ID: 1161752847

View in Genome Browser
Species Human (GRCh38)
Location 19:6110298-6110320
Sequence GGGACGTGCTGCCCGCCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 169}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161752835_1161752847 16 Left 1161752835 19:6110259-6110281 CCCGCGGGCGCACCACCCGGACG 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1161752847 19:6110298-6110320 GGGACGTGCTGCCCGCCCCCCGG 0: 1
1: 0
2: 1
3: 13
4: 169
1161752836_1161752847 15 Left 1161752836 19:6110260-6110282 CCGCGGGCGCACCACCCGGACGT 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1161752847 19:6110298-6110320 GGGACGTGCTGCCCGCCCCCCGG 0: 1
1: 0
2: 1
3: 13
4: 169
1161752840_1161752847 4 Left 1161752840 19:6110271-6110293 CCACCCGGACGTTTGGGGTGAGC 0: 1
1: 0
2: 1
3: 2
4: 32
Right 1161752847 19:6110298-6110320 GGGACGTGCTGCCCGCCCCCCGG 0: 1
1: 0
2: 1
3: 13
4: 169
1161752843_1161752847 0 Left 1161752843 19:6110275-6110297 CCGGACGTTTGGGGTGAGCGGCG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1161752847 19:6110298-6110320 GGGACGTGCTGCCCGCCCCCCGG 0: 1
1: 0
2: 1
3: 13
4: 169
1161752842_1161752847 1 Left 1161752842 19:6110274-6110296 CCCGGACGTTTGGGGTGAGCGGC 0: 1
1: 0
2: 1
3: 5
4: 50
Right 1161752847 19:6110298-6110320 GGGACGTGCTGCCCGCCCCCCGG 0: 1
1: 0
2: 1
3: 13
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161752847 Original CRISPR GGGACGTGCTGCCCGCCCCC CGG Intronic
900102132 1:966428-966450 GGGACGTCCCGCCCGGCACCAGG - Intergenic
900167754 1:1250642-1250664 GTGACTTGCTGCCCTCACCCTGG + Intergenic
900201255 1:1407617-1407639 GGGAGGGGCAGGCCGCCCCCTGG + Intergenic
901691179 1:10974162-10974184 GGGCCGGGCTGCCAGTCCCCTGG + Intronic
904030135 1:27528375-27528397 AGGACGTTCTGCCCGCGCCTGGG + Intergenic
905211526 1:36377756-36377778 GGAACTTCCTGCCTGCCCCCTGG + Intronic
907314990 1:53562612-53562634 GGGATGGGATGCCTGCCCCCGGG - Intronic
912383220 1:109258698-109258720 AGGAAGGGCGGCCCGCCCCCGGG - Exonic
914194553 1:145438801-145438823 GGGACGTGCTGCTCTCCACTTGG - Intergenic
914313770 1:146489471-146489493 GGGACGTGCTGCTCTCCACTTGG - Intergenic
914475884 1:148021683-148021705 GGGACGTGCTGCTCTCCACTGGG - Intergenic
914500579 1:148243910-148243932 GGGACGTGCTGCTCTCCACTTGG + Intergenic
915466088 1:156098899-156098921 GGAACCTGCTGCCCACCCCCAGG - Intronic
922365893 1:224863411-224863433 GAGACGTGGTGCCTGGCCCCTGG + Intergenic
922565393 1:226598167-226598189 AGGAAGTGCTGCCAGCCCTCAGG + Intronic
1065188721 10:23192391-23192413 CCGCCGGGCTGCCCGCCCCCGGG - Exonic
1069861391 10:71473856-71473878 GGGACCTGTTGCCCACTCCCAGG + Intronic
1070775882 10:79109562-79109584 GGGATGTGGTGCCCACTCCCAGG + Intronic
1074522607 10:114239406-114239428 GGGTCGTGCCGCCCTCTCCCAGG + Exonic
1075519460 10:123135298-123135320 GGGACCCGCTTCCCGCCGCCAGG - Intergenic
