ID: 1161752849

View in Genome Browser
Species Human (GRCh38)
Location 19:6110309-6110331
Sequence CCCGCCCCCCGGCCCCCGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 460
Summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 405}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161752836_1161752849 26 Left 1161752836 19:6110260-6110282 CCGCGGGCGCACCACCCGGACGT 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1161752849 19:6110309-6110331 CCCGCCCCCCGGCCCCCGAACGG 0: 1
1: 0
2: 3
3: 51
4: 405
1161752840_1161752849 15 Left 1161752840 19:6110271-6110293 CCACCCGGACGTTTGGGGTGAGC 0: 1
1: 0
2: 1
3: 2
4: 32
Right 1161752849 19:6110309-6110331 CCCGCCCCCCGGCCCCCGAACGG 0: 1
1: 0
2: 3
3: 51
4: 405
1161752843_1161752849 11 Left 1161752843 19:6110275-6110297 CCGGACGTTTGGGGTGAGCGGCG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1161752849 19:6110309-6110331 CCCGCCCCCCGGCCCCCGAACGG 0: 1
1: 0
2: 3
3: 51
4: 405
1161752842_1161752849 12 Left 1161752842 19:6110274-6110296 CCCGGACGTTTGGGGTGAGCGGC 0: 1
1: 0
2: 1
3: 5
4: 50
Right 1161752849 19:6110309-6110331 CCCGCCCCCCGGCCCCCGAACGG 0: 1
1: 0
2: 3
3: 51
4: 405
1161752835_1161752849 27 Left 1161752835 19:6110259-6110281 CCCGCGGGCGCACCACCCGGACG 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1161752849 19:6110309-6110331 CCCGCCCCCCGGCCCCCGAACGG 0: 1
1: 0
2: 3
3: 51
4: 405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161752849 Original CRISPR CCCGCCCCCCGGCCCCCGAA CGG Intronic
901066596 1:6497339-6497361 CCCGCCGCCCGCCCCCCGCGCGG - Intronic
901229146 1:7632298-7632320 CCCGCCCCCCGCGCCCCCAGCGG + Intronic
902375129 1:16026919-16026941 CCCGCCCCGCCGCCCCCGGGGGG - Intronic
903233726 1:21936927-21936949 CCCGCCCCCAGCCCCACGAAGGG + Intronic
904037639 1:27567378-27567400 CCCCCCTCCCGGCCCCCCGACGG - Intronic
904696847 1:32335875-32335897 CCCGGCCCCGGGCCCTAGAAGGG + Intronic
906615776 1:47232021-47232043 CGCCCCCCCCGGCCATCGAAAGG + Intronic
907829511 1:58051196-58051218 CCAGCCCCCCAGCCCCCGATGGG + Intronic
909416217 1:75408701-75408723 CTAGCCCCCCAGCCCCCGACAGG - Intronic
909475363 1:76075224-76075246 CCCTCCCCGTGGCCCCTGAAAGG - Intronic
911468454 1:98284926-98284948 CCAGCCCCCCAGCCCCGGACAGG + Intergenic
912615455 1:111095820-111095842 CCAGCCCCCCAGCCCCTGAAAGG - Intergenic
912872249 1:113319017-113319039 CCAGCCCCCCAGCCCCCAATAGG - Intergenic
914171204 1:145225556-145225578 CCAGCCCCCCACCCCCTGAAAGG + Intergenic
915246330 1:154558567-154558589 CCGGCCCGCCGGCCCCGGAGCGG - Exonic
915519347 1:156432299-156432321 CCCGCCCCCCCGCCCCCGACTGG - Intergenic
915618700 1:157064504-157064526 CCAGCCCCCCAACCCCCGACAGG + Intergenic
919445646 1:197701423-197701445 CCTCACCCCTGGCCCCCGAATGG - Intronic
920429233 1:205905452-205905474 CCCACCCCCCACCCCCCGACAGG - Intergenic
921306692 1:213803954-213803976 CCAGCCCCCCACCCCCCGACAGG - Intergenic
921866615 1:220093991-220094013 CCCGCCCCCCGGCGGCTGCAGGG + Intergenic
922789996 1:228306111-228306133 CCCCCCACCCAGCCCCCAAAGGG - Intronic
923066401 1:230521322-230521344 CCAGCCCCCCACCCCCCGACAGG + Intergenic
924302620 1:242654774-242654796 CCCGCCCCCCACCCCCTGACAGG - Intergenic
1063200892 10:3784868-3784890 CCCGCGCCCCGGCGCCCGCAGGG + Intronic
1063734964 10:8742417-8742439 CCAGGCCCCCAGCCCCCGACAGG - Intergenic
1064334785 10:14429191-14429213 CCCCCACCCCGCCCCCCGAAAGG - Intronic
1065102018 10:22340762-22340784 CCTTCGCCCCGGCCCCCGAGCGG + Intergenic
1065727135 10:28677429-28677451 CCCGCCCCACGGCGTCCGATTGG - Exonic
1066126509 10:32347332-32347354 TCCGCCCCCGGACCCGCGAAGGG - Intronic
1067091228 10:43266700-43266722 CCCGCGCCCCGGCCCCACGACGG + Intronic
1067153655 10:43756867-43756889 CCAGCCCCCCAACCCCCGACAGG + Intergenic
1068289695 10:54987013-54987035 CTCGCCCCCCAGCCCCCAACAGG + Intronic
1069883853 10:71611064-71611086 CCAGCCCCCCAGCCCCCCATGGG + Intronic
1070162447 10:73874311-73874333 CCCGCCCCCCGGCCCTGCACCGG - Intronic
1071642071 10:87319404-87319426 CCTGCCCCCCACCCCCCGACAGG - Intergenic
1072275727 10:93820857-93820879 CCCGCCCCCTGGCCCCAACAAGG + Intergenic
1073291853 10:102417035-102417057 CCTGACCCCCGGCCCCAGCATGG - Exonic
1076702137 10:132279039-132279061 CCCGTCCCCCGCCCCCTGCATGG - Intronic
