ID: 1161752851

View in Genome Browser
Species Human (GRCh38)
Location 19:6110310-6110332
Sequence CCGCCCCCCGGCCCCCGAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 1, 2: 7, 3: 27, 4: 334}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161752842_1161752851 13 Left 1161752842 19:6110274-6110296 CCCGGACGTTTGGGGTGAGCGGC 0: 1
1: 0
2: 1
3: 5
4: 50
Right 1161752851 19:6110310-6110332 CCGCCCCCCGGCCCCCGAACGGG 0: 1
1: 1
2: 7
3: 27
4: 334
1161752836_1161752851 27 Left 1161752836 19:6110260-6110282 CCGCGGGCGCACCACCCGGACGT 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1161752851 19:6110310-6110332 CCGCCCCCCGGCCCCCGAACGGG 0: 1
1: 1
2: 7
3: 27
4: 334
1161752835_1161752851 28 Left 1161752835 19:6110259-6110281 CCCGCGGGCGCACCACCCGGACG 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1161752851 19:6110310-6110332 CCGCCCCCCGGCCCCCGAACGGG 0: 1
1: 1
2: 7
3: 27
4: 334
1161752840_1161752851 16 Left 1161752840 19:6110271-6110293 CCACCCGGACGTTTGGGGTGAGC 0: 1
1: 0
2: 1
3: 2
4: 32
Right 1161752851 19:6110310-6110332 CCGCCCCCCGGCCCCCGAACGGG 0: 1
1: 1
2: 7
3: 27
4: 334
1161752843_1161752851 12 Left 1161752843 19:6110275-6110297 CCGGACGTTTGGGGTGAGCGGCG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1161752851 19:6110310-6110332 CCGCCCCCCGGCCCCCGAACGGG 0: 1
1: 1
2: 7
3: 27
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161752851 Original CRISPR CCGCCCCCCGGCCCCCGAAC GGG Intronic
900174976 1:1287615-1287637 CTGCACCCCTGCCCCCGCACCGG - Intronic
900205612 1:1430874-1430896 CCGCCCACAGGCCCCCCCACAGG - Intergenic
900970801 1:5991760-5991782 CCGCCCCCCGGCTCCAGCTCCGG - Intronic
901526051 1:9824001-9824023 CCGCCACCCCGCCCCCGGCCGGG - Exonic
902411253 1:16212729-16212751 CCGCCCCCCTTCCCCAGAACCGG + Intergenic
902655466 1:17864997-17865019 CCGCCTCCCAGCCCCCTCACAGG - Intergenic
905680894 1:39869919-39869941 GCGCCCCCCGCCTCCCGGACGGG - Intronic
909747834 1:79121212-79121234 CCGCCCCCCCACCCCACAACAGG + Intergenic
909792686 1:79697855-79697877 CCTGCCCCCGCCCCCGGAACTGG - Intergenic
910193859 1:84621085-84621107 CCGCCCCTCGGCCCCGGCAGAGG - Intergenic
911926511 1:103838775-103838797 CCCTCCCCCAGCCCCCCAACAGG - Intergenic
912619522 1:111140569-111140591 CAGCCCCCCGGCTCCCGCGCCGG - Intronic
914337781 1:146731385-146731407 CCTCCCCCCGACCCCACAACAGG + Intergenic
914490242 1:148146971-148146993 CCGCCCCCCGGCCCCCCGCCTGG - Intronic
914869126 1:151458824-151458846 CCGCCCCCCGGCGCCCGCCGCGG - Intronic
915553225 1:156646952-156646974 CTGCCTCCCGGCCCCGGGACAGG - Exonic
915629087 1:157138171-157138193 CCCTCCCCCGCCCCCCGCACTGG + Intronic
916634310 1:166651960-166651982 CCGCTCCCCCGCCCCACAACAGG + Intergenic
918215994 1:182392115-182392137 CCGCCCCACGGCCCCCAACCCGG + Exonic
919895703 1:202008452-202008474 CCGCCCCCCCGCCCCCGCACTGG - Exonic
920648343 1:207819234-207819256 CTGCTCCGCGGCCCCCGAATTGG + Intergenic
921390295 1:214608242-214608264 CCGCCCCCCGGCCCCCGGCCTGG + Intronic
922306480 1:224349803-224349825 GCGCCCCCCACCTCCCGAACGGG + Intergenic
922526500 1:226308688-226308710 CCCTCCCCCGGCCCCGGGACAGG + Intronic
922644937 1:227276480-227276502 CTGCCCCCCACCTCCCGAACGGG - Intronic
922680130 1:227587980-227588002 CCTCCCCCCAGCCCCCCAACAGG + Intronic
922776274 1:228215552-228215574 CCGCCCCACAGCCCCCAAGCTGG + Exonic
923592169 1:235328496-235328518 CCTCCCCCCCGCCCCCGCACCGG - Intronic