1075844163 10:125531739-125531761 GGGAGGTGCTGACCGAGCCCCGG + Intergenic
1076547134 10:131252982-131253004 GGTACGTGCTGCCATCCCCGGGG - Intronic
1076683713 10:132187433-132187455 GGGACAGGCCGCCCGGCCCCGGG - Intronic
1076843124 10:133056325-133056347 GGGACCTACTGCCCGCACACTGG + Intergenic
1077992736 11:7426372-7426394 GGGAGGTGCTACCTGCCCTCAGG - Intronic
1080802121 11:35618734-35618756 GGACCGAGCTGCCCGCCTCCCGG + Exonic
1083048306 11:59755568-59755590 GGGACGCGCTACCTGCCTCCGGG + Exonic
1083173927 11:60937881-60937903 GGGCAGTGCAGCCAGCCCCCGGG + Exonic
1083599573 11:63938680-63938702 GGGAGGTGCTGCCAACCACCCGG + Intergenic
1083682680 11:64358693-64358715 GGGCCCTGCTGGCCACCCCCAGG + Intergenic
1083728800 11:64642481-64642503 GGGAAGCGCCCCCCGCCCCCGGG + Intronic
1083772831 11:64878022-64878044 CGGACGCGCCCCCCGCCCCCTGG + Intronic
1084396575 11:68914906-68914928 GGGACACCCTGCCCGCCTCCTGG + Exonic
1084517011 11:69642745-69642767 GGCGCGGGCTGCCGGCCCCCGGG - Intronic
1084557747 11:69884952-69884974 GGGACCAGCTGCCCCCTCCCCGG + Intergenic
1084565599 11:69926733-69926755 GCGTCCTCCTGCCCGCCCCCAGG - Intergenic
1085322266 11:75582551-75582573 GAGAGGGGCTGCCAGCCCCCCGG + Intergenic
1085727641 11:78968033-78968055 ATGACGTGGTGCCCTCCCCCTGG + Intronic
1087188688 11:95230712-95230734 GGGACGAGCCGCCCGAGCCCCGG + Intronic
1089053266 11:115564470-115564492 GGGAGGTGCTGCCCTCCCAGGGG + Intergenic
1089519942 11:119056875-119056897 GGGCCGAGCTGCGTGCCCCCCGG + Intronic
1095958421 12:47819434-47819456 GGGACGTGGGGCCCGCACACCGG + Intronic
1096700619 12:53380486-53380508 GGGATGGGCCGCCCGCCCCGGGG + Intronic
1099806627 12:87528283-87528305 GGGAAGTGCTGCCTGCCCTGAGG + Intergenic
1101982543 12:109420284-109420306 GGGACATGTTACCCGCCCCCCGG + Intronic
1103474688 12:121209996-121210018 GGGAGGTGGCGCCCTCCCCCGGG + Intronic
1104043166 12:125143710-125143732 TGGAGTTGCTGCCCGGCCCCGGG - Intergenic
1105202850 13:18194578-18194600 GGGCCGTGCTGACCTCTCCCGGG - Intergenic
1106036715 13:26050984-26051006 GAGACGCGCTGTCCGCGCCCAGG - Exonic
1107276786 13:38687764-38687786 GAGACGGGCTGCGCGCGCCCAGG - Exonic
1112507275 13:99982455-99982477 AGCCCGTGCTGCCCGCCGCCCGG - Exonic
1114417926 14:22556649-22556671 GGGAGGGGCTGCCGGCCCCTCGG + Exonic
1118593754 14:67420296-67420318 GGGAGATGCTGCCCGCCGCTAGG + Intergenic
1119476680 14:74934585-74934607 GGGACTTGCAGCACCCCCCCAGG + Intergenic
1121562018 14:94882868-94882890 GGCACGTGCTGCCCACCCAGTGG + Intergenic
1122269320 14:100561266-100561288 GGGCCTTGCTGCCCACCCCTTGG - Intronic
1122414165 14:101540883-101540905 GGGACCCGCTGCCCTGCCCCGGG + Intergenic
1123505602 15:20939806-20939828 GGGCTGTGCTGCCTGCACCCGGG - Intergenic
1123699994 15:22907284-22907306 GAGTTGTGCTGCCCGCCACCTGG - Intronic
1125524790 15:40368086-40368108 GGGGCGCGCTGCCCTCCCACCGG - Exonic
1128280107 15:66387297-66387319 GAGAGGTGCTGCCCTCCCCCCGG + Exonic