1077063369 11:627179-627201 CACGGCCCCGGGCCCCCGCAAGG + Intergenic
1077490370 11:2858270-2858292 CCCACCCCCCGGCCACCGCCTGG + Intergenic
1078031229 11:7753402-7753424 CCTGCCCCCCATCCCCCGACAGG - Intergenic
1078458267 11:11492739-11492761 CTTGCCCCCCACCCCCCGAAAGG - Intronic
1078661385 11:13289530-13289552 CCAGCCCCCCAGCCCCTGACAGG + Intronic
1078771766 11:14358632-14358654 CCCGCCCCCTGGCCCCGGCCCGG + Intronic
1079009541 11:16816925-16816947 CCCTCCCCCAGGACCCCCAAGGG - Exonic
1082140071 11:48598761-48598783 CCCTCCCCCCGCCCCACAAAAGG + Intergenic
1082951841 11:58825296-58825318 CTTGCCCCCCAGCCCCCGACAGG + Intergenic
1083554275 11:63613785-63613807 CCCCCACACCGGCCCCCGGAAGG + Intronic
1083887884 11:65581576-65581598 CCAGCCCCTCGGCTCCGGAAAGG + Exonic
1083920190 11:65778282-65778304 CCCGATGCCCGGCCCCCGCACGG - Exonic
1084146771 11:67269184-67269206 CCCGCCCCCCGCCGCCCCAGTGG + Intronic
1084650279 11:70485533-70485555 CCCGCTCCCCCGCCCCCGCCGGG - Intronic
1086424579 11:86671678-86671700 CCCGCCCCCTGGACCCAGAAAGG - Intronic
1087451696 11:98331701-98331723 CCCTCCCCCCGCCCCACGACAGG + Intergenic
1087854285 11:103072753-103072775 CCCTCCCCCCACCCCCCGACAGG - Intronic
1088959025 11:114642421-114642443 CACTCCCCCCAGCCCCCGACAGG + Intergenic
1089354790 11:117842500-117842522 CCTGCCCCCTCGCCCCCTAAGGG - Intronic
1090120166 11:124018349-124018371 CCAGCCCCCCACCCCCCAAAAGG + Intergenic
1091817506 12:3451042-3451064 CCCCCCCCCCCCCCGCCGAAAGG + Intronic
1091867825 12:3857120-3857142 CCAGCCCCCCACCCCCCGACAGG - Intronic
1091985794 12:4909648-4909670 CCCGCCGCCCCGCCCACGAACGG - Intergenic
1092821415 12:12357010-12357032 CCCGCCCCCCGGCCCGAGGGAGG - Intergenic
1093435306 12:19129629-19129651 CCCGCCCCGCCGCCCCGGCAGGG - Intergenic
1094402242 12:30074547-30074569 CCTGCCCCCCACCCCCCGACAGG - Intergenic
1096773015 12:53948335-53948357 TCCACCCCCCTGCCCCCGACCGG - Intergenic
1096778023 12:53975427-53975449 CCCTCCCCCCGCCCCCAAAAGGG - Exonic
1096778025 12:53975428-53975450 CCCCTCCCCCCGCCCCCAAAAGG - Exonic
1096796735 12:54082562-54082584 CCCGGCCCCCGGCCCCGGACCGG - Intergenic
1097452257 12:59751054-59751076 CTAGCCCCCCGCCCCCCGACAGG - Intronic
1097999140 12:65922180-65922202 CCATCCCCCAGGCCCCAGAATGG + Intronic
1099409726 12:82310638-82310660 CCAGCCCCCCGCCCCCCAACAGG + Intronic
1100248953 12:92794724-92794746 CCAGCCCCCCACCCCCCGACAGG - Intronic
1100404713 12:94263204-94263226 CCCCGCCCCCGGCCCCGGGAAGG + Intronic
1101466908 12:104958325-104958347 CCCGCCGCCCCGCCCCCGCGCGG + Intronic
1102375711 12:112419272-112419294 GCCGGCCCCCGGCCCCTGGAGGG - Intronic
1103244046 12:119440055-119440077 CCGGCCCCCCACCCCCCGACAGG - Intronic
1103647516 12:122406060-122406082 CCCGCCCCCCATCCCCCAGATGG - Intronic
1103749767 12:123150835-123150857 CCCGCCCCGCGGCCCCGGCCCGG + Intergenic
1103856321 12:123973097-123973119 CCCGCCCCCCAGCCCCGGCCCGG - Intronic
1104517108 12:129437887-129437909 CCAGCCCCCCTCCCCCCGACAGG + Intronic
1105520227 13:21124745-21124767 CCCCCCCCCCGCCCCCCGACAGG + Intergenic
1105644938 13:22307091-22307113 CCAGCCCCCCAGCCCCTGACAGG + Intergenic
1105659525 13:22478176-22478198 CCCTCCCCCCACCCCCCGACAGG - Intergenic
1106517043 13:30465008-30465030 CGCGCCCCGCCGCCCCCGCACGG + Intronic
1107968294 13:45616529-45616551 CTTGCCCCCCCGCCCCCGATAGG + Intergenic
1108199059 13:48024780-48024802 CCAGCACCCCAGCCCCCGACAGG - Intergenic
1108408516 13:50126176-50126198 TCCGCCCGCCTGCCCGCGAACGG - Intronic
1109407657 13:61922262-61922284 CCTGCCACCCTGCCCCCGCAAGG + Intergenic
1110390545 13:74968483-74968505 CTTGCCCCCCAGCCCCCGACAGG + Intergenic
1112937578 13:104820387-104820409 CCAGCCCCCCACCCCCCGACAGG - Intergenic
1113304336 13:109060477-109060499 CTTGCCCCCCAGCCCCCGACAGG - Intronic
1115160141 14:30384488-30384510 CCCGCCCCCCACCCCACGACAGG - Intergenic
1116149989 14:41128713-41128735 CCAGCCCCCCAGCCCCCGACAGG + Intergenic
1117016125 14:51519167-51519189 CCCGCCCCCTGCCACCCCAACGG + Intronic
1118529666 14:66688907-66688929 CCAGCCCCCCACCCCCCGACAGG - Intronic
1118858435 14:69642642-69642664 CCCGCCCCCCGCCCCCCTGCTGG + Intronic
1119075205 14:71631020-71631042 CCAGCCCCCCAGCCCCTGACAGG + Intronic
1119774393 14:77239510-77239532 CCCCCACCCCGGGCCCCAAAAGG - Intronic