924359041 1:243216352-243216374 CCTCCCCCCGACCCCACAACAGG + Intronic
924436710 1:244049007-244049029 CCGGCCCCTGGCCCCTGACCTGG + Intronic
1063546156 10:6984034-6984056 CCGTTCCCCAGCCCCCCAACAGG + Intergenic
1063948940 10:11204539-11204561 CCCCCCACCGGCCCCCGACAAGG - Intronic
1065186611 10:23174899-23174921 CCCCTCCCCGGCCCCCAATCCGG - Intergenic
1065198338 10:23288462-23288484 TCACCCCCCAGCCCCCCAACAGG - Intronic
1069470730 10:68687134-68687156 CCGCCCCCCCGCCCCCGCCTTGG + Intronic
1069680806 10:70283934-70283956 CCGCCCCTCGCCTCCCGACCAGG + Intergenic
1070752780 10:78973863-78973885 CCGCGCCCCGGCCCCAGCCCCGG - Intergenic
1073019574 10:100431840-100431862 CCGCCCCCCCCCCCCCCACCCGG + Intergenic
1075401378 10:122163726-122163748 TCGCCCCCCGGCCCCCGGCTCGG + Intronic
1076011746 10:126994905-126994927 GCGCCCCCCACCTCCCGAACGGG + Intronic
1076833883 10:133010284-133010306 CAGACCCCCTGGCCCCGAACTGG - Intergenic
1077090625 11:776876-776898 GCGCCCCGCGGCCCCCGTCCTGG - Intronic
1077100456 11:820060-820082 CCGCCCCCAGGCCAGCGACCCGG - Intronic
1077317899 11:1927433-1927455 CAGCCCCACGGCCCATGAACGGG - Intronic
1077538347 11:3134990-3135012 CTGCACCCCAGCCCCCGAGCTGG + Intronic
1078771768 11:14358633-14358655 CCGCCCCCTGGCCCCGGCCCGGG + Intronic
1078800889 11:14643620-14643642 CCGCGCCGCGGCCGCCCAACAGG - Intronic
1079090510 11:17476947-17476969 CCGCCCCCCGGCCCCGCAGGTGG - Intergenic
1079251977 11:18793167-18793189 CCACCCCCCCGCCCCCGAGACGG + Intergenic
1079317578 11:19422223-19422245 CCGCTCCCCGCCCCCCAGACTGG - Intronic
1081831500 11:46119950-46119972 GCGCCCCCGGGACCCCGAGCGGG - Intronic
1081952718 11:47059186-47059208 TCACCCCCCAGCCCCCCAACAGG - Intronic
1082003710 11:47408551-47408573 CGGCCGCCCGGCCCCCGGCCCGG - Intronic
1082166356 11:48955503-48955525 CTGCCCCCCACCTCCCGAACTGG + Intergenic
1083173586 11:60936498-60936520 CCTCCCCCCAGCCCCACAACTGG + Exonic
1083329653 11:61891603-61891625 CTGCCCCCCCGCCCCCGGCCAGG + Intronic
1083741475 11:64713723-64713745 CCGGCCCCCGGCCCCCGCTCAGG + Exonic
1083922434 11:65787874-65787896 CCGCTCCCCGCCCCCCAAAGTGG - Intronic
1083936652 11:65872965-65872987 CCGCCTCCCGGCGCCGGACCAGG + Intronic
1084332835 11:68439814-68439836 CCCCGCCCCGGCCCCCCATCAGG - Exonic
1084492599 11:69486853-69486875 CTGCCCCACTGTCCCCGAACTGG + Intergenic
1084516075 11:69638557-69638579 TCGCCCCCTGGCCCCCGCCCCGG - Intergenic
1085409157 11:76281449-76281471 GAGCCCCCCGGCTCCCAAACAGG + Intergenic
1092218277 12:6697287-6697309 CTTCCCCACGGCCCCCGAACAGG + Exonic
1095341822 12:41098530-41098552 CCTCCCTCCGGCCCCCTGACAGG - Intergenic
1095703668 12:45216219-45216241 ACGCCCCGCGGTCCCCGATCCGG + Exonic
1095784648 12:46096046-46096068 CCACCCCCTGACCCCCCAACAGG - Intergenic
1095987726 12:48010684-48010706 CTGCCCCCCGCCCCCCGCACTGG - Intergenic
1096389509 12:51217828-51217850 CCGCCCCCAGGCCCCCAGCCTGG + Intergenic
1096773013 12:53948334-53948356 CCACCCCCCTGCCCCCGACCGGG - Intergenic
1097120204 12:56725541-56725563 CCGCCCTCCGGTCCGCGAAGTGG + Intronic
1097679826 12:62637979-62638001 CCCCCCCCCCGCCCCCAACCAGG - Intergenic
1098447853 12:70585794-70585816 CCGACCCCCGACCCCACAACAGG + Intronic
1099409726 12:82310638-82310660 CCAGCCCCCCGCCCCCCAACAGG + Intronic
1099973593 12:89524921-89524943 CCGGCCCCCAGCCCCCGGCCCGG - Intronic
1101409497 12:104457092-104457114 CAGCCGCCCGGCCCGCGACCAGG + Exonic
1103722264 12:122981181-122981203 CCGACCCCCGTCCCCGGGACCGG - Exonic
