCTTTTTCACACTGG + Intronic
986560930 5:9060397-9060419 GACCCTATCCTTGTTGCCATGGG - Intronic
986982848 5:13469067-13469089 GACCCATGCATTTTTCATATGGG - Intergenic
987349245 5:17006949-17006971 GACCCAATCCCTTGCCTCATGGG + Intergenic
988873774 5:35420632-35420654 TATCCAATCCTTTTTCCCACTGG - Intergenic
1000254775 5:159527158-159527180 GACCCTCTCATTTTTTACATTGG + Intergenic
1004129287 6:12903484-12903506 GACTCCATCCTTCTTGACATGGG + Intronic
1008399316 6:51046452-51046474 CATAGAATCCTTTTTCACATGGG + Intergenic
1011096864 6:83675890-83675912 GGCCAAATCTTTTTTGACATTGG - Intronic
1017378925 6:153804522-153804544 AACCCAATCTGTTTTTACATAGG - Intergenic
1018268514 6:162051551-162051573 GACCGAAGCCTTTCTCACAAAGG - Intronic
1030845647 7:114406621-114406643 GACTCAATTCTTTTTCAGAATGG - Intronic
1040776125 8:51045072-51045094 GACCCAATGCTCTTCCACAGTGG + Intergenic
1041133828 8:54734474-54734496 GACAGAATCCTTTGTCACACTGG - Intergenic
1042195133 8:66225567-66225589 CACTAAATCCTTTTTCACACAGG + Intergenic
1042992048 8:74652429-74652451 GACCAAATCCCTTTGCAAATTGG + Intronic
1047807066 8:128371777-128371799 TCCCCAATCCTTTGTCAGATTGG + Intergenic
1048683295 8:136871583-136871605 GACCCAAGCCTTTTATACCTTGG + Intergenic
1049410176 8:142470467-142470489 GAGCCACTCCTTTTGCACAAGGG + Intronic
1058539980 9:106001757-106001779 AACCCTATCATTTTTCAGATAGG + Intergenic
1058731985 9:107859226-107859248 GGCCCAGGCCTTTTTCACAGAGG - Intergenic
1186779512 X:12898855-12898877 CAAGCAATCCTTTTTCACCTTGG + Intergenic
1187764139 X:22620879-22620901 TCCCCAATCCTTTCTCACAAAGG - Intergenic
1190305209 X:49078023-49078045 GGCCCAATCCTCTCTCACTTTGG + Exonic
1194685305 X:96906831-96906853 CAGCCAAACCTTTTTTACATAGG + Intronic
1196753894 X:119141120-119141142 GACCCTTTCCTTTCTCCCATGGG + Intronic
1198640404 X:138749840-138749862 GACACAATCCTTTATGCCATGGG + Intronic
1200059093 X:153476193-153476215 GGCCCAACCCTTTCTCACCTGGG + Intronic