1120787643 14:88551555-88551577 CCGGTCCCTCGGCTCCCGAAGGG + Intronic
1121547120 14:94770460-94770482 CCCGCGGCCCGGCTGCCGAATGG - Intergenic
1121916163 14:97838531-97838553 CCCACCCCCAGGCCCCCGGGAGG + Intergenic
1122032954 14:98926883-98926905 CCAGCCCCCCAGCCCCCAACAGG + Intergenic
1122098172 14:99386620-99386642 CCCTACCCCCGGCCCCTGAAGGG + Intergenic
1122275197 14:100587419-100587441 CCCGCCCCCCGCCCCCAGCCCGG + Intergenic
1122947816 14:105021175-105021197 CCCCGCCCCCGGCCCGCGAGTGG - Intergenic
1123464644 15:20506200-20506222 CCCGCCCCTCGGGCCGCGAGAGG - Intergenic
1123630718 15:22258147-22258169 CCCGCCCGCCGGCCCCTGACGGG + Intergenic
1123653472 15:22494841-22494863 CCCGCCCCTCGGGCCGCGAGAGG + Intergenic
1123743893 15:23303704-23303726 CCCGCCCCTCGGGCCGCGAGAGG + Intergenic
1124275369 15:28322167-28322189 CCCGCCCCTCGGGCCGCGAGAGG - Intergenic
1124307335 15:28589434-28589456 CCCGCCCCTCGGGCCGCGAGAGG + Intergenic
1124724122 15:32140070-32140092 CCAGCCCCCCACCCCCCGAGAGG + Intronic
1125112024 15:36045621-36045643 TCCGCCCCCCAGCCCCCGATAGG - Intergenic
1125890048 15:43258965-43258987 CCCGCTTCCCTGTCCCCGAATGG - Intronic
1126128631 15:45319154-45319176 CCAGCCCCCCAGCCCCCAACAGG - Intergenic
1127222880 15:56899002-56899024 CCCGCTCCCCTACCCCCGACTGG - Intronic
1128143172 15:65316485-65316507 CCCGCCCCACCGCCCCCGACTGG + Intergenic
1128384589 15:67138348-67138370 CCCCTCCCCCGGCCCCAGGATGG + Intronic
1128582735 15:68820399-68820421 TGCGCCCGCCGGCCCCCGATGGG + Intronic
1128755512 15:70181018-70181040 CCAGCCCCCTGGCCCTCAAATGG - Intergenic
1128841180 15:70853215-70853237 CCCCCCCCCCGCCCCCCGCAAGG + Intronic
1129761298 15:78130787-78130809 CCTGCCCCCCAGCCCCAGGAAGG - Intronic
1129880224 15:79001482-79001504 CCCGCCCCCCGCCACCCCAAGGG - Intronic
1131515091 15:93072098-93072120 GCCTCCCCCCTCCCCCCGAAAGG + Intronic
1131917032 15:97278878-97278900 CCCGCCCCCCACCCCCTGATAGG + Intergenic
1132128444 15:99251471-99251493 CCCGCCCGCCGTCCCCCGCTTGG + Exonic
1132685090 16:1158859-1158881 CCCGCACCCCTGGCCCCGCAGGG + Intronic
1132719742 16:1309791-1309813 CCCGCCCCGCGGCCCCGGCCCGG - Intronic
1132729089 16:1351845-1351867 CGCGCCCCTCGGCCTCCCAATGG + Exonic
1132779276 16:1614107-1614129 CCCCCTCCCCGCCCCCCGAAAGG - Intronic
1133285925 16:4690788-4690810 CCCGCCCCCCGCCCCCACCAAGG + Exonic
1133408927 16:5551788-5551810 TCCGCCCCCCACCCCCCGACAGG + Intergenic
1133768994 16:8856892-8856914 CCCCACCCCCGGCTCCCCAAGGG + Intronic
1135727667 16:24869576-24869598 CCCGACCCCCGACCCCCGCAGGG + Intronic
1136779003 16:32885607-32885629 GCCGCCCCCCGGCCCCCGGCCGG - Intergenic
1136779090 16:32885936-32885958 CCCGCGCCCCCGGCCCCGACCGG + Intergenic
1136891615 16:33975911-33975933 GCCGCCCCCCGGCCCCCGGCCGG + Intergenic
1138389114 16:56657638-56657660 CCCGCCCCCCGGCCCCGCCCCGG - Intronic
1138769700 16:59648949-59648971 CCAGCCCCCCAGCCCCCAACAGG + Intergenic
1139664436 16:68446829-68446851 CCCCACTCTCGGCCCCCGAAGGG + Intronic
1140129556 16:72148363-72148385 CCAGCCCCCCACCCCCCGACAGG - Intronic
1140851127 16:78935599-78935621 CCCTCCCCCCAGCCCACGACAGG - Intronic
1141179378 16:81742142-81742164 CCCCCCCCCCGCCCCCACAATGG - Intronic
1141595920 16:85096885-85096907 CCCCACCCCAGGCCCTCGAAAGG + Intergenic
1141972333 16:87492432-87492454 CCCGCCCGCCGGCCCCTGACGGG - Intergenic
1142369266 16:89669409-89669431 CCAGTCCTCCGGCTCCCGAATGG - Exonic
1203081414 16_KI270728v1_random:1147696-1147718 GCCGCCCCCCGGCCCCCGGCCGG - Intergenic
1142742990 17:1941587-1941609 CCCACCGCCTGGCCCCCGAGGGG - Intronic
1143090565 17:4447061-4447083 ACCACCCCCCGTCCCCCTAATGG - Intronic
1143372981 17:6451876-6451898 CCCCCCCCCCGCCCGCCGATGGG + Exonic
1143617717 17:8063917-8063939 CCACTCCCCCGCCCCCCGAAAGG + Intergenic
1144658203 17:17051528-17051550 CCCGCCACCCCGCCCCAGGATGG - Intronic
1144840742 17:18184154-18184176 CGCGCCCCGGGGCCCCCGGAGGG - Intronic
1145196509 17:20898913-20898935 CCTCCCCCCCGCCCCCCGCAGGG - Intergenic
1145991273 17:29080735-29080757 CGCGCCCCCCGGTCCCCGAGCGG + Intronic
1147153946 17:38533820-38533842 CCTGACCCCCGTCCCCCGCAGGG - Intronic
1147614048 17:41818186-41818208 CCCGCCCCACTGCCCCCGCATGG + Exonic
1148048579 17:44758669-44758691 CCTGCCCCCGGGCCCCAGACAGG + Intergenic
