ID: 1161752835

View in Genome Browser
Species Human (GRCh38)
Location 19:6110259-6110281
Sequence CGTCCGGGTGGTGCGCCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 43}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161752835_1161752851 28 Left 1161752835 19:6110259-6110281 CCCGCGGGCGCACCACCCGGACG 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1161752851 19:6110310-6110332 CCGCCCCCCGGCCCCCGAACGGG 0: 1
1: 1
2: 7
3: 27
4: 334
1161752835_1161752849 27 Left 1161752835 19:6110259-6110281 CCCGCGGGCGCACCACCCGGACG 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1161752849 19:6110309-6110331 CCCGCCCCCCGGCCCCCGAACGG 0: 1
1: 0
2: 3
3: 51
4: 405
1161752835_1161752841 -9 Left 1161752835 19:6110259-6110281 CCCGCGGGCGCACCACCCGGACG 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1161752841 19:6110273-6110295 ACCCGGACGTTTGGGGTGAGCGG 0: 1
1: 0
2: 1
3: 5
4: 64
1161752835_1161752846 -4 Left 1161752835 19:6110259-6110281 CCCGCGGGCGCACCACCCGGACG 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1161752846 19:6110278-6110300 GACGTTTGGGGTGAGCGGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 72
1161752835_1161752852 29 Left 1161752835 19:6110259-6110281 CCCGCGGGCGCACCACCCGGACG 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1161752852 19:6110311-6110333 CGCCCCCCGGCCCCCGAACGGGG 0: 1
1: 0
2: 2
3: 26
4: 258
1161752835_1161752845 -5 Left 1161752835 19:6110259-6110281 CCCGCGGGCGCACCACCCGGACG 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1161752845 19:6110277-6110299 GGACGTTTGGGGTGAGCGGCGGG 0: 1
1: 0
2: 1
3: 5
4: 93
1161752835_1161752847 16 Left 1161752835 19:6110259-6110281 CCCGCGGGCGCACCACCCGGACG 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1161752847 19:6110298-6110320 GGGACGTGCTGCCCGCCCCCCGG 0: 1
1: 0
2: 1
3: 13
4: 169
1161752835_1161752844 -6 Left 1161752835 19:6110259-6110281 CCCGCGGGCGCACCACCCGGACG 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1161752844 19:6110276-6110298 CGGACGTTTGGGGTGAGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161752835 Original CRISPR CGTCCGGGTGGTGCGCCCGC GGG (reversed) Intronic