ID: 1161752845

View in Genome Browser
Species Human (GRCh38)
Location 19:6110277-6110299
Sequence GGACGTTTGGGGTGAGCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 93}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161752825_1161752845 30 Left 1161752825 19:6110224-6110246 CCGCCGCGCGCGCGGACGGGGTG 0: 1
1: 0
2: 1
3: 13
4: 963
Right 1161752845 19:6110277-6110299 GGACGTTTGGGGTGAGCGGCGGG 0: 1
1: 0
2: 1
3: 5
4: 93
1161752836_1161752845 -6 Left 1161752836 19:6110260-6110282 CCGCGGGCGCACCACCCGGACGT 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1161752845 19:6110277-6110299 GGACGTTTGGGGTGAGCGGCGGG 0: 1
1: 0
2: 1
3: 5
4: 93
1161752827_1161752845 27 Left 1161752827 19:6110227-6110249 CCGCGCGCGCGGACGGGGTGGCG 0: 1
1: 0
2: 0
3: 12
4: 1004
Right 1161752845 19:6110277-6110299 GGACGTTTGGGGTGAGCGGCGGG 0: 1
1: 0
2: 1
3: 5
4: 93
1161752835_1161752845 -5 Left 1161752835 19:6110259-6110281 CCCGCGGGCGCACCACCCGGACG 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1161752845 19:6110277-6110299 GGACGTTTGGGGTGAGCGGCGGG 0: 1
1: 0
2: 1
3: 5
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161752845 Original CRISPR GGACGTTTGGGGTGAGCGGC GGG Intronic
901212854 1:7536322-7536344 GCACTTTCAGGGTGAGCGGCAGG + Intronic
901766283 1:11502078-11502100 GGACATCCGGGGTGAGCCGCCGG + Exonic
904450063 1:30605324-30605346 TGAGGCTTGGGGTGAGCGGAGGG + Intergenic
904679890 1:32222042-32222064 GGCCGTTTGGGGTGGGGGTCAGG - Intronic
915143226 1:153779494-153779516 GGATATATGGGGTGAGGGGCCGG - Intronic
915609358 1:156978745-156978767 GGAAGTTTGGGGAGAGCAGAGGG - Intronic
922090711 1:222392713-222392735 GGATGTTTGGGGTGAGCAGGGGG - Intergenic
923404091 1:233643344-233643366 GCATGTTCGGGGTGAGCAGCTGG + Intronic
1064192619 10:13220843-13220865 GGAGGTTTGTGGAGAGCTGCGGG + Intergenic
1070789588 10:79181330-79181352 GGAGGCTGGAGGTGAGCGGCTGG + Intronic
1070957165 10:80471765-80471787 GCAGGTGTGGGGTGAGTGGCAGG + Intronic
1074292520 10:112149261-112149283 GGAAGTTTAGGGAGAGAGGCTGG + Intergenic
1079242337 11:18729580-18729602 GGACCGGTGGGGTGAGGGGCAGG + Intronic
1081014383 11:37857885-37857907 GGAAGCTTGGGGGGAGGGGCGGG - Intergenic
1081585537 11:44381417-44381439 GCAGGTTTGGGGTGAGCCTCAGG - Intergenic
1083571443 11:63764026-63764048 GGAGGAGTGGGGTGAGCGGTGGG - Exonic
1083869653 11:65479012-65479034 GGACGCTTGGGGCGGGCAGCGGG - Intergenic
1085637515 11:78169979-78170001 GGAAGTTTGGGGTGAATGGGTGG + Intergenic
1087155209 11:94895174-94895196 GGACTTTTAGGGAGAGGGGCAGG + Intergenic
1091658160 12:2360935-2360957 GGTCGTGTGTGGTGAACGGCAGG - Intronic
1101575388 12:105992544-105992566 GGATGTTTGGCATGAGCGCCAGG - Intergenic
1102190453 12:110984055-110984077 TGGCGTTTGGGGTGAGGAGCTGG - Intergenic
