ID: 1161752835

View in Genome Browser
Species Human (GRCh38)
Location 19:6110259-6110281
Sequence CGTCCGGGTGGTGCGCCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 43}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161752835_1161752851 28 Left 1161752835 19:6110259-6110281 CCCGCGGGCGCACCACCCGGACG 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1161752851 19:6110310-6110332 CCGCCCCCCGGCCCCCGAACGGG 0: 1
1: 1
2: 7
3: 27
4: 334
1161752835_1161752847 16 Left 1161752835 19:6110259-6110281 CCCGCGGGCGCACCACCCGGACG 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1161752847 19:6110298-6110320 GGGACGTGCTGCCCGCCCCCCGG 0: 1
1: 0
2: 1
3: 13
4: 169
1161752835_1161752845 -5 Left 1161752835 19:6110259-6110281 CCCGCGGGCGCACCACCCGGACG 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1161752845 19:6110277-6110299 GGACGTTTGGGGTGAGCGGCGGG 0: 1
1: 0
2: 1
3: 5
4: 93
1161752835_1161752846 -4 Left 1161752835 19:6110259-6110281 CCCGCGGGCGCACCACCCGGACG 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1161752846 19:6110278-6110300 GACGTTTGGGGTGAGCGGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 72
1161752835_1161752852 29 Left 1161752835 19:6110259-6110281 CCCGCGGGCGCACCACCCGGACG 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1161752852 19:6110311-6110333 CGCCCCCCGGCCCCCGAACGGGG 0: 1
1: 0
2: 2
3: 26
4: 258
1161752835_1161752841 -9 Left 1161752835 19:6110259-6110281 CCCGCGGGCGCACCACCCGGACG 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1161752841 19:6110273-6110295 ACCCGGACGTTTGGGGTGAGCGG 0: 1
1: 0
2: 1
3: 5
4: 64
1161752835_1161752844 -6 Left 1161752835 19:6110259-6110281 CCCGCGGGCGCACCACCCGGACG 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1161752844 19:6110276-6110298 CGGACGTTTGGGGTGAGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 88
1161752835_1161752849 27 Left 1161752835 19:6110259-6110281 CCCGCGGGCGCACCACCCGGACG 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1161752849 19:6110309-6110331 CCCGCCCCCCGGCCCCCGAACGG 0: 1
1: 0
2: 3
3: 51
4: 405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161752835 Original CRISPR CGTCCGGGTGGTGCGCCCGC GGG (reversed) Intronic
912775147 1:112502153-112502175 CGCGCAGGTGCTGCGCCCGCGGG + Intronic
1076650346 10:131982590-131982612 TGTCCGGGGCGTCCGCCCGCAGG + Intergenic
1076891711 10:133288012-133288034 CGTCCCGGTGAGGCGACCGCAGG - Intronic
1084195093 11:67520038-67520060 CTTCCGGGAGGTGCGGCCACTGG - Exonic
1088604250 11:111512909-111512931 CGTCCGGGAGCTGCAGCCGCGGG + Intergenic
1090205183 11:124879926-124879948 CATCTGGGTGGAGCACCCGCTGG - Exonic
1096121175 12:49090335-49090357 AGGCCGGGTGGTGCCCACGCCGG - Exonic
1098595826 12:72272581-72272603 GGCCCGGGTGGCCCGCCCGCGGG + Intronic