1104029362 12:125053514-125053536 GCGCCCCCCGCCTCCCGGACGGG + Intergenic
1104924906 12:132309004-132309026 CCGCCCCTCTGCCCCCAACCAGG + Intronic
1105520227 13:21124745-21124767 CCCCCCCCCCGCCCCCCGACAGG + Intergenic
1105845097 13:24287027-24287049 CCACCCCCCGCCCCCCCATCAGG + Intronic
1106340237 13:28820233-28820255 CTGCGCCCCGGCCCTCGAGCGGG + Intergenic
1106349112 13:28910537-28910559 CCTCCCCCCAGCCCCCCAGCAGG + Intronic
1107451279 13:40512372-40512394 CCTTCCCCCTGCCCCCGGACAGG - Intergenic
1108188616 13:47913942-47913964 CCAGCCCCCAGCCCCCCAACAGG - Intergenic
1110071823 13:71187120-71187142 CCATCCCCCGACCCCCCAACAGG - Intergenic
1110563253 13:76931822-76931844 CTTGCCCCCGGCCCCCCAACAGG - Intergenic
1110815695 13:79857960-79857982 CCGGCCCCCGACCCCCTGACAGG - Intergenic
1114270707 14:21098426-21098448 CGGCCCCCCCGCCCCCGGCCCGG + Exonic
1119223758 14:72928859-72928881 CAGCCCCGAGGCCCCCAAACTGG + Intronic
1120091851 14:80341370-80341392 CCAGCCCCCCACCCCCGAACCGG - Intronic
1121645808 14:95516550-95516572 CCGGCCCCCGGCCCCAGGCCTGG + Intronic
1122719956 14:103716230-103716252 CCGCCTCCCGGCGCCCGCCCTGG - Intronic
1124291733 15:28457540-28457562 CTTCCCCCCGGCCCCCGGCCTGG + Intergenic
1124385811 15:29207443-29207465 CACCCCCCCCGCCCCCCAACCGG - Intronic
1126436651 15:48644876-48644898 CCGCCGCCCGTCCCCCGGGCCGG + Exonic
1128056395 15:64702933-64702955 CCGGCCCCCGCCCCCCGCAGCGG - Intronic
1128143174 15:65316486-65316508 CCGCCCCACCGCCCCCGACTGGG + Intergenic
1128182426 15:65615876-65615898 CCACCCCCCCACCCCCCAACAGG + Intronic
1128455117 15:67827686-67827708 CCGGGTCCCGGCCCCCGAGCAGG - Exonic
1128489864 15:68134928-68134950 GCGCCCCCCACCCCCCGGACGGG + Intronic
1128490101 15:68135452-68135474 GCGCCCCCCACCCCCCGGACGGG + Intronic
1129082389 15:73052410-73052432 CCGCCCCCCCCCCCCCGCCCCGG + Intronic
1130152798 15:81324212-81324234 CCGCGCCCCCGCTCCCGAATTGG + Intergenic
1130908696 15:88256834-88256856 CCTCCCCCCGCCCCCCGCCCGGG + Intergenic
1132578763 16:675764-675786 CCGGACCCCGGCCCCCGGCCAGG + Exonic
1132585767 16:705291-705313 CCGCGCCCCGGCCCCTGGCCCGG - Intronic
1132671201 16:1102902-1102924 CCCCCCCCCGGCCCCCCTCCCGG + Intergenic
1132912569 16:2322528-2322550 CCGCCCCCCCACCCCACAACAGG + Intronic
1133221250 16:4320034-4320056 CCGCCCCCCAGCCATCGAACTGG - Intronic
1133272391 16:4616554-4616576 CCGCCCCCGGGCGCTCGAAGCGG - Intronic
1135382783 16:22008261-22008283 CCACCCCCCGAGCCCCGGACAGG - Exonic
1136579374 16:31142558-31142580 CCGCCCCCTGGCGGCCGTACAGG + Exonic
1136642979 16:31583183-31583205 CCTCCCCCCAGCCCCCCAACAGG + Intergenic
1136707043 16:32200123-32200145 CCGGCCCCTGGCCCCCGGCCTGG - Intergenic
1136760867 16:32729294-32729316 CCGGCCCCTGGCCCCCGGCCTGG + Intergenic
1136779092 16:32885937-32885959 CCGCGCCCCCGGCCCCGACCGGG + Intergenic
1136807236 16:33141092-33141114 CCGGCCCCTGGCCCCCGGCCTGG - Intergenic
1139996499 16:70985948-70985970 CCTCCCCCCGACCCCACAACAGG - Intronic
1141657061 16:85422035-85422057 CCGCCCCACGGCCCATGTACAGG + Intergenic
1141709401 16:85689139-85689161 CCCCGCCCCGGCCCGCGGACAGG + Intronic
1142141486 16:88474571-88474593 GAGCCCCCCGCCCCCCGAAGTGG - Intronic
1203063019 16_KI270728v1_random:989608-989630 CCGGCCCCTGGCCCCCGGCCTGG + Intergenic
1142638337 17:1271126-1271148 CGGCCCCTCGGCCACCGCACTGG - Exonic
1142725059 17:1807418-1807440 GCCCCCCCCGGCCCCCACACCGG + Intronic