1102926724 12:116832221-116832243 GGTCGTCTGGGGTGAGAGGTGGG - Intronic
1103048765 12:117761195-117761217 CGATGTTGGGGGTGCGCGGCGGG + Exonic
1104749198 12:131227799-131227821 GGAGGTGTGGGGGGAGAGGCGGG + Intergenic
1110582547 13:77148363-77148385 TGACTTTTGGTGTGAGTGGCTGG - Intronic
1113894753 13:113756830-113756852 GGACATCAGGGGTGAGCCGCAGG - Intergenic
1116140472 14:40987149-40987171 GGACATTTGCGGTGAACTGCTGG - Intergenic
1117466872 14:56002435-56002457 GGAGGTGTGGGGTGGGCGGGGGG + Intergenic
1117587383 14:57224167-57224189 GGGGGTTTGGGGTGAGGGGTGGG + Intronic
1119396073 14:74327236-74327258 GGAGGCTTGGGGTGAGCCTCTGG - Intronic
1119951858 14:78753305-78753327 TTACATTTGGGGTTAGCGGCTGG + Intronic
1125193046 15:37015589-37015611 GGAAGTGTGGGGTGGGTGGCAGG + Intronic
1126445008 15:48732546-48732568 GGGGGTTTGGGGTGAGGGGAGGG + Intronic
1133285595 16:4689171-4689193 GGTCCTGTGGGCTGAGCGGCTGG + Exonic
1139534357 16:67562468-67562490 GGACGGGTGGGGGGACCGGCCGG - Exonic
1142748162 17:1971033-1971055 GGATGTTTGGGGTAAGAGGTCGG - Intronic
1142929223 17:3268253-3268275 GGACATTTGGGTTGTGGGGCAGG + Intergenic
1143750258 17:9022166-9022188 GGACTTTGGGGGAGAGAGGCGGG + Intronic
1152046030 17:77936514-77936536 GGGAGTTTGGGGTGAGGAGCTGG - Intergenic
1153229822 18:2925002-2925024 GGAGGTCTGGGGTGGGTGGCAGG + Intronic
1155261936 18:24051459-24051481 GGACATCTGGGGTGAGCTGGTGG + Intronic
1155953109 18:31934450-31934472 GGAAGTTTAGGGAGAGAGGCTGG - Intronic
1160792584 19:929459-929481 GGGCGCTAGGGGTGGGCGGCGGG - Exonic
1161702379 19:5802541-5802563 GGCGGTGTGGGGTGAGCGGGAGG + Intergenic
1161752845 19:6110277-6110299 GGACGTTTGGGGTGAGCGGCGGG + Intronic
1163682293 19:18690075-18690097 GGATGTTGGGGGTGAGGGGAAGG + Intronic
925886914 2:8401361-8401383 GGGCAGTTGGGGTGAGGGGCGGG - Intergenic
925943789 2:8842487-8842509 GGGGGTTTGGGGTGAGAGGTGGG - Intergenic
926434739 2:12826425-12826447 GTATGTTTGGGGTGAGGGGCGGG - Intergenic
928177168 2:29042419-29042441 GGATGTTTGGGGCCAGAGGCGGG + Intronic
928332717 2:30369909-30369931 GGATGTTTGGGGTGAGAAGGAGG + Intergenic
932288216 2:70554064-70554086 GGGGGTTTGGGGTAAGGGGCGGG + Intronic
933331022 2:80893358-80893380 GGAAGTTTGGTGTGACAGGCAGG - Intergenic
934553406 2:95275542-95275564 GGAGTTCTGGGGTGAGCAGCAGG + Intronic
934563892 2:95327905-95327927 GGAAGTTTGGGGTGAGTGTTTGG - Intronic
940094398 2:149958082-149958104 GGGGGTTTGGGGTGGGCGGTGGG - Intergenic
1169118740 20:3083185-3083207 GGACGGGCGGGGTGAGCGGGAGG + Intronic
1172184121 20:33020787-33020809 GGACTTTTGGGGTGAGGGCTGGG - Intronic
1173457581 20:43215852-43215874 AGACGCTAGGGGTGAGCGGGAGG + Intergenic
1179595159 21:42438367-42438389 GGAAGTTTGGGGTGCGCCGAAGG + Intronic