1148645452 17:49217586-49217608 CCCGCCCCCCGCCCCCCACCAGG - Intronic
1148852446 17:50561531-50561553 GCCGGCCCCCGGCCCCCGACAGG - Exonic
1149315914 17:55438527-55438549 CCAGCCCCCCACCCCCCGACAGG - Intergenic
1150624816 17:66835071-66835093 CTCGCGCCCCGGACCCCGAGAGG - Intergenic
1151079331 17:71310594-71310616 CCAGTCCCCCACCCCCCGAAAGG - Intergenic
1152183746 17:78841158-78841180 CGCGCGCCCCCGCCCCAGAACGG + Intronic
1152197251 17:78925084-78925106 CCAGCCCCCCGGCCCGCCATGGG - Exonic
1152209890 17:78997419-78997441 CCCACCGCCCGGCCCCCGGCAGG - Exonic
1152654353 17:81513021-81513043 CCCGCCCGCCGGCCCGCGCAGGG - Intronic
1152663147 17:81552260-81552282 CCCGCCGCCAGGCCCCCGAGAGG + Exonic
1155606597 18:27613309-27613331 CTTGCCCCCCATCCCCCGAAAGG - Intergenic
1155722900 18:29041304-29041326 CCCGCCCCCCACCCCCCAACAGG + Intergenic
1155932405 18:31721179-31721201 CCAGCCCCCCACCCCCCGACAGG - Intergenic
1156743652 18:40363526-40363548 CCCGCCCCCCACCCCACGACAGG + Intergenic
1157318105 18:46610393-46610415 CCAGCCCCCCAGCCCCCGACAGG - Intronic
1160616149 18:80130737-80130759 CCCGCCCCCCCGCCCACGTCAGG + Intronic
1160710589 19:549288-549310 CCCGCCCCCCAGCCCCTGACAGG - Intronic
1160730346 19:639189-639211 CCCGCCAGCCGGCCACCGACAGG + Intergenic
1160826230 19:1081803-1081825 CCCACCCCCGGGCTCCCGCAGGG + Exonic
1160947968 19:1652272-1652294 CGCGCCCCCCGCCCCCCGCCGGG + Intronic
1161101795 19:2425201-2425223 CCCGCGCCGCGACCCCCGGACGG + Exonic
1161256817 19:3314289-3314311 CCCCCCTCCCGCCCCCCGGAAGG - Intergenic
1161627215 19:5334229-5334251 CCCGCCCTCAGCCCCCCGATGGG - Intronic
1161752849 19:6110309-6110331 CCCGCCCCCCGGCCCCCGAACGG + Intronic
1161962188 19:7529037-7529059 TCCTCCCCCAGGCCCCCCAAAGG + Intronic
1162799727 19:13103813-13103835 CCCCCCCCCCCGCCCAGGAATGG + Intergenic
1162924602 19:13923853-13923875 CCCGCCCCACCGCCACCAAAGGG - Intronic
1162940393 19:14005898-14005920 CCCGCGGCCCGGCCCCCGCGAGG - Intronic
1162953506 19:14085624-14085646 CCCGCCCCCCGGCCCTACCATGG - Exonic
1163014614 19:14446637-14446659 CCCACCTCCCTGCCCCAGAAAGG - Intronic
1163023388 19:14495763-14495785 CCCTCCCCCCGTCCCCCGGCTGG - Intronic
1163026810 19:14517686-14517708 CCAGCCCCCAAGCCCACGAACGG + Intronic
1163315629 19:16538778-16538800 GCCACCCCCCCGCCCCAGAAAGG + Intronic
1163380837 19:16967332-16967354 CCGGCCCCCCACCCCCCGACAGG - Intronic
1163427156 19:17245933-17245955 CCCCCCGCCCGCCCCGCGAATGG - Exonic
1163441230 19:17323647-17323669 CCCGCCCCCCAGCCCCTGCCGGG - Exonic
1165861606 19:38912047-38912069 CCCGCTCCCCGGCCCCTGGCAGG + Intronic
1166367385 19:42284431-42284453 CCCGCCCCCCGGCGCGCGCGGGG - Intronic
1167001239 19:46746612-46746634 CCCACCCGCCGGCCCCCGCGCGG - Exonic
1167300459 19:48674619-48674641 CCTGCCCCCGGGCACCCGCAGGG - Intergenic
1167486539 19:49766526-49766548 CCCGCCCCACAGCCGCCCAATGG + Intergenic
1167862033 19:52292963-52292985 CCAGCCCCCCACCCCCCGACAGG + Exonic
1168029284 19:53666780-53666802 CCCGCCCCCCCTCCCCCCCATGG - Intergenic
1168029620 19:53669264-53669286 CCCGCCCCCCCTCCCCCCCATGG - Intergenic
1168056988 19:53869500-53869522 CCCGCACCCCCGCCCCCGCGGGG + Exonic
926851654 2:17204734-17204756 CCTGCCCCCCACCCCCCGACAGG + Intergenic
926880531 2:17539791-17539813 CCCTCCCCCCGGCTCCCCATTGG - Intronic
927652278 2:24919988-24920010 CGCGCCTGCCGGCCCCCGCACGG - Intergenic
928511963 2:32010673-32010695 CCCGCCCCCCACCCCCCGCGGGG + Intronic
928776344 2:34768416-34768438 CCAGCCCCCCACCCCCCGACAGG - Intergenic
928998724 2:37324814-37324836 CCCGCCCTCCGGCCCCAGGACGG - Intergenic
929808399 2:45168980-45169002 CCCAGCCCCCGGCGCCTGAAGGG - Intergenic
930523542 2:52497835-52497857 CCATCCTCCCGACCCCCGAATGG + Intergenic
931648056 2:64443228-64443250 CCTGCCCCCCGCCCCCAGCAAGG - Intergenic
931682990 2:64768232-64768254 CCCTCCTCCCTGCCCGCGAAGGG + Intergenic
931802201 2:65769512-65769534 CCAGCCCCCCAGCCCCTGACAGG + Intergenic
932158132 2:69437016-69437038 CCCGCCCCCAGGCCCTCTACCGG - Intronic
932830961 2:74989424-74989446 CCAGCCCCCCACCCCCCGACAGG - Intergenic
933126860 2:78619835-78619857 CCCTCCCCCCAGCCCACAAAAGG + Intergenic
934566988 2:95346619-95346641 CCCGCGCCCCGGCGCCCGCGGGG + Intronic
935399141 2:102641891-102641913 CCAGCCCCCCACCCCCCGACAGG - Intronic