1142808693 17:2385319-2385341 CCTCCCCCCGGCCCCCTCGCCGG + Exonic
1143148194 17:4789926-4789948 CGGCCCCCCGGGACCCGACCCGG + Exonic
1143783262 17:9240311-9240333 CCGCCCCCGGGCCCCAGGGCAGG - Exonic
1145190833 17:20841574-20841596 CCGCCCCCCGGCCCCCGGCCTGG - Intronic
1146329604 17:31916936-31916958 CTGCCCCCGGGACCCCGCACCGG + Intergenic
1147994377 17:44353134-44353156 CCTCCCCAGGGCCCCAGAACAGG + Intergenic
1148562429 17:48613637-48613659 CGCCCCCCCCGCCCCCGCACGGG - Intronic
1148714248 17:49704410-49704432 CCGCCCCCCGGCCCACGCACTGG + Intronic
1148899436 17:50865652-50865674 CCGCCCCGTGGCCCCCGCCCCGG + Intronic
1150096267 17:62378759-62378781 CCACCCCCCTACCCCCCAACAGG - Intronic
1150249935 17:63699784-63699806 CCGCCCCTCGGCCCCCGACCTGG + Intronic
1150995449 17:70312146-70312168 CCAGCCCCCGACCCCCCAACAGG + Intergenic
1151854391 17:76710754-76710776 CCGCCCCTGCGCCCCCGAGCCGG - Exonic
1152183747 17:78841159-78841181 GCGCGCCCCCGCCCCAGAACGGG + Intronic
1152663149 17:81552261-81552283 CCGCCGCCAGGCCCCCGAGAGGG + Exonic
1152709029 17:81861058-81861080 ACGCCCCCCGGCCCCCGGACCGG + Intergenic
1152758847 17:82098088-82098110 CCGCGCCCCGGCCCCAGCGCCGG + Intronic
1152915146 17:83030766-83030788 CCGCCCCGAGGCCTCTGAACTGG - Intronic
1153051983 18:908409-908431 CCGCCCCGCGCGCCCCGCACAGG - Intronic
1153935307 18:9914875-9914897 CCGCCCCCCGACCCCTGCCCCGG + Intronic
1156651970 18:39235608-39235630 CGGCCCCCCGGCCCCCGGCGTGG + Intergenic
1157455946 18:47828299-47828321 CTGCCCCCCACCTCCCGAACGGG - Exonic
1159219158 18:65437510-65437532 CCGTCCCCCGACCCCTCAACAGG - Intergenic
1159798183 18:72868054-72868076 CCGCCCCCCGGCCCCCCCCCCGG - Intronic
1160675860 19:390937-390959 TGGCCCCCCGGCCCCCGCCCCGG + Intergenic
1160675868 19:390949-390971 CCCCGCCCCGGCCCCCGCCCTGG + Intergenic
1160691292 19:461574-461596 CCCCCCCCCCACCCCCGAGCCGG - Intergenic
1160858711 19:1228711-1228733 GCGCCCCGCGGCCCCCGCCCGGG + Exonic
1160907437 19:1458087-1458109 CCATCCTCCAGCCCCCGAACAGG + Intronic
1160995370 19:1879849-1879871 CCGCCCCCCGGCCCCCCGCCTGG + Intronic
1161215816 19:3094592-3094614 CCGCCCCCCGGCCCCCGGCCCGG - Exonic
1161590135 19:5125772-5125794 CCACCCCCCGCCCCCCGCCCTGG + Intronic
1161752851 19:6110310-6110332 CCGCCCCCCGGCCCCCGAACGGG + Intronic
1161778456 19:6276660-6276682 CCTCCCCCCGGCCCCAGCCCAGG + Intronic
1161846360 19:6713772-6713794 CCACCCCCCAGCCCCCCACCTGG + Intronic
1162021384 19:7869988-7870010 CCGCCCCCCGACCCCGGGTCCGG - Exonic
1162022491 19:7874168-7874190 CGGCCCCGCTGCCCGCGAACGGG + Intronic
1162481281 19:10928467-10928489 CTTCCCCCCCGCCCCCGAGCCGG + Intronic
1163026811 19:14517687-14517709 CAGCCCCCAAGCCCACGAACGGG + Intronic
1163315631 19:16538779-16538801 CCACCCCCCCGCCCCAGAAAGGG + Intronic
1164659266 19:29949053-29949075 CTGCCCCCCGCCTCCCGGACGGG + Intronic
1164677160 19:30109229-30109251 CTGCCCCCCAACCCCAGAACAGG + Intergenic
1165094323 19:33402265-33402287 CCTCCACCCGGCACCCCAACAGG + Intronic
1165349739 19:35269190-35269212 CCGCGCCCCGGCCCCGGCCCCGG + Intronic
1166857926 19:45792494-45792516 CCGCCCGCAGGCCCCGGACCCGG - Exonic
1167001237 19:46746611-46746633 CCACCCGCCGGCCCCCGCGCGGG - Exonic
1167266526 19:48485577-48485599 CCGCCCCCCAGCCCCCCAGATGG - Exonic
1167368087 19:49065073-49065095 CCCCGCCCCCGCCCCCGACCCGG - Intronic
1168344091 19:55642004-55642026 CCCCCCACCGGCCCCCGTATCGG - Exonic
926451757 2:13012460-13012482 CCGCACCCCCACCCCCGACCAGG - Intergenic
