ID: 1161752846

View in Genome Browser
Species Human (GRCh38)
Location 19:6110278-6110300
Sequence GACGTTTGGGGTGAGCGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 72}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161752836_1161752846 -5 Left 1161752836 19:6110260-6110282 CCGCGGGCGCACCACCCGGACGT 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1161752846 19:6110278-6110300 GACGTTTGGGGTGAGCGGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 72
1161752835_1161752846 -4 Left 1161752835 19:6110259-6110281 CCCGCGGGCGCACCACCCGGACG 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1161752846 19:6110278-6110300 GACGTTTGGGGTGAGCGGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 72
1161752827_1161752846 28 Left 1161752827 19:6110227-6110249 CCGCGCGCGCGGACGGGGTGGCG 0: 1
1: 0
2: 0
3: 12
4: 1004
Right 1161752846 19:6110278-6110300 GACGTTTGGGGTGAGCGGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161752846 Original CRISPR GACGTTTGGGGTGAGCGGCG GGG Intronic
900322858 1:2093682-2093704 CACGTTTGGGGGCAGAGGCGGGG - Intronic
902894166 1:19467488-19467510 CACGTTTGGGGTGAGAAGAGCGG - Intronic
904009628 1:27382423-27382445 GAGGTTTGGGGAGAGGGGCCAGG + Intronic
906156316 1:43616087-43616109 GAGGTGTGGGGTGTGCTGCGGGG + Intronic
906200180 1:43954988-43955010 GACCTGTGGGGTGAGTAGCGGGG - Intronic
916240226 1:162632105-162632127 GAGGTGTGGGGTAGGCGGCGGGG + Intronic
919878793 1:201889020-201889042 AGCGATTGCGGTGAGCGGCGCGG - Exonic
920878499 1:209859022-209859044 GAGGTGTGGAGGGAGCGGCGCGG - Intergenic
1074191218 10:111139362-111139384 GACCTTTGGGGTGAGGGGTAAGG + Intergenic
1076021247 10:127075771-127075793 CACGTGTCGGGTGAGCGGCATGG - Intronic
1076494620 10:130888973-130888995 GAGGTTTGGGGGAAGGGGCGGGG + Intergenic
1077635691 11:3840445-3840467 GACACTTGGGGTGAGAGGGGCGG - Intronic
1083571442 11:63764025-63764047 GAGGAGTGGGGTGAGCGGTGGGG - Exonic
1089252480 11:117174963-117174985 GAAGTTTGGGGTGAGAGGACAGG - Intronic
1089432772 11:118436905-118436927 CGTGTTTGGGGAGAGCGGCGGGG + Exonic
1090029565 11:123195361-123195383 GGCGTTTGGGGTTTGCGGTGGGG + Intergenic
1092247815 12:6873226-6873248 GAGGTTCGGGGGCAGCGGCGAGG - Exonic
1092583846 12:9876412-9876434 GAGGTGTGGAGGGAGCGGCGCGG - Intergenic
1097227706 12:57488290-57488312 GTCGATTGGGGTGTGTGGCGAGG - Intronic
1102190452 12:110984054-110984076 GGCGTTTGGGGTGAGGAGCTGGG - Intergenic
1102926723 12:116832220-116832242 GTCGTCTGGGGTGAGAGGTGGGG - Intronic
1103048766 12:117761196-117761218 GATGTTGGGGGTGCGCGGCGGGG + Exonic
1109037763 13:57286978-57287000 GAGGTTTGGAGAGAGAGGCGCGG - Intergenic
1109699660 13:66009372-66009394 GAGGTTTGGAGGGAGAGGCGCGG + Intergenic
1117587384 14:57224168-57224190 GGGGTTTGGGGTGAGGGGTGGGG + Intronic
1119951859 14:78753306-78753328 TACATTTGGGGTTAGCGGCTGGG + Intronic
1124635432 15:31361814-31361836 GACGTCTGGGGTGGGGGGTGGGG - Intronic
1125896666 15:43308235-43308257 GAAGTTTGGGCTGGGCGCCGTGG - Intergenic
1126396867 15:48227573-48227595 AGCGTTTGGGGTGAGCCCCGAGG - Intronic
1133791778 16:9014565-9014587 GATGTTTGGAGTGAGCTGGGTGG - Intergenic
