ID: 1161752844

View in Genome Browser
Species Human (GRCh38)
Location 19:6110276-6110298
Sequence CGGACGTTTGGGGTGAGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 88}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161752835_1161752844 -6 Left 1161752835 19:6110259-6110281 CCCGCGGGCGCACCACCCGGACG 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1161752844 19:6110276-6110298 CGGACGTTTGGGGTGAGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 88
1161752825_1161752844 29 Left 1161752825 19:6110224-6110246 CCGCCGCGCGCGCGGACGGGGTG 0: 1
1: 0
2: 1
3: 13
4: 963
Right 1161752844 19:6110276-6110298 CGGACGTTTGGGGTGAGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 88
1161752836_1161752844 -7 Left 1161752836 19:6110260-6110282 CCGCGGGCGCACCACCCGGACGT 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1161752844 19:6110276-6110298 CGGACGTTTGGGGTGAGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 88
1161752827_1161752844 26 Left 1161752827 19:6110227-6110249 CCGCGCGCGCGGACGGGGTGGCG 0: 1
1: 0
2: 0
3: 12
4: 1004
Right 1161752844 19:6110276-6110298 CGGACGTTTGGGGTGAGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161752844 Original CRISPR CGGACGTTTGGGGTGAGCGG CGG Intronic
902619153 1:17640352-17640374 GGGAGGTTTGGGGTGAGTGAGGG + Intronic
904450062 1:30605323-30605345 CTGAGGCTTGGGGTGAGCGGAGG + Intergenic
906507397 1:46390399-46390421 TGGACGTTTGGGTTGAAGGGGGG + Intergenic
908132030 1:61083272-61083294 CGAGCGTGCGGGGTGAGCGGTGG - Intronic
908355928 1:63324464-63324486 CGGCCATTTGGCTTGAGCGGCGG - Exonic
915609359 1:156978746-156978768 GGGAAGTTTGGGGAGAGCAGAGG - Intronic
920600790 1:207321854-207321876 CGGCCGTGTGGGGTGAGTAGGGG + Exonic
922090712 1:222392714-222392736 GGGATGTTTGGGGTGAGCAGGGG - Intergenic
1063916379 10:10886944-10886966 CTGAGGTTTGGGGTGTGGGGTGG + Intergenic
1076900762 10:133336359-133336381 CGGGGGTTGGGGGTGGGCGGTGG - Intronic
1077280423 11:1742466-1742488 CTGACAGTTGGGGTGAGCTGAGG + Intronic
1083571444 11:63764027-63764049 AGGAGGAGTGGGGTGAGCGGTGG - Exonic
1092401096 12:8180124-8180146 AGGACGTTTGGCCTTAGCGGTGG - Intronic
1096203936 12:49706548-49706570 CAGATGTTTGGGGGGAGAGGGGG - Intronic
1102926725 12:116832222-116832244 TGGTCGTCTGGGGTGAGAGGTGG - Intronic
1112265557 13:97920241-97920263 CTGGAGCTTGGGGTGAGCGGTGG - Intergenic
1117466871 14:56002434-56002456 TGGAGGTGTGGGGTGGGCGGGGG + Intergenic
1117587382 14:57224166-57224188 AGGGGGTTTGGGGTGAGGGGTGG + Intronic
1117819242 14:59630874-59630896 CTGACGGTGGGGGTGAGAGGAGG + Intronic
1118336898 14:64861197-64861219 CGGGGGTTGGGGGTGAGGGGAGG + Intronic