926683088 2:15678657-15678679 CAGCCCCCCAGCCCCCCAGCAGG - Intergenic
927215821 2:20667345-20667367 CCGCCCCCTGGGCTCCGGACCGG - Exonic
928998722 2:37324813-37324835 CCGCCCTCCGGCCCCAGGACGGG - Intergenic
929242312 2:39665763-39665785 CCGCCCGCCCGCCCCCGGCCCGG - Intronic
929487163 2:42365204-42365226 CCACCACCCGTCCCCCAAACTGG - Intronic
929983063 2:46699144-46699166 CCGCCCCCCGCCCCCCGCCCCGG + Intronic
930071479 2:47369640-47369662 CCGGCCCTCGGCCCCCGAAACGG + Intronic
930075653 2:47403496-47403518 CCGCCCCCGTGCCTCCGCACTGG - Intronic
931602535 2:64019033-64019055 CCGCCGCCCGGCGCCCGGCCGGG + Exonic
932158130 2:69437015-69437037 CCGCCCCCAGGCCCTCTACCGGG - Intronic
933061983 2:77749233-77749255 CCATCCCCCTGCCCCCCAACAGG - Intergenic
934045570 2:88170435-88170457 CCGCGCCCCGCGCCCCGCACCGG + Intronic
934522003 2:95025605-95025627 CCGCCCCCCGCCCCACGCCCCGG - Intergenic
937359220 2:121217509-121217531 CCGCCCCCCGGCCCTCCATAAGG - Exonic
938828878 2:135033455-135033477 GCGCCCCCCACCCCCCGGACGGG + Intronic
938828964 2:135033659-135033681 GCGCCCCCCACCCCCCGGACGGG + Intronic
939706667 2:145462510-145462532 CCTCCCCTTGGCCCCCTAACAGG + Intergenic
941104899 2:161341134-161341156 CCGCCCCTGCGCCCCCGAGCCGG - Intronic
942240920 2:173964093-173964115 CCGCCCGCCTGCCCGCGGACCGG - Intronic
942748634 2:179264362-179264384 CCGCCCCGCGGCCCGCGCAGGGG + Intronic
942780457 2:179635375-179635397 CAGCCCCCCCACCCCCCAACAGG - Intronic
944570857 2:201042685-201042707 CTGCCCCCCAGCTCCCGGACTGG - Intronic
945821212 2:214668182-214668204 CTTCCCCCCAACCCCCGAACAGG + Intergenic
947576733 2:231281214-231281236 CCGCCCCACTGCCCCCATACAGG - Intronic
947992158 2:234496682-234496704 CCGCCCGCCGCCGCCCGCACCGG + Exonic
948670912 2:239568090-239568112 CCCCACCCCGGCCCCCGAGTTGG + Intergenic
949040514 2:241846507-241846529 CTGACCCCCGGGCCCCGAAGAGG - Intergenic
1168965419 20:1895312-1895334 CCTCCCCCCGACTCCGGAACGGG - Intronic
1170390949 20:15874063-15874085 CAGCCCCCCCACCCCCCAACAGG + Intronic
1170629771 20:18056962-18056984 CCGCCGCCCCGCCCCGGACCTGG + Intronic
1171175519 20:23048898-23048920 CCGCTCCGCGGGCCGCGAACGGG + Exonic
1172015512 20:31870496-31870518 CCGCCCGCCGACCCCCGGCCCGG + Exonic
1172107833 20:32527405-32527427 CAGCACCCCAGCCCCAGAACAGG + Intronic
1173681771 20:44886691-44886713 CCGCTCCCCACCCCCCGACCAGG - Intronic
1174648468 20:52105089-52105111 CCGGCCCCCAGCCCCCGGGCGGG + Intronic
1175178884 20:57130940-57130962 CCACCCCCCACCACCCGAACTGG + Intergenic
1175521236 20:59604056-59604078 CCGCCCCCCCGCCCCCCGGCAGG + Intronic
1175823438 20:61924134-61924156 CTCCCCCCCGGCCCCACAACAGG - Intronic
1175846946 20:62064614-62064636 CCGCCCCCGGGACCCCCACCGGG - Exonic
1178707734 21:34889132-34889154 CCGCCACGAGGCTCCCGAACCGG + Intronic
1179010063 21:37549682-37549704 TAGCCCCCCGCCCCCCTAACAGG + Intergenic
1179792970 21:43766100-43766122 CTCCCCCCCGGCCCCCGCCCAGG - Intergenic
1180067161 21:45418262-45418284 CCGGCCCCCGGCTGCCGAAGTGG + Intronic
1180843598 22:18970352-18970374 GCGCCCCCCAGCCCCCGCCCAGG + Intergenic
1180843612 22:18970378-18970400 GCGCCCCCCAGCCCCCGCCCAGG + Intergenic
1181121445 22:20670389-20670411 CCGCCCCCCGGCCCCCGGCTTGG + Intergenic
1181334404 22:22117413-22117435 CCGCCCCCCGGCCCCCGGCTTGG + Intergenic
1181831667 22:25564951-25564973 CCGCCCGCCGCGCCCCGACCTGG - Exonic
1182278654 22:29205905-29205927 CCGCCCTCCGGCCGCGGAGCTGG + Exonic