1202971189 15_KI270727v1_random:240647-240669 GGGCTGTGCTGCCTGCACCCAGG - Intergenic
1132458104 16:35461-35483 GGGCCCTGCTCCCAGCCCCCAGG + Intergenic
1132894828 16:2223798-2223820 GGGATGAACTGCCCGCACCCCGG - Intronic
1132928440 16:2445651-2445673 GGGACGTGCTGGCCTTTCCCGGG + Intronic
1136588288 16:31201945-31201967 GGGTCCTGGTGGCCGCCCCCTGG - Exonic
1137926462 16:52546592-52546614 GGGAGGTGGCCCCCGCCCCCCGG + Intronic
1138619069 16:58197706-58197728 GGGCCCTGCTGCCCGCGGCCGGG + Exonic
1140051329 16:71484207-71484229 GGGGCGTGGGCCCCGCCCCCAGG - Intronic
1142395430 16:89828835-89828857 GGGGCGTCCGTCCCGCCCCCTGG + Intronic
1143109351 17:4544723-4544745 GGTGGGTGCGGCCCGCCCCCAGG + Intronic
1144825761 17:18104890-18104912 GGGGTGTGCTGCCTGCCCCCTGG + Intronic
1147790889 17:43013814-43013836 GGGACTTGCTGCCCACCCAGTGG - Exonic
1147987612 17:44315409-44315431 GGGACGTCCTCCCAGCCGCCCGG + Intronic
1148496070 17:48054294-48054316 GGGTGGGGCTGCCCGCCCCTGGG + Intronic
1148646073 17:49220201-49220223 TGGAGGTGCTGCCTGCCCCTTGG - Exonic
1151458188 17:74239185-74239207 GGGACCTGCTGCCCCTCTCCAGG + Intronic
1151540719 17:74763401-74763423 GGGACGTGGTGTCCGCCATCAGG + Exonic
1151586027 17:75009038-75009060 GGGAGCTCCTCCCCGCCCCCCGG + Intergenic
1151703873 17:75756855-75756877 AGGAGGTGCTGCCCACCCCGGGG + Exonic
1152241708 17:79164466-79164488 GTGAAGTGCCGCCCACCCCCAGG - Intronic
1152362927 17:79840678-79840700 GGGCCGCGCTGTCCGCTCCCGGG - Intergenic
1152388605 17:79989931-79989953 GGGTGTTGCTGCCCACCCCCAGG + Intronic
1152588133 17:81198151-81198173 CGGACGTGCTGCCCCGCCCCAGG - Exonic
1152783871 17:82238130-82238152 TGGAGGAGCTGCCCCCCCCCGGG - Intronic
1152879560 17:82807343-82807365 GGGAGCAGCTGCCTGCCCCCAGG - Intronic
1155024633 18:21930260-21930282 GGGGCCTCCTTCCCGCCCCCCGG + Intergenic
1160512785 18:79461771-79461793 GGCAGGTGCTGACCACCCCCCGG - Intronic
1160524959 18:79530318-79530340 GGCGCGTGCTGGCCGCCTCCGGG - Intergenic
1160665457 19:326022-326044 GGGACGTGCTGCTCGACCCCAGG - Intronic
1160689483 19:454831-454853 GGGACGGGCTTCCGGCCCTCAGG - Intronic
1160993983 19:1873423-1873445 GGGAGGGTCTGCCCTCCCCCCGG + Intergenic
1161096828 19:2396807-2396829 GCCTCGTCCTGCCCGCCCCCTGG - Intronic
1161752847 19:6110298-6110320 GGGACGTGCTGCCCGCCCCCCGG + Intronic
1161851655 19:6740583-6740605 GGAACCTGGTGCCTGCCCCCTGG + Intronic
1162323617 19:9985736-9985758 GGGATGAGCTGCCCACCCCAAGG - Intronic
1162780984 19:13006951-13006973 GGGAAGTGCTGGGCGCCTCCAGG + Intronic
1163288981 19:16366160-16366182 TGGACTTGCTGCCCGTCCCAGGG - Intronic
1163365447 19:16873498-16873520 GGGACAGACTGCCAGCCCCCTGG - Intronic
1163690257 19:18734882-18734904 GGGAGCTGCTGCCCACCTCCAGG - Intronic
1164682790 19:30146650-30146672 GTGAGGTGCTGACAGCCCCCAGG + Intergenic
1166678644 19:44754451-44754473 GGGACAGGCTTCCCTCCCCCGGG + Intronic