937212049 2:120280543-120280565 CTTGCCCCCCGCCCCCCAAAAGG - Intronic
939812084 2:146846025-146846047 CCAGCCCCCCAACCCCCGACAGG - Intergenic
940839422 2:158561926-158561948 CCAGCCCCCCACCCCCCGACAGG + Intronic
940854958 2:158722708-158722730 CCCCCACCCCAGCCCCAGAAGGG + Intergenic
940978224 2:159970945-159970967 CCAGCCCCCCACCCCCCGACAGG - Intronic
941541031 2:166784654-166784676 CCCGCCCCCCACCCCCCAGAGGG + Intergenic
941842600 2:170103035-170103057 CCCTCCCCCCAGCCCCTGACAGG + Intergenic
942748632 2:179264361-179264383 TCCGCCCCGCGGCCCGCGCAGGG + Intronic
944019137 2:195079612-195079634 CCAGCCCCCCAGCCCCAGACAGG - Intergenic
944413470 2:199463078-199463100 CCCGGCCCGCGGCCGCCGAAGGG - Intronic
946085731 2:217169316-217169338 CCAGCCCCCCAGCCCCTGACAGG + Intergenic
946189876 2:218002580-218002602 CCCACCCCCCCACCCCCCAATGG - Intronic
947720133 2:232365201-232365223 CCCGACCCCCAGCCCCCTAGAGG + Intergenic
947732752 2:232440188-232440210 CCCGACCCCCAGCCCCCTAGAGG + Intergenic
948801717 2:240436196-240436218 CCCGCCGCCCGGGCCCCGAATGG + Intronic
948921721 2:241069037-241069059 CGCGGCCCCCGGCACACGAAAGG + Intronic
1168757357 20:326384-326406 GCCGCCGCCCCGCCCCCCAAAGG - Exonic
1169862281 20:10165385-10165407 CCAGCCCCCCACCCCCCGACAGG - Intergenic
1170226534 20:13996283-13996305 CTGTCCCCCCAGCCCCCGAATGG + Intronic
1173488463 20:43458537-43458559 CCCGCCCCCAGGGTCCCCAAGGG - Intronic
1174138777 20:48398504-48398526 CCCGCCCCCCAGCCCCCTCCAGG - Intergenic
1174579580 20:51562371-51562393 CCCGCGCCCCGGCCAGGGAAGGG - Intronic
1175237865 20:57525997-57526019 CCCACCCCTCGCCCCCCGCAGGG - Intergenic
1175267222 20:57710046-57710068 CCCCCTCCCCGGCCCCCGCGCGG - Intronic
1175267243 20:57710108-57710130 CCCGCCCCCCGGCTCGGGGAGGG - Intronic
1175552201 20:59824774-59824796 CCCTCCCCCCGCCCCCCCACTGG - Intronic
1175846948 20:62064615-62064637 CCCGCCCCCGGGACCCCCACCGG - Exonic
1175988423 20:62775907-62775929 GCCGCCCCAAGGCCCCCAAAAGG + Intergenic
1176194586 20:63831335-63831357 CCCGCCCCCCGGCGCGCGCCCGG + Intergenic
1176549515 21:8215029-8215051 CCCGCCCCCCGACCCGCGCGCGG - Intergenic
1176568440 21:8398063-8398085 CCCGCCCCCCGACCCGCGCGCGG - Intergenic
1176576352 21:8442293-8442315 CCCGCCCCCCGACCCGCGCGCGG - Intergenic
1176975553 21:15316853-15316875 CCAGGCCCCCAGCCCCCGACAGG + Intergenic
1177672979 21:24257323-24257345 CCAGCCCCCCACCCCCCGACAGG - Intergenic
1178533823 21:33396553-33396575 CCCGCCCCCCACCCCCCGCCTGG + Intergenic
1180068228 21:45423491-45423513 CCCGCCCCCCGCCCCCCGGAGGG + Intronic
1180160220 21:45995850-45995872 CCACACCCCCGGGCCCCGAAAGG - Intronic
1182363494 22:29762342-29762364 CCAACCCCCAGGCCCCGGAACGG + Intronic
1182604134 22:31490008-31490030 CCCACCCCCCGGCCCGCGCAGGG - Intronic
1183830809 22:40417550-40417572 CCCGCCCCCCGCCCCCTACAAGG - Intronic
1184492933 22:44820579-44820601 CCTGCACCCCAGCCCCCGGAGGG - Intronic
1184525807 22:45021662-45021684 CCCCCCGCCCCGCCCCCGACAGG + Intergenic
1184985142 22:48127196-48127218 CCTGCCCCCCACCCCCCAAAAGG + Intergenic
1185323923 22:50216464-50216486 CCTGCCCCTCGGCCCACAAAGGG + Intronic
1185331383 22:50253480-50253502 CCCGCCCCCCCACCCCCGCCAGG - Exonic
1185370565 22:50459095-50459117 CCTGCCCCACGGCACCCGGAGGG + Intronic
1203254402 22_KI270733v1_random:131351-131373 CCCGCCCCCCGACCCGCGCGCGG - Intergenic
1203262458 22_KI270733v1_random:176430-176452 CCCGCCCCCCGACCCGCGCGCGG - Intergenic
949945552 3:9187110-9187132 CCAGCCCCCCACCCCCCGACAGG + Intronic
950452546 3:13073352-13073374 CCCGCGCCCCGCACCCCGGATGG - Intergenic
951705004 3:25535558-25535580 CTAGCCCCCCAGCCCCCGACAGG + Intronic
952724332 3:36567488-36567510 CCAGCCCCCCAGCCCCTGACAGG + Intergenic
954384301 3:50236294-50236316 GCCGCCGCCCGGCCCCCACACGG - Exonic
955265257 3:57436812-57436834 CCCGCCCCCTGGCCCCCCAGTGG - Intronic
956051477 3:65252928-65252950 CTAGCCCCCCACCCCCCGAAAGG + Intergenic
956460365 3:69465538-69465560 CCAGTCCCCCAGCCCCCGACAGG + Intronic
958087349 3:88827382-88827404 CCAGCCCCCCACCCCCCGACAGG + Intergenic
958976242 3:100670709-100670731 CTAGCCCCCCAGCCCCCGACAGG + Intronic
959763465 3:109996611-109996633 CCAGCCCCCCAGCCCCCGACAGG + Intergenic
960714158 3:120559442-120559464 CTCTCACCCCGGCCCCAGAAGGG - Intergenic