1182604132 22:31490007-31490029 CCACCCCCCGGCCCGCGCAGGGG - Intronic
1182790293 22:32946535-32946557 CCCTCCCCCGGCCCCACAACAGG - Intronic
1183406692 22:37633691-37633713 CCACCCCCCGGGCCCTGCACCGG + Intergenic
1183956220 22:41382096-41382118 GCGCGCCCCGGCCCCGGACCGGG - Exonic
1184145542 22:42607965-42607987 GCGCCCCCCACCTCCCGAACAGG - Intronic
1184201405 22:42971876-42971898 CTGCCCCCCACCTCCCGAACGGG - Intronic
1184423452 22:44395287-44395309 TCCCCCACCGGCCCCCGAGCCGG - Intergenic
1184500437 22:44868299-44868321 CCGTCCCCCTGCCCCCCACCTGG - Intergenic
1184523677 22:45009477-45009499 CCGGCCCCCGGCCACCTACCTGG + Exonic
1185285402 22:49997713-49997735 CCGCACCCAGGACCCCCAACTGG + Exonic
1185313785 22:50170349-50170371 CCGCAGCCCGGCCCCCGCCCTGG - Intergenic
953720444 3:45350176-45350198 CCGCCTCCCGCTCCCCGACCCGG + Intergenic
954107284 3:48416121-48416143 CCGGCCCGCGGCCCCAGAGCTGG - Exonic
956826062 3:72997339-72997361 CCGCCACTCGTCCCCTGAACGGG - Intronic
961665794 3:128492595-128492617 CCGCCTCCCGGCCCCCGAACTGG - Intronic
964507956 3:157420172-157420194 CCTCCCCCCAGCCCCCCAACAGG - Intronic
964653150 3:159034378-159034400 CTAGCCCCCGACCCCCGAACAGG + Intronic
964720605 3:159764724-159764746 CCGCTCTCCGGCCCGGGAACCGG + Exonic
965592047 3:170370440-170370462 CCCCCCCCCCCCCCCCGAGCAGG + Intronic
966096754 3:176213504-176213526 CCTTCCCCCGGCCCCCGCAGTGG - Intergenic
966283536 3:178265136-178265158 CCTCACCCCTGCCCCCCAACAGG + Intergenic
967187138 3:186953979-186954001 CCTCCCCCAGGCCCCCTGACAGG + Intronic
968049807 3:195646875-195646897 CAGCTCCCCGGCCCTCAAACCGG - Intergenic
968105924 3:196000911-196000933 CAGCTCCCCGGCCCTCAAACCGG + Intergenic
968161630 3:196432015-196432037 CCGCCCCCGGGTCCCCGGGCCGG + Intronic
968221387 3:196942652-196942674 CCGCCCCGCGGCGCCCGACCCGG - Intergenic
968304327 3:197639107-197639129 CAGCTCCCCGGCCCTCAAACCGG + Intergenic
968667366 4:1828768-1828790 GCGCCCCCCACCCCCCGGACGGG + Intronic
969344751 4:6563692-6563714 CCGCCCCCCGCCCCCCGCCCCGG - Intergenic
969384735 4:6837134-6837156 CTGCCCCCCACCTCCCGAACGGG + Intronic
969708991 4:8831949-8831971 CCGGCCCCCAGCCCCCGCTCCGG - Intergenic
970643810 4:18096629-18096651 CCGCCCCCCGACCCCACAACAGG - Intergenic
971029392 4:22620636-22620658 CCCCCCCCCCGCCCCCGAGTTGG - Intergenic
971282045 4:25249482-25249504 CTGCCCCCCGCCTCCCGGACGGG + Intronic
971320332 4:25600290-25600312 CCGTCCCCCGACCCCACAACAGG - Intergenic
971766192 4:30835217-30835239 CCAACCCCCGGGCCACGAACCGG + Intronic
973984543 4:56337645-56337667 TCTCCCCCCGGCCCCCCAGCTGG + Intergenic
978459421 4:108934327-108934349 CAGCCCCCCATCCCCCCAACAGG - Intronic
978476777 4:109139821-109139843 CCTCCCCCCGACCCCACAACAGG + Intronic
979624140 4:122827096-122827118 CCGTCCCCCGGCCCCGGCCCCGG - Exonic
981200215 4:141971688-141971710 CCAGCCCCCGACCCCCAAACAGG - Intergenic
984780000 4:183516808-183516830 CCGCCCCCCTGCCCCCCACTTGG + Intergenic
984923410 4:184785594-184785616 CCCCCCCCCCGCCCCCGCCCAGG - Intronic
985506533 5:284767-284789 CAGCTCCCCGGCCCTCAAACTGG - Intronic
986721614 5:10564437-10564459 CCGGCCCCCGGCCCGCGCCCCGG + Intronic
989552251 5:42749781-42749803 TAGCCCCCCGACCCCCCAACAGG + Intergenic
992105420 5:73446725-73446747 CAGCCCCCCAACCCCCGACCTGG - Exonic
993386348 5:87267762-87267784 CCGGCCCCCCGCCCCCGCTCCGG + Intergenic
993517003 5:88850083-88850105 CCGCCCCCCAACCCCATAACAGG + Intronic