1136517178 16:30775200-30775222 TACATTTGGGGTGCGCGGCCTGG - Exonic
1137434057 16:48441247-48441269 GCCGGTTGGGGTGAGTGGGGAGG + Intronic
1137715323 16:50594955-50594977 GACGTTTGGGGAATGCTGCGTGG - Intronic
1141686055 16:85570618-85570640 GACCGGTGGGGTGAGCCGCGTGG + Intergenic
1141749080 16:85946365-85946387 GAGCTTTGGGGTGAGGGGAGAGG - Intergenic
1148747608 17:49927368-49927390 GACTGCTGGGGTGAGGGGCGAGG - Intergenic
1153886999 18:9475829-9475851 GAAGTTGGGGGTGGGGGGCGTGG + Intronic
1160792583 19:929458-929480 GGCGCTAGGGGTGGGCGGCGGGG - Exonic
1161752846 19:6110278-6110300 GACGTTTGGGGTGAGCGGCGGGG + Intronic
1163289063 19:16366806-16366828 GAAGTTTGGGCTGAGGGCCGTGG - Intronic
1163788363 19:19289872-19289894 GACGTATGGGGGAAGGGGCGTGG - Intronic
1165345886 19:35248693-35248715 GGGCTTAGGGGTGAGCGGCGGGG - Exonic
925663512 2:6227610-6227632 GAAGTTTGGGGTGAGGTGGGTGG - Intergenic
925943788 2:8842486-8842508 GGGGTTTGGGGTGAGAGGTGGGG - Intergenic
926434738 2:12826424-12826446 TATGTTTGGGGTGAGGGGCGGGG - Intergenic
931810039 2:65845751-65845773 GCCATTTGGGGTGAGGGGAGTGG - Intergenic
932288217 2:70554065-70554087 GGGGTTTGGGGTAAGGGGCGGGG + Intronic
933139766 2:78778981-78779003 GAGGTGTGGAGGGAGCGGCGCGG + Intergenic
940094397 2:149958081-149958103 GGGGTTTGGGGTGGGCGGTGGGG - Intergenic
941108985 2:161396625-161396647 GAGGTTTGGGTGGAGCGGGGTGG + Intronic
944482763 2:200174773-200174795 GACGTGTGGAGGGAGAGGCGCGG + Intergenic
944668075 2:201973106-201973128 GACGGTGGGGGTGAGGGGTGGGG - Intergenic
1175825570 20:61934731-61934753 GATGTTTGGGGTGTGGGGTGGGG - Intronic
1176066950 20:63202910-63202932 GGCGTTTGGGCAGAGCGGAGGGG - Exonic
949805455 3:7950919-7950941 GAGGTTAGGGGTGAGCGGGCAGG + Intergenic
950151645 3:10692304-10692326 GACGGTTGGGGGGAGAGGCAGGG - Intronic
951080531 3:18445464-18445486 TGCGCTTGGGGTGCGCGGCGCGG + Intronic
954072663 3:48154368-48154390 GAGGTTTGTGGTGGGCGGGGGGG - Intergenic
956240823 3:67128311-67128333 GATGTTTGGGTTGAGCAGCCTGG + Intergenic
962319507 3:134378637-134378659 GAGGTTGGGGGTGAGGGGAGGGG + Intergenic
968511762 4:998796-998818 GAGGTTTGAGGTGAGCTGGGGGG - Intronic
969723580 4:8906556-8906578 GGAGTTTGGGGTGAGGGGCCGGG + Intergenic
972793722 4:42397223-42397245 GAGAGTTGGGGTGTGCGGCGGGG + Intergenic
982863345 4:160481759-160481781 GAAGTGTGGAGGGAGCGGCGCGG + Intergenic
985690563 5:1309403-1309425 GACGTTTGGGCTGGGCGTGGTGG + Intergenic
988489173 5:31692335-31692357 GAGGTTTGGAGGGAGAGGCGCGG - Intronic
1008674144 6:53801613-53801635 GAGGTATGGGGTGAGGGGTGGGG - Intronic
1017696619 6:157021894-157021916 GAGGTTAGGGGCGCGCGGCGAGG - Intronic
1018029964 6:159834068-159834090 GAAGTTGGGGGAGAGCGGTGGGG + Intergenic
1018734801 6:166679749-166679771 GAGGTGTGGAGGGAGCGGCGCGG + Intronic
1032510553 7:132468884-132468906 GAAGTCTGGGGTGAGCGTCTAGG + Intronic
1034423474 7:151001143-151001165 GTGGTTTGGGGTGACCGGAGTGG + Intronic
1036490216 8:9218210-9218232 GAGGTTTGGGTGGAGAGGCGGGG + Intergenic
1061415059 9:130443069-130443091 GACGGTGGGGGTGGGGGGCGGGG + Intergenic
1190302953 X:49067158-49067180 CAGGTCTGGGGTGAGAGGCGAGG - Exonic