925178892 2:1803918-1803940 GGGACATCCTGCGAGCCCCCAGG + Intronic
925385869 2:3461328-3461350 AAGACGTGCAGCCCGCACCCCGG + Intronic
927857276 2:26535541-26535563 GGAAAGTGCTGCCCGCCCACTGG - Intronic
929533605 2:42767241-42767263 GGGAGCTGCTGCCCGCCCAGGGG + Exonic
929587821 2:43127199-43127221 GGGACGTGCAGCCAGGCCTCAGG - Intergenic
935872775 2:107469381-107469403 GGTACTGGCTGCCCGCGCCCTGG - Intergenic
935881266 2:107568532-107568554 GGTAAGTGGTGCCAGCCCCCAGG - Intergenic
938099878 2:128491402-128491424 GGGTAGTGCTGCCAGCCCCACGG - Intergenic
938303480 2:130231881-130231903 GGGACCTGCAGGCCTCCCCCTGG - Intergenic
938453199 2:131442375-131442397 GGGACCTGCAGGCCTCCCCCTGG + Intergenic
946909062 2:224442613-224442635 GGGACGTGGTGCCCGCAGCCGGG - Intergenic
947714954 2:232334754-232334776 GGGCTGCCCTGCCCGCCCCCGGG - Intronic
1170701969 20:18711922-18711944 GGCACGTGCCCCCCGACCCCCGG - Intronic
1170903809 20:20492625-20492647 GGGACATGCTGCGGGCTCCCTGG - Intronic
1171340392 20:24422599-24422621 GGGGCGCGCTGCCCTCTCCCTGG + Intergenic
1173930229 20:46811617-46811639 GGTGCCTGCTGTCCGCCCCCCGG - Intergenic
1174054059 20:47785846-47785868 GGGACGCGCGGCCCGCGACCCGG + Exonic
1176074266 20:63241368-63241390 GGCAGGTGCTGCCGGCCGCCTGG + Exonic
1176101172 20:63365199-63365221 GGGGAGTGCTGCCCTTCCCCGGG - Intronic
1176205724 20:63887124-63887146 GGCACGTGCTGGCGGCGCCCCGG - Intronic
1176239878 20:64070939-64070961 GGGCCGTGCTGCCTGCTGCCTGG + Intronic
1176715106 21:10343427-10343449 GGGCCGTGCTGACCTCTCCCGGG + Intergenic
1178416699 21:32411044-32411066 GGGCAGTGCTGCCCACTCCCAGG + Intergenic
1179220232 21:39400185-39400207 CGCACGTGCTGACAGCCCCCCGG + Intronic
1179416463 21:41202514-41202536 GGGACTTGGTGCCTGTCCCCAGG - Intronic
1180603241 22:17036511-17036533 GGGCCGTGCTGACCTCTCCCGGG - Intergenic
1180940333 22:19656631-19656653 GTGCTGTGCTGCCCGCCGCCAGG - Intergenic
1182519964 22:30879622-30879644 GGGAAGTGCTGGGCTCCCCCGGG - Intronic
1183788371 22:40045088-40045110 GGGCCGCGCCGCGCGCCCCCGGG - Intronic
1184381184 22:44145688-44145710 GTGACGTGATGCCAGTCCCCTGG + Intronic
1185187797 22:49413296-49413318 GTGACGTGCTGGGAGCCCCCGGG + Intergenic
952866002 3:37855562-37855584 AGCAGGTGCAGCCCGCCCCCTGG - Intergenic
953464083 3:43104550-43104572 GGAACGTGCTGACCACCCCTGGG + Intronic
953680715 3:45036096-45036118 GGGACCTCCTCCCCGCCCCGCGG - Intergenic
954136983 3:48586409-48586431 GGTACGTGCTGGCGGCGCCCAGG + Exonic
954701216 3:52451858-52451880 CGGCCATGCTGCCCACCCCCAGG - Exonic
955074704 3:55602650-55602672 GGGACATGATGCCAGCTCCCCGG + Intronic
961958356 3:130827684-130827706 GGGGCGTGCTTCCCTTCCCCGGG - Intergenic
962365157 3:134774076-134774098 GGGATGTGCTTTCCACCCCCAGG - Intronic
969361334 4:6666065-6666087 GGTAGGTGCAGCCCACCCCCAGG + Intergenic
969530341 4:7726914-7726936 AGGCCGTGCTGCCAGACCCCAGG - Intronic