996888850 5:128393157-128393179 CTGTCCCCCGGCCCCCACACCGG + Exonic
996894381 5:128461844-128461866 CCCTCCCCCGACCCCCCAACAGG - Intronic
997228606 5:132227657-132227679 GCGACCCCCGGCCCCGGATCCGG + Intronic
998166733 5:139848494-139848516 GCGCCCCCCGGCCCGGGACCCGG - Exonic
999300396 5:150486688-150486710 CCCCTCCCCTGCTCCCGAACAGG + Intronic
1002296150 5:178232466-178232488 CCGCCGCCCGCCCCCCGCCCGGG + Intronic
1002524408 5:179807158-179807180 CCGCCGCCCGCCCCCCGCCCCGG - Intronic
1002712771 5:181205073-181205095 CCGCGGACCGGCCCCGGAACCGG - Exonic
1002844706 6:936277-936299 GCCCCTCCCGGCCCCCGCACAGG + Intergenic
1003103269 6:3193704-3193726 TCGCCCTCCTACCCCCGAACTGG - Intergenic
1003872352 6:10412922-10412944 CCGCATCCCGGCTCCCGATCCGG - Intronic
1005933148 6:30498741-30498763 GCGCCCCCCACCTCCCGAACGGG + Intergenic
1006400162 6:33813089-33813111 CCGCCCCCCGCCCCCCCAGAGGG - Intergenic
1012380328 6:98613256-98613278 CCGCCCCCCCACCCCACAACAGG + Intergenic
1013126136 6:107186607-107186629 GCGCCCCCCTACCCCCCAACAGG + Intronic
1013155701 6:107489965-107489987 CAGCCCCCCGGCTCTCGAGCGGG - Exonic
1013196305 6:107848064-107848086 CCGACCCCCGACCCCCGTCCTGG - Intergenic
1018818202 6:167351382-167351404 CCCCCCCCCGCCCCCGGACCAGG - Intronic
1019112132 6:169724601-169724623 CCTCCCCGCGGCCCCCGGCCCGG + Intronic
1019367886 7:644647-644669 CCACCCCCAGGCCTCCGGACAGG + Intronic
1019520823 7:1459798-1459820 ACGCCGCCCGGCCCCAGTACGGG + Intergenic
1019651595 7:2161959-2161981 CCGCCCCCCACCTCCCGGACGGG - Intronic
1019694763 7:2439014-2439036 CCCCGGCCCGGCCCCCGATCTGG - Intergenic
1020085684 7:5309000-5309022 CCGACCCCAGGCCCCAGGACAGG + Intronic
1020106003 7:5422634-5422656 CCGCGCCCAGCCCCCCGAGCAGG + Intronic
1020274331 7:6615600-6615622 CCGCGCCCCCGCCCCCGGCCCGG + Exonic
1020476187 7:8597702-8597724 CTGCCCCCCCGCCCCCCACCCGG - Intronic
1022020886 7:26398552-26398574 CCACCCCCCAGCCGCCGAGCCGG - Intergenic
1022275787 7:28854269-28854291 ACGCCCCGCGGCCCCGGCACGGG - Intergenic
1022318124 7:29263915-29263937 CTGCCCCCCAGCTCCCGGACAGG - Intronic
1026057546 7:66997631-66997653 CCACCCCCCCGCCCCCGAGATGG + Intronic
1026548555 7:71346741-71346763 CCCACCCCCGCCCCCCCAACAGG - Intronic
1026945911 7:74316032-74316054 CCTCCCCCCGCCCCCACAACAGG + Intronic
1027592690 7:80135289-80135311 CCGACCCCCGGGCCCCGACCCGG - Intronic
1028683606 7:93567698-93567720 CCAGCCCCCTGCCCCCCAACAGG + Intronic
1030840687 7:114350293-114350315 CCCTCCCCCGGTCCCCCAACAGG + Intronic
1035020408 7:155797244-155797266 GCTCCCCCCAGCCCCCGACCCGG + Intergenic
1035643566 8:1201343-1201365 CTGCCCCACGGCCCCTGAGCGGG - Intergenic
1037495658 8:19438184-19438206 CTGCCCCCCGACCCCCGCCCCGG - Intronic
1038444359 8:27593072-27593094 CCGCCCCCCCGGCCCCGCGCAGG - Intergenic
1038872773 8:31514285-31514307 CCAGCCCCCAGCCCCCCAACAGG + Intergenic
1039608487 8:38901420-38901442 CCGAGCCCCGGCCCCTGCACGGG + Exonic
1041200833 8:55451150-55451172 GTGTCCCCCGGCCCCCGACCCGG - Intronic
1044554012 8:93542447-93542469 CCTCCCCCCGGCCCCCGCTCTGG - Intergenic
1045098754 8:98825400-98825422 CCGCCCGCCGGGCCCCGAGCCGG - Intronic
1045235839 8:100351576-100351598 GCGCCCCCCACCTCCCGAACGGG - Intronic
1045432050 8:102123811-102123833 CCGGCCCCCGGCCCCGGCCCCGG + Intronic
1047382102 8:124372955-124372977 CTGCCACCCGGCCCCCAACCTGG + Intergenic
1048600717 8:135916290-135916312 CCCTCCCCCGCCCCCCGAAAGGG + Intergenic