962346488 3:134623050-134623072 CCCTCTCCCAGGGCCCCGAATGG + Intronic
962514691 3:136139449-136139471 CCCCCCCCTCGGCCTCCCAAAGG - Intronic
964859643 3:161186909-161186931 CTCGCCCCCCAGCCCCCAACAGG - Intronic
966168936 3:177055537-177055559 CCCCCGCCCCGCCCCCCGATTGG - Intronic
967857801 3:194131440-194131462 CCCCCACCCCCGCCCCGGAAGGG - Intergenic
968156867 3:196388286-196388308 CCAGCCCCCCAGCCCCCGACAGG - Intronic
968450601 4:674380-674402 CGCGCCCCCTGGCGACCGAAGGG + Intronic
969344804 4:6563851-6563873 CCCGCCCGCCCGCCCGCGCAGGG - Intergenic
970030088 4:11664357-11664379 CCCTCCTCCCAGCCCCCGACAGG - Intergenic
970305223 4:14724696-14724718 CTTGCCCCCCAGCCCCCGACAGG - Intergenic
970651116 4:18179088-18179110 CCAGCCCCCCAGCCCCGGACAGG - Intergenic
971429511 4:26550707-26550729 CCCACCCCCCTACCCCCGACAGG + Intergenic
972740335 4:41881662-41881684 CCCGCGCCCCGGCTCCCCCAGGG + Intergenic
972958317 4:44419694-44419716 CCAGCCCCCCATCCCCCGACAGG - Intronic
973619513 4:52712687-52712709 CCCGCCCCCCGGGCCGCCGAGGG - Intergenic
974611314 4:64220925-64220947 CCCTCCCCCCGCCCCACGACAGG - Intergenic
976348286 4:84030459-84030481 CCCGCCCCCCACCCCCCGACAGG - Intergenic
977184331 4:93917493-93917515 CCCGCCCCCTCGCCCCCTCATGG - Intergenic
978505634 4:109453443-109453465 CCCCCCCCCCCCCCCCCGAATGG + Intronic
979012836 4:115393154-115393176 CCAGCCCCCCAGCCCCTGACAGG - Intergenic
980439130 4:132817874-132817896 CCCCCTCCCCGCCCCCCGCATGG + Intergenic
981201660 4:141987246-141987268 CTAGCCCCCCAGCCCCCAAAAGG + Intergenic
982467409 4:155747969-155747991 CCCCCCCCCCCGCCCACAAAAGG + Intergenic
982564498 4:156971409-156971431 CCCCACCCCCCACCCCCGAAGGG + Intergenic
982612631 4:157595906-157595928 CCAGCCCCCCAACCCCCGATAGG - Intergenic
983733664 4:171030626-171030648 CCAGCCCCCCAGCTCCCGACAGG - Intergenic
985662164 5:1162671-1162693 CCCACCCCCAGGGCCTCGAAGGG - Intergenic
986733091 5:10649512-10649534 CCCGTCCTCCGGGCCCCGCACGG - Exonic
987327275 5:16823765-16823787 CCCGCCCCCCGCCCCCAGCCAGG - Intronic
987902944 5:24037372-24037394 CCAGCCCCCCACCCCCCGACAGG + Intronic
988608184 5:32700544-32700566 CCAGCCCCCCACCCCCCGACAGG + Intronic
988688157 5:33545854-33545876 CCAGCCCCCCACCCCCCGACAGG - Intronic
988820264 5:34876831-34876853 CCAGCCCCCCAGCCCCCGACAGG - Intronic
989379420 5:40798418-40798440 CCCGCCCACCGGCACGCGGAGGG + Intergenic
990075583 5:51842928-51842950 CCCCCCCCCCCCCCCCCGCAGGG + Intergenic
991102355 5:62806956-62806978 CCAGCCCCCCACCCCCCGAGAGG + Intergenic
991509146 5:67357573-67357595 ACCGCCCCCCAACCCCCGACAGG - Intergenic
991800620 5:70359206-70359228 CTTGCCCCCCAGCCCCCGACAGG + Intergenic
991827980 5:70650835-70650857 CTTGCCCCCCAGCCCCCGACAGG - Intergenic
993127263 5:83850773-83850795 CCAGCCTCCCAGCCCACGAAAGG - Intergenic
994043358 5:95283768-95283790 CCCGCCCCCCGCTCCCCGGGTGG + Intronic
994241268 5:97424350-97424372 CCAGCCCCCCACCCCCCGACAGG + Intergenic
994388149 5:99157573-99157595 CCCCTCCCCCGACCCCCGATAGG + Intergenic
995108582 5:108402632-108402654 CCAGCCCCCCAGCCCCTGACAGG + Intergenic
995675643 5:114659664-114659686 CCAGCCCCCCAGCCCCCAACAGG - Intergenic
995764675 5:115602360-115602382 CCCACCCCGCCGCCCCCGAGGGG + Exonic
997456501 5:134021335-134021357 CCAGCCCCCCACCCTCCGAAAGG + Intergenic
999288812 5:150410057-150410079 CCCGCCCCCCGCCCACCGTCGGG - Intronic
1002001459 5:176198673-176198695 CCCTCCCCCCAGCCCCCAACAGG - Intergenic
1002037166 5:176480793-176480815 CCAGCCCCCCACCCCCCGAGAGG - Intronic
1002252882 5:177940306-177940328 CCCTCCCCCCAGCCCCCGACAGG + Intergenic
1002296148 5:178232465-178232487 CCCGCCGCCCGCCCCCCGCCCGG + Intronic
1002373961 5:178775204-178775226 CCCACCCCCAGGCCTCCGGAAGG + Intergenic
1003175578 6:3750889-3750911 CCCGCCCGCCGGCCCTCGGGAGG + Intronic
1004044758 6:12012646-12012668 CACGCCCCCCGCCCGCCGAAGGG - Intronic
1004289773 6:14355888-14355910 CCAGCCCCCCAGCCCCTGACAGG + Intergenic
1004647844 6:17580380-17580402 CCCGCCTCCCGCCTCCCAAAGGG + Intergenic
1006026242 6:31148827-31148849 CCCTCCCCCCAGCCCCTGCATGG - Intronic
1006313559 6:33277685-33277707 CCCGCCCCACGAAGCCCGAATGG - Exonic
1006400164 6:33813090-33813112 CCCGCCCCCCGCCCCCCCAGAGG - Intergenic