1180948384 22:19709113-19709135 GGAGGGGTGGGGTGAGCCGCAGG + Intergenic
1182522475 22:30892220-30892242 GAGCGTTTGGTGTGAGCAGCTGG + Intronic
1183437691 22:37804958-37804980 CGCCGTTTGGGGTGCGTGGCGGG + Intergenic
950151646 3:10692305-10692327 TGACGGTTGGGGGGAGAGGCAGG - Intronic
950929355 3:16773705-16773727 GGAGGTGTGGAGTGAGAGGCAGG + Intergenic
956490062 3:69761507-69761529 GGAGGTTTGGAGGGAGAGGCAGG + Intronic
960698873 3:120421490-120421512 GGGCGTATGGGGTGAGATGCTGG + Intronic
963710714 3:148744600-148744622 AGACCTTTGGGGTGAGTGGCTGG - Intergenic
966952687 3:184837062-184837084 GTAGGTTTGGGGTGAGCCCCAGG - Intronic
968873041 4:3251057-3251079 GGATGTTGGGTTTGAGCGGCTGG + Intronic
969630360 4:8332453-8332475 CTACGTTTGGGGTGTGCTGCAGG - Intergenic
969723579 4:8906555-8906577 AGGAGTTTGGGGTGAGGGGCCGG + Intergenic
975779152 4:77820286-77820308 GGAGGGTTGGGGTGAGGGGAAGG + Intergenic
984714315 4:182912720-182912742 GGAAGTCTGGGGTGTGGGGCAGG + Intronic
985723912 5:1505769-1505791 GGACGTGTGAGGTGAGGGTCAGG - Intronic
993333642 5:86630571-86630593 GGAGGAATGGGGTCAGCGGCTGG + Intergenic
994353240 5:98769666-98769688 GGACGTGGGGGGCGAGCGGCAGG + Intronic
1001399471 5:171437929-171437951 TGACTTCTGGGGTGAGGGGCCGG - Intronic
1005082104 6:21966442-21966464 GGATGTTTGAGGGGAGCTGCAGG - Intergenic
1007116609 6:39347650-39347672 GGACACTTGGGCTGAGAGGCAGG + Intronic
1011544080 6:88465510-88465532 GGACATGTGGGGTGGGAGGCAGG + Intergenic
1012056638 6:94420612-94420634 GCCTGTTTGGGGTGAGGGGCTGG + Intergenic
1013370686 6:109468420-109468442 GGAAGTTTGGGGTGAGGAGTAGG - Intronic
1019601694 7:1886878-1886900 GGACAGTTGGGGTGTGCAGCCGG + Intronic
1030642721 7:112024464-112024486 GGACTTTTGGCCTGAGCAGCCGG - Intronic
1035683420 8:1506375-1506397 GGACCTTTTGGGTGAGTGTCCGG + Intronic
1036490215 8:9218209-9218231 GGAGGTTTGGGTGGAGAGGCGGG + Intergenic
1040952144 8:52948043-52948065 GGAAGTTGGAGGTGAGCTGCAGG - Intergenic
1049525774 8:143126173-143126195 GGACATTTGGGGAGAGCGGCAGG + Intergenic
1050802905 9:9637980-9638002 GGGCCTTTGGGGTGAGGGCCAGG - Intronic
1060000539 9:119954280-119954302 GGAAGTTCAGGGTGAGTGGCAGG - Intergenic
1060666057 9:125432826-125432848 GTATGTTTGGGGTGAGGGCCTGG + Intergenic
1061415058 9:130443068-130443090 GGACGGTGGGGGTGGGGGGCGGG + Intergenic
1062341119 9:136094466-136094488 GGCCGTGCGGGGTGCGCGGCGGG + Intronic
1185524835 X:769825-769847 GAATGTTTGGGGTGGGCAGCGGG + Intergenic
1188003549 X:25002733-25002755 GGACCTTTGGGGAGAGGGGCAGG - Intergenic
1191618679 X:63192942-63192964 GGAGGTGTGGAGTGAGAGGCAGG - Intergenic
1192221861 X:69202877-69202899 GGATGGTTGGGGTGAGGGACAGG + Intergenic
1200092177 X:153641195-153641217 GTACGTTTGGGGAGAGAGGTGGG - Intergenic