1049419571 8:142510823-142510845 CCGCGCCCCGGCCCCGGCCCCGG - Intronic
1049549616 8:143251077-143251099 CAGACCCCCGTCCCCGGAACTGG + Exonic
1049585285 8:143430110-143430132 GCGCCCCCGGGCCGCCGAGCGGG - Exonic
1053690602 9:40584898-40584920 CCGCCCCCCGCCCCCGGTGCAGG - Intergenic
1054274210 9:63052597-63052619 CCCCCCCCCCGCCCCCGGGCAGG + Intergenic
1054301859 9:63385869-63385891 CCGCCCCCCGCCCCCGGTGCAGG - Intergenic
1054400631 9:64712372-64712394 CCCCCCCCCCGCCCCCGGGCAGG - Intergenic
1054434237 9:65196687-65196709 CCCCCCCCCCGCCCCCGGGCAGG - Intergenic
1054738444 9:68780146-68780168 CCGCCTCCCTGCCCCCGACATGG + Exonic
1055481877 9:76716808-76716830 TCGCCCCCCAACCCCCCAACAGG + Intronic
1055580473 9:77702809-77702831 CTGCCCCCCAGCTCCCGGACGGG + Intergenic
1055580492 9:77702851-77702873 CTGCCCCCCAGCTCCCGGACGGG + Intergenic
1055638175 9:78297601-78297623 CCCCGCCCCAGCCCCCGGACCGG - Intronic
1058023410 9:100115452-100115474 CCGTCCCCCGACCCCACAACAGG + Intronic
1058225090 9:102350391-102350413 GCGCCCCCCAGCCCCCGACAGGG - Intergenic
1059269192 9:113061416-113061438 CCGCCCCACGGGCCCTGATCCGG - Intergenic
1059270327 9:113066865-113066887 CCGCCCCACGGGCCCTGATCCGG - Intergenic
1059271463 9:113072315-113072337 CCGCCCCACGGGCCCTGATCCGG - Intergenic
1059272594 9:113077759-113077781 CCGCCCCACGGGCCCTGATCCGG - Intergenic
1059273729 9:113083201-113083223 CCGCCCCACGGGCCCTGATCCGG - Intergenic
1059274864 9:113088647-113088669 CCGCCCCACGGGCCCTGATCCGG - Intergenic
1059769849 9:117414882-117414904 CCGCCCCCGGAGCCCCGAGCCGG + Exonic
1060478135 9:124000182-124000204 CCGCCCCCCGGCCCTGGCCCGGG + Intergenic
1060485893 9:124045857-124045879 CCGCCCCCCGCCCACCGCGCGGG - Intergenic
1061015770 9:127980311-127980333 AAGCCCGCCGGCCCGCGAACTGG - Exonic
1061293713 9:129666168-129666190 CCGCGCCCCGGCCCCGGCCCCGG - Intronic
1061540236 9:131274444-131274466 CAGCACCCCCTCCCCCGAACTGG + Intronic
1061608943 9:131733353-131733375 CCCCCCCCCCGCCCCCGCCCCGG - Intronic
1061831679 9:133300198-133300220 CCGCCCCCCACCTCCCGGACGGG - Intergenic
1062268508 9:135698409-135698431 CCTCCCGCCGGCCATCGAACTGG + Exonic
1062579273 9:137222313-137222335 CCGCCCCGCGGACCCCGCGCGGG - Intergenic
1062599783 9:137314614-137314636 CCGCCCCCAGGGCCCCGGAAGGG + Intronic
1186609289 X:11123469-11123491 CCCCCCCCCGGCCCCGAGACGGG - Intergenic
1188826572 X:34842285-34842307 TTGCCCCCCAACCCCCGAACAGG - Intergenic
1188886437 X:35556191-35556213 CCCCCCACCGCACCCCGAACAGG - Intergenic
1189324457 X:40104615-40104637 CCCACCCCCTGCCCCCGACCGGG + Intronic
1191807492 X:65150486-65150508 CCTGCCCCCGACCCCCCAACAGG + Intergenic
1192784916 X:74326007-74326029 CCCCGCCCCGGCCCCTGAGCAGG + Intergenic
1193615276 X:83680167-83680189 CCCTCCCCCAGCCCCCCAACAGG + Intergenic
1193777629 X:85663185-85663207 CCACCCCCCCACCCCCCAACAGG - Intergenic
1195988262 X:110656442-110656464 CCTCCCCCTGTCCCCCTAACAGG - Intergenic
1196011398 X:110891708-110891730 CCAGCCCCCGACCCCCCAACAGG - Intergenic
1196592352 X:117501085-117501107 CCCTCCCCCAGCCCCCCAACAGG - Intergenic
1198152707 X:133926784-133926806 CCGCCCCCCTGCCACCGCCCCGG + Intronic
1198600735 X:138282634-138282656 GCGCCCCCCACCTCCCGAACAGG + Intergenic
1199640437 X:149856108-149856130 CCAGCCCCCGACCCCCGAACAGG + Intergenic
1200155339 X:153972048-153972070 CCGCCCCACGGCCCCCCCACCGG + Intergenic
1201959367 Y:19661665-19661687 CCCCCCCCCGCCCCCCGCCCCGG - Intergenic