1007373797 6:41443149-41443171 CTTGGCCCCCGGCCCCCCAAGGG - Intergenic
1007600121 6:43076234-43076256 CCTCCCCTCCGGCCCCCGCACGG - Intergenic
1007818492 6:44542045-44542067 CCCTCACCCCTGCCCCCTAAAGG + Intergenic
1008812448 6:55520091-55520113 CCCGCCCCCCACCCCCTGACAGG - Intronic
1009184074 6:60552868-60552890 CCAGCCCCCCACCCCCCAAAAGG - Intergenic
1009868270 6:69424946-69424968 CCCCCCGCCCAGCCCCCGGAAGG - Intergenic
1011725781 6:90209046-90209068 CCAGCCCCCCACCCCCCGACAGG - Intronic
1011726368 6:90214345-90214367 CCCTCCCCCCGCCCCGCCAAGGG - Intronic
1012170301 6:96008522-96008544 CTAGCCCCCCACCCCCCGAAAGG - Intergenic
1012577330 6:100819158-100819180 CCAGCCCCCCAGCCCCCGACAGG - Intronic
1012591960 6:100992732-100992754 CTAGCCCCCCAACCCCCGAAAGG - Intergenic
1013709990 6:112885935-112885957 CCAGCCCCCCGCCCCCAGACCGG - Intergenic
1014078729 6:117265480-117265502 CCCGCTCCGCAGCCCCCGAGTGG + Intergenic
1015133566 6:129841414-129841436 CCAGCCCCCCACCCCCCGACCGG - Intronic
1017994896 6:159523492-159523514 CCCGCCCCCCCACCCCCTTAAGG + Intergenic
1019520822 7:1459797-1459819 CACGCCGCCCGGCCCCAGTACGG + Intergenic
1020204748 7:6105465-6105487 CCCGCCCGCCGCCCCCCGCGTGG + Intronic
1020274374 7:6615701-6615723 CCCCCGCCCCGGCCCCCGCGCGG + Exonic
1021099777 7:16574641-16574663 CCAGCCCTCCAGCCCCCGACAGG - Intronic
1021510452 7:21427863-21427885 CCAGCGCCCCGGCCCCCGGCAGG + Intergenic
1021802028 7:24316763-24316785 CCAGCCCCCCTGCCCAGGAAAGG + Intergenic
1022275788 7:28854270-28854292 CACGCCCCGCGGCCCCGGCACGG - Intergenic
1022318164 7:29264001-29264023 CCTGCCCCCCAGCTCCCGGATGG - Intronic
1022621100 7:31985569-31985591 CCCAACCCCCAGCCCCCGACAGG + Intronic
1023773617 7:43583059-43583081 CCCGCCCCGCGCCCCGCGACCGG - Exonic
1024041161 7:45556355-45556377 CCAGCCCCCCACCCCCCGACAGG + Intergenic
1024105830 7:46085529-46085551 CCGGCCCCCCACCCCCCGACAGG + Intergenic
1024188175 7:46976279-46976301 CTTGCCCCCCGCCCCCCGACAGG + Intergenic
1024223999 7:47311255-47311277 CCCTCCCCCTGCCCCCAGAATGG - Intronic
1027121793 7:75527585-75527607 TCTGCCCCCCGGCTCCCGAGAGG + Intergenic
1028288218 7:89031013-89031035 CCAACCCCCCAGCCCCCAAAAGG - Intronic
1030278389 7:107744070-107744092 TCCGCCTCCCGGCCTCCGGAAGG + Exonic
1030573542 7:111257929-111257951 CCAGCCCCCCAGCCCCCAACAGG + Intronic
1033054908 7:138042049-138042071 CCTGCCCCCCACCCCACGAAAGG - Intronic
1034618067 7:152436018-152436040 CCCGCCCGCCGCCCCCCGCCCGG - Intergenic
1034673493 7:152874512-152874534 CCAGCCCCCCACCCCCCGACAGG + Intergenic
1034722580 7:153308175-153308197 CCAGCCCCCCACCCCCCGACAGG - Intergenic
1034985898 7:155515299-155515321 CCCCCCCCCCGGCCCCGGCCAGG + Intronic
1035232109 7:157471495-157471517 CCCTGCCCCCAGCCCCCGCATGG + Intergenic
1035643567 8:1201344-1201366 CCTGCCCCACGGCCCCTGAGCGG - Intergenic
1035749688 8:1987880-1987902 CCAGCTCCCCAGCCCCCGACGGG + Intronic
1036789685 8:11709338-11709360 CCCGCCCTCGGGCCTCCGCAGGG + Intronic
1037487773 8:19364582-19364604 CCCGCCCCCCTCCCCCCCAGAGG + Intronic
1038584734 8:28778520-28778542 CCCGCCTCCAGGCCCGTGAATGG + Intronic
1038599926 8:28929934-28929956 CCCGCCCCCCGCCCCGCCAATGG + Intronic
1039608485 8:38901419-38901441 CCCGAGCCCCGGCCCCTGCACGG + Exonic
1039648115 8:39309110-39309132 CCAGCCCCCCAGCCCCCAACAGG - Intergenic
1039832906 8:41230947-41230969 CCAGCCCCCCACCCCCCGACAGG - Intergenic
1039842960 8:41306863-41306885 CCCTCACCCCAGCCCCCAAAAGG - Intronic
1039903170 8:41767294-41767316 CCCGCGCCCCGGCCCCGGCCGGG + Intronic
1041624083 8:60005154-60005176 CCAGCCCCCTAGCCCCTGAAAGG - Intergenic
1043388203 8:79768158-79768180 CCCGCCCCGCGCGCCCCGATTGG + Intergenic
1047178519 8:122565364-122565386 CCAGCCCCCCAGCCCCCAACAGG - Intergenic
1047805718 8:128357157-128357179 CCCTCCCCCCAACCCCCAAAAGG - Intergenic
1048600715 8:135916289-135916311 CCCCTCCCCCGCCCCCCGAAAGG + Intergenic
1049047016 8:140160638-140160660 CCAGCCCCCCACCCCCCGACAGG - Intronic
1049194615 8:141308460-141308482 CCGCCCACCCCGCCCCCGAACGG + Intergenic
1049247477 8:141570463-141570485 CCAGCCCCCTGACCCCCGCAGGG - Intergenic
1049386684 8:142346403-142346425 CCCGGCTCCCAGCCCCCGCACGG + Intronic
1049419583 8:142510851-142510873 CGGGCGCCCCGGCCCCCGAGCGG - Intronic