1121768461 14:96508217-96508239 CAGACGGTTGGGGTGGGCTGAGG - Intronic
1121837721 14:97106946-97106968 CGGAGGTTGGGGGTGGGTGGGGG + Intergenic
1123149437 14:106166767-106166789 CGGACGTGTGAGGTGACCTGGGG - Intergenic
1124370828 15:29103819-29103841 CGGGCCTTTGGGAAGAGCGGAGG - Intronic
1126445007 15:48732545-48732567 TGGGGGTTTGGGGTGAGGGGAGG + Intronic
1126600646 15:50424220-50424242 AGGACGTTATGGGTGGGCGGTGG - Intergenic
1127771563 15:62235398-62235420 CGGAGGGTTGGGGTGGGAGGAGG + Intergenic
1129192011 15:73942745-73942767 AGGATGTTTGGGGTGTGAGGAGG + Intronic
1131224835 15:90615924-90615946 CGGAGGTTTGCAGTGAGCCGAGG - Intronic
1140038602 16:71390233-71390255 TGGAAGTTTGGGGTGGGTGGTGG - Exonic
1141533336 16:84661691-84661713 CAGACGTGTGGGAGGAGCGGCGG + Exonic
1142118895 16:88376372-88376394 GGGACGTCCGGGGTGAGAGGGGG + Intergenic
1142478072 17:201454-201476 CAGACGTTTGGGGTGGGATGGGG + Intergenic
1142478163 17:201869-201891 CAGACGTTTGGGGTGGGATGGGG + Intergenic
1143109482 17:4545274-4545296 CGGACGATTCTGATGAGCGGCGG - Exonic
1143825891 17:9606826-9606848 AGGAAGTTAGGGGTGAGGGGTGG + Intronic
1146513409 17:33469946-33469968 TGGACTTTGGGGGTCAGCGGGGG + Intronic
1147965128 17:44190618-44190640 CTGACCCTGGGGGTGAGCGGTGG - Exonic
1152593038 17:81222935-81222957 CGGACGGCCGGGGTGAGCAGCGG + Intronic
1160792585 19:929460-929482 CGGGCGCTAGGGGTGGGCGGCGG - Exonic
1161752844 19:6110276-6110298 CGGACGTTTGGGGTGAGCGGCGG + Intronic
1163592657 19:18203157-18203179 TGGAGGTTTGCGGGGAGCGGGGG - Intronic
1164834590 19:31349403-31349425 CGCACGTTCGGGGTTCGCGGCGG - Exonic
925919437 2:8628779-8628801 CGGAGGGTTGGGGCGGGCGGGGG + Intergenic
925943790 2:8842488-8842510 AGGGGGTTTGGGGTGAGAGGTGG - Intergenic
926434740 2:12826426-12826448 TGTATGTTTGGGGTGAGGGGCGG - Intergenic
927473400 2:23393814-23393836 AGGAGGTTTGGGGTGTGGGGAGG + Intronic
930030101 2:47053163-47053185 CGGATGCTGGGGGTGGGCGGAGG + Intronic
933147685 2:78875212-78875234 CGTACATTTGGGGTGGGCAGAGG + Intergenic
935714100 2:105924718-105924740 CGCAGGTTGGTGGTGAGCGGAGG + Intergenic
935878775 2:107540180-107540202 CGGGAGGTTGGGGGGAGCGGGGG - Intergenic
940094399 2:149958083-149958105 AGGGGGTTTGGGGTGGGCGGTGG - Intergenic
944668077 2:201973108-201973130 CTGACGGTGGGGGTGAGGGGTGG - Intergenic
946713190 2:222526862-222526884 GGGAGGTTGGGGGTGAGGGGAGG + Intronic
948776073 2:240289751-240289773 CTGACGGGTGGGGTGAGCTGAGG + Intergenic
1169268850 20:4183661-4183683 GGGGCGTTTGGGGTGAGGAGGGG + Intronic
1172184122 20:33020788-33020810 TGGACTTTTGGGGTGAGGGCTGG - Intronic