980969364 4:139555451-139555473 GGGGAGGGCTGCCCGCCTCCCGG + Intronic
985677802 5:1241291-1241313 GGGACGTGCTGTCTGCCCAGTGG - Intronic
987323098 5:16788256-16788278 GTCACTTGCTGCCCACCCCCTGG - Intronic
988254956 5:28809330-28809352 GGGACGCGGTGCCCGCCCTCCGG - Intergenic
990733230 5:58832099-58832121 GGCTCGTGCTGCCCGGCCACAGG + Intronic
997228834 5:132228419-132228441 GGGACCTGGGGCCCACCCCCTGG + Intronic
997965589 5:138353192-138353214 CGGACGCCCTGGCCGCCCCCCGG - Intronic
1001589573 5:172856153-172856175 ATGACGTGCTGCCCACCCCTAGG - Intronic
1006438038 6:34036563-34036585 GGCAGCTGCTGCCCGCTCCCCGG + Exonic
1018438865 6:163789544-163789566 AGGACGTGCTGAGAGCCCCCAGG - Intergenic
1019197746 6:170291787-170291809 GGGATATGCTGTCCGGCCCCCGG - Intergenic
1019353981 7:569550-569572 GGGAGGGGCTGCATGCCCCCTGG - Intronic
1019594986 7:1854315-1854337 GGGACGAGCTGCCGGGGCCCAGG - Intronic
1019928166 7:4206646-4206668 GAGAGGTGCTTCCCGCCCCATGG - Intronic
1023044782 7:36201558-36201580 GGGATGAACTGCCCGCCTCCTGG + Intronic
1023818926 7:43969695-43969717 GGGACCCACTGCCCGCCCCCAGG + Intergenic
1026873083 7:73865118-73865140 GGGAGCTGCAGCCTGCCCCCTGG + Exonic
1029649270 7:101879724-101879746 GTGCCGTGCGGCCCGCCCGCAGG + Intronic
1029728983 7:102426896-102426918 GGGACTTGCTGACAGTCCCCTGG - Intergenic
1029743976 7:102506658-102506680 GGGACCCACTGCCCGCCCCCAGG + Intronic
1029761965 7:102605821-102605843 GGGACCCACTGCCCGCCCCCAGG + Intronic
1034885522 7:154795517-154795539 GGGCAGTGATGACCGCCCCCTGG + Intronic
1035166313 7:156992429-156992451 GGGACGTGCTGCACTGGCCCAGG + Intergenic
1035266661 7:157693181-157693203 GGGACCTGCTGCCCTCAGCCTGG + Intronic
1035702133 8:1644185-1644207 GGGAAGTCCTGCCAGGCCCCTGG - Intronic
1038720100 8:30027662-30027684 GAGAGGTGCTGCCCTCCCCCCGG + Intergenic
1042962585 8:74320442-74320464 GGTCCGTGCTGACCGCTCCCGGG - Intronic
1045919262 8:107510907-107510929 GGGAGGAGCTGCCCTCCCACTGG - Intergenic
1049199377 8:141332478-141332500 GGGACCTGCTGCCCCCACCTGGG - Intergenic
1049273946 8:141710477-141710499 GGGAGGTGATGCCCCTCCCCGGG - Intergenic
1049611081 8:143555636-143555658 GGGACGGGCTGCCACACCCCAGG + Intronic
1052756942 9:32551159-32551181 GGGTCGCGCTGCCCTCCTCCGGG - Intronic
1057211296 9:93202470-93202492 GGGCCGGGCTGACCGCCCACGGG - Intronic
1057588053 9:96347257-96347279 GGGAGATGCTGCCCACCTCCTGG + Intronic
1057801330 9:98192859-98192881 GGGGCGGGCTGCCGGCCACCAGG + Intergenic
1061149505 9:128820861-128820883 GGGAGGTTCTGCCGCCCCCCTGG - Exonic
1062568892 9:137175504-137175526 GGGAGGTGCAGCCCGTGCCCAGG - Intronic
1203792984 EBV:161457-161479 GGAACCTGCTGCAGGCCCCCGGG - Intergenic
1185456330 X:312684-312706 GGGACCCCCTGCCCTCCCCCGGG + Intronic
1185479114 X:433050-433072 GGGACATCCTGCCCCCTCCCCGG - Intergenic
1202584413 Y:26408698-26408720 GGGCTGTGCTGCCTGCCCCCGGG - Intergenic