1049509075 8:143018703-143018725 CTCCCGCCCCGGCCCCCGCAGGG - Intronic
1050315006 9:4392233-4392255 CCCGACCCCCGCCCCACGACAGG - Intergenic
1050559562 9:6820868-6820890 CCAGCCCCCCAACCCCCGACAGG + Intronic
1050597844 9:7221968-7221990 CCAGCCCCCCACCCCCCAAAAGG - Intergenic
1052185752 9:25591627-25591649 CCAGCCCCCCGCCCCGCAAAAGG - Intergenic
1052263728 9:26547768-26547790 CCAGTCCCCCAGCCCCCGACAGG - Intergenic
1052725584 9:32224800-32224822 CCCTCCCCCCACCCCACGAAAGG + Intergenic
1053482290 9:38424495-38424517 CCCGCCCCGCGGCCGCTGATTGG + Intergenic
1054175046 9:61869171-61869193 CCCGGCCCCCGGCCCCGGACAGG - Intergenic
1054496151 9:65824993-65825015 CCCCCCCCCCCGCCCCCGGCAGG + Intergenic
1054662491 9:67711622-67711644 CCCGGCCCCCGGCCCCGGACTGG + Intergenic
1054794920 9:69291767-69291789 CCCTCCCCCCACCCCCCGACAGG - Intergenic
1055784926 9:79862326-79862348 CCAGCCCCGCAGCCCCCGACAGG + Intergenic
1057023463 9:91718577-91718599 CCCCCCCCCCCGCCCCAGGATGG - Intronic
1057894001 9:98891661-98891683 CTAGCCCCCCAGCCCCCGACAGG - Intergenic
1058225091 9:102350392-102350414 TGCGCCCCCCAGCCCCCGACAGG - Intergenic
1059285982 9:113171996-113172018 CCCGTCCCCCAACCCCCGACAGG + Intronic
1060478133 9:124000181-124000203 CCCGCCCCCCGGCCCTGGCCCGG + Intergenic
1060485895 9:124045858-124045880 CCCGCCCCCCGCCCACCGCGCGG - Intergenic
1061285426 9:129620038-129620060 CCCGCCCCCCGGGCCCCGCGGGG + Intronic
1062314742 9:135961188-135961210 CCCGCCACCCGGGCCCCTGAAGG + Exonic
1062555742 9:137112719-137112741 CCCTTCCCCCGGCCCCAGATGGG - Intronic
1062562326 9:137147014-137147036 CCCTCCCCCCAGCGCCCGACAGG + Intronic
1062568822 9:137175200-137175222 CCCGCCCCCTGGCCCCCCGTGGG + Intronic
1062579275 9:137222314-137222336 CCCGCCCCGCGGACCCCGCGCGG - Intergenic
1062599781 9:137314613-137314635 CCCGCCCCCAGGGCCCCGGAAGG + Intronic
1203777667 EBV:82639-82661 CCTGCCCTCAGGCCCCCGAGTGG + Intergenic
1203777690 EBV:82726-82748 CCCGCCCTCGGACCCCCGAGTGG + Intergenic
1203470803 Un_GL000220v1:114495-114517 CCCGCCCCCCGACCCGCGCGCGG - Intergenic
1203478624 Un_GL000220v1:158467-158489 CCCGCCCCCCGACCCGCGCGCGG - Intergenic
1186950704 X:14621511-14621533 CCTGTCCCCCAGCCCCCGACAGG + Intronic
1187388735 X:18872081-18872103 CCCGCCCCCCTGCCCCCAGCTGG + Intergenic
1187574483 X:20540162-20540184 CCAGCCCCCCAGCCCCCAACAGG + Intergenic
1188044320 X:25408385-25408407 CCAGCCCCCCAACCCCCGACAGG + Intergenic
1189162629 X:38826076-38826098 CCAGCCCCCCACCCCCCGACAGG + Intergenic
1189215141 X:39316549-39316571 CCAGCCCCCCACCCCCCGATAGG - Intergenic
1189239864 X:39516764-39516786 CCCTAGCCCCGGCCCCCGAGAGG - Intergenic
1189461086 X:41243532-41243554 CCCCCCCCCCGCCCCCCGCTCGG - Intergenic
1189844732 X:45124238-45124260 CCAGCCCCCCACCCCCCGACAGG - Intergenic
1189875297 X:45430409-45430431 CCAGCCCCCCAGCCCCCAACAGG + Intergenic
1189878728 X:45466542-45466564 CCAGCCCCCCATCCCCCGACAGG - Intergenic
1191738265 X:64410116-64410138 CCAGCTCCCCAGCCCCCGACAGG - Intergenic
1191771925 X:64770178-64770200 CCCGGCCCCCAGCCCCCAATGGG + Intergenic
1192525264 X:71837415-71837437 CCAGCCCCCCAGCCCCCAACAGG - Intergenic
1193414085 X:81200700-81200722 CCAGCCCCCCACCCCCCGACTGG - Intronic
1194282202 X:91966979-91967001 CCCACCCCCCACCCCCCGACTGG + Intronic
1195132877 X:101871867-101871889 CCCACCCCCCACCCCCCAAAAGG + Intergenic
1195282810 X:103353382-103353404 CCAGGCCCCCAGCCCCCGACAGG + Intergenic
1195764762 X:108284303-108284325 CCAGCCCCCCAGCCCCCGACAGG - Intronic
1195827597 X:109019476-109019498 CCAGCCCCCTAGCCCCCGACAGG + Intergenic
1196854524 X:119970373-119970395 CCCGCCCCCCGCCCCCCCCCCGG - Intergenic
1196892234 X:120302494-120302516 CCCACCCCCCGACCCCCCACCGG + Intronic
1197033212 X:121844133-121844155 CCCTCCCCCCACCCCACGAAAGG + Intergenic
1198005462 X:132489300-132489322 CCCGCCGGCCGGCCCCGGGAAGG - Intronic
1198161793 X:134015511-134015533 CCAGCCCCCCACCCCCCGACAGG + Intergenic
1200100802 X:153688447-153688469 GCCGCCCCCCGGCCCCCGGCCGG + Exonic
1200230464 X:154441411-154441433 CCCGCCCCCCCGCCCCCCAGAGG - Intronic
1200599793 Y:5191634-5191656 CCCACCCCCCACCCCCCGACTGG + Intronic
1200743809 Y:6884274-6884296 CCAGCCCCCCAGCCCCTGACAGG - Intergenic
1201460036 Y:14212212-14212234 CCAGCCCCCCACCCCACGAAAGG - Intergenic