1103800195 12:123533128-123533150 CGTCCGGGCAGTGGGACCGCGGG - Intronic
1105005735 12:132719458-132719480 CCTCCGGGTGGTGTGGCCTCAGG + Intronic
1112415507 13:99200733-99200755 AGTCAGGGGCGTGCGCCCGCTGG - Intergenic
1113656064 13:112068348-112068370 CGTGCGGGTGGTGCGGGTGCGGG - Exonic
1136893581 16:33983977-33983999 CGTGAGGGTGGTGGGCCTGCGGG + Intergenic
1203079453 16_KI270728v1_random:1139645-1139667 CGTGAGGGTGGTGGGCCTGCGGG - Intergenic
1147612879 17:41811987-41812009 CGGGCGGGCGGCGCGCCCGCTGG + Exonic
1149508465 17:57216214-57216236 GGTCCGGGTAGTGCTCCTGCAGG - Intergenic
1159045755 18:63367281-63367303 CGCCTGGGTGGCGCGCGCGCCGG - Exonic
1161233979 19:3189000-3189022 CCTCCGGGTAGTGGGCCCGGGGG - Intronic
1161752835 19:6110259-6110281 CGTCCGGGTGGTGCGCCCGCGGG - Intronic
1166097385 19:40549383-40549405 CGTCCAGGTCGTGCGCCACCTGG - Exonic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
1166679523 19:44758317-44758339 CCTCCCGCTGGTGCGCACGCTGG + Exonic
1166852779 19:45768454-45768476 CGACCCGGTGTTGCGCGCGCGGG - Exonic
1168401507 19:56088256-56088278 CGTCCCCGTGCTGGGCCCGCTGG + Exonic
926730195 2:16030687-16030709 CCTCTGGGTGGTGGGTCCGCAGG - Intergenic
934767657 2:96889041-96889063 GATCTGGGTGGTGCCCCCGCAGG + Intronic
940962173 2:159798015-159798037 CGGCCGGGTGTTGCGTCTGCGGG + Intronic
1184192124 22:42901855-42901877 CGCCCTGGTGGTGCCCCTGCAGG - Intronic
952287217 3:31980964-31980986 CGTCCGGGGGAGGCGGCCGCAGG - Exonic
961012924 3:123448156-123448178 CGCCCGGGTGCTGCCCCCGCTGG + Exonic
968693658 4:2009472-2009494 CGTGCAGGTGCTGGGCCCGCGGG - Exonic
1013422634 6:109979757-109979779 CTGCAGCGTGGTGCGCCCGCTGG + Exonic
1019451806 7:1102714-1102736 CGTGAGGGTGGGCCGCCCGCAGG + Intronic
1019504221 7:1382783-1382805 CGTCCGGGAGGTGAGCCCCTGGG - Intergenic
1023831297 7:44040267-44040289 CGTCCGCGTGGCGCTCCCGCAGG + Intergenic
1023863829 7:44229526-44229548 CAGGTGGGTGGTGCGCCCGCAGG + Intronic
1026817315 7:73522644-73522666 TGTCCGTGTGGTGCGCCGGAGGG + Intergenic
1029741627 7:102494573-102494595 CGTCCGCGTGGCGCTCCCGCAGG + Exonic
1029759618 7:102593742-102593764 CGTCCGCGTGGCGCTCCCGCAGG + Exonic
1029776984 7:102689652-102689674 CGTCCGCGTGGCGCTCCCGCAGG + Intergenic
1038596455 8:28890550-28890572 CTTCCGCGTGGGGCGCCCGTCGG - Exonic
1047203087 8:122782429-122782451 CGTCCCGGTGGAGTCCCCGCGGG - Intronic
1049761327 8:144333095-144333117 CGTCCGGGTGGAGGGGCCGGAGG - Exonic
1051894703 9:21975102-21975124 CTTCCGGCTGGTGCCCCCGGGGG - Intronic
1061515467 9:131087522-131087544 CGTCTGGCTGGTGAGCCTGCTGG - Exonic
1062306230 9:135908194-135908216 CTTCCGGGGGATGCGCCGGCGGG - Intergenic
1188005364 X:25012932-25012954 CGTCCGGGTAGTGCGTCTTCTGG + Exonic
1189386260 X:40539355-40539377 CGTGTGGGTGGGGCGCCCCCAGG - Intergenic
1193130074 X:77910595-77910617 CTTCCGGGTGATGCCCCTGCCGG - Intergenic