1174592440 20:51657098-51657120 CGGACCTTAGTGGTGAGCGTTGG + Exonic
1175825572 20:61934733-61934755 CTGATGTTTGGGGTGTGGGGTGG - Intronic
1180190587 21:46160789-46160811 CGGACCTTAGGGCTGAGCAGTGG - Intergenic
1185167322 22:49269697-49269719 CTGATGTTGGGGGGGAGCGGGGG - Intergenic
949826878 3:8174881-8174903 GGGATGCTTGGGGTGAGAGGAGG - Intergenic
954914627 3:54138382-54138404 GTGAAGCTTGGGGTGAGCGGTGG + Intronic
962319505 3:134378635-134378657 CTGAGGTTGGGGGTGAGGGGAGG + Intergenic
967409533 3:189153526-189153548 TGGATGTTTGGGGTGAGGGGTGG + Intronic
968618571 4:1593239-1593261 CAGACGTTTGGAGTCAGCAGAGG + Intergenic
968820116 4:2843867-2843889 CGGGCGGTGGGGGCGAGCGGAGG + Exonic
969779021 4:9381456-9381478 AGGACGTTTGGCCTTAGCGGTGG + Intergenic
970276131 4:14403173-14403195 GGGAGGGTTGGGGTGAGGGGTGG + Intergenic
972726090 4:41747282-41747304 GGGAGGTGTGGGGTGAGGGGCGG - Intronic
985064071 4:186104764-186104786 CGGGCGTCTGGGGCGGGCGGCGG + Intronic
992217908 5:74543659-74543681 CGGGGGTGTGGGGTGAGGGGAGG + Intergenic
1006408702 6:33859722-33859744 GGGACATATGGGGTGAGCAGGGG - Intergenic
1017721399 6:157245739-157245761 GGGACGGTTGGGGGGGGCGGGGG + Intergenic
1019216430 6:170446939-170446961 CGGACGGTTGTGGTGAGGTGTGG - Intergenic
1025870542 7:65428320-65428342 CGGGGGTTGGGGGTGAGGGGAGG + Intergenic
1026625621 7:71989369-71989391 CGGAGGTTTGCAGTGAGCAGAGG + Intronic
1029657336 7:101935899-101935921 TGGACGTTTGGGGACAGAGGTGG + Intronic
1036276460 8:7355415-7355437 AGGACGTTTGGCCTTAGCGGTGG + Intergenic
1036344879 8:7954930-7954952 AGGACGTTTGGTCTTAGCGGTGG - Intergenic
1036840219 8:12115697-12115719 AGGACGTTTGGTCTTAGCGGTGG - Intergenic
1036862008 8:12361934-12361956 AGGACGTTTGGTCTTAGCGGTGG - Intergenic
1039498409 8:37998484-37998506 AGGAGGTTTGGGGTCGGCGGGGG - Intergenic
1040544780 8:48390363-48390385 CGGAAGTGTGGGGAGAGAGGAGG - Intergenic
1042271661 8:66961943-66961965 CGGACGTCTGGGGAGAGTTGCGG + Exonic
1045737797 8:105317993-105318015 CGGGGGTTGGGGGTGAGGGGAGG + Intronic
1047764615 8:127980368-127980390 AGGGGGTTTGGGCTGAGCGGTGG + Intergenic
1059761244 9:117339734-117339756 CAAATGTTTGGGGTGAGGGGAGG + Intronic
1062101061 9:134728803-134728825 CCGAGGTCTGGGCTGAGCGGGGG + Exonic
1185585715 X:1240874-1240896 TGGAGATTTGGGGTGAGCAGGGG + Intergenic
1185585761 X:1241055-1241077 TGGAGATTTGGGGTGAGCGGGGG + Intergenic
1185585779 X:1241128-1241150 TGGAGATTTGGGGTGAGCGGGGG + Intergenic
1185585827 X:1241311-1241333 TGGAGATTTGGGGTGAGTGGGGG + Intergenic
1189017329 X:37297782-37297804 CGGACGTATGGGGTGGGGGGGGG - Intergenic
1200092178 X:153641196-153641218 TGTACGTTTGGGGAGAGAGGTGG - Intergenic