ID: 1161752924

View in Genome Browser
Species Human (GRCh38)
Location 19:6110542-6110564
Sequence TGCGCGAGGCTGGCTGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 245}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161752924_1161752929 -6 Left 1161752924 19:6110542-6110564 CCGCCGCCAGCCAGCCTCGCGCA 0: 1
1: 0
2: 2
3: 17
4: 245
Right 1161752929 19:6110559-6110581 CGCGCAGCCCGCCCGCCCGACGG 0: 1
1: 0
2: 2
3: 23
4: 169
1161752924_1161752931 -4 Left 1161752924 19:6110542-6110564 CCGCCGCCAGCCAGCCTCGCGCA 0: 1
1: 0
2: 2
3: 17
4: 245
Right 1161752931 19:6110561-6110583 CGCAGCCCGCCCGCCCGACGGGG 0: 1
1: 1
2: 2
3: 25
4: 131
1161752924_1161752932 -1 Left 1161752924 19:6110542-6110564 CCGCCGCCAGCCAGCCTCGCGCA 0: 1
1: 0
2: 2
3: 17
4: 245
Right 1161752932 19:6110564-6110586 AGCCCGCCCGCCCGACGGGGCGG 0: 1
1: 0
2: 1
3: 7
4: 107
1161752924_1161752942 19 Left 1161752924 19:6110542-6110564 CCGCCGCCAGCCAGCCTCGCGCA 0: 1
1: 0
2: 2
3: 17
4: 245
Right 1161752942 19:6110584-6110606 CGGGGCGTTGTTACCGGCAACGG 0: 1
1: 0
2: 0
3: 1
4: 10
1161752924_1161752930 -5 Left 1161752924 19:6110542-6110564 CCGCCGCCAGCCAGCCTCGCGCA 0: 1
1: 0
2: 2
3: 17
4: 245
Right 1161752930 19:6110560-6110582 GCGCAGCCCGCCCGCCCGACGGG 0: 1
1: 1
2: 2
3: 25
4: 164
1161752924_1161752933 0 Left 1161752924 19:6110542-6110564 CCGCCGCCAGCCAGCCTCGCGCA 0: 1
1: 0
2: 2
3: 17
4: 245
Right 1161752933 19:6110565-6110587 GCCCGCCCGCCCGACGGGGCGGG 0: 1
1: 0
2: 5
3: 24
4: 164
1161752924_1161752943 27 Left 1161752924 19:6110542-6110564 CCGCCGCCAGCCAGCCTCGCGCA 0: 1
1: 0
2: 2
3: 17
4: 245
Right 1161752943 19:6110592-6110614 TGTTACCGGCAACGGTTACCAGG 0: 1
1: 0
2: 0
3: 0
4: 14
1161752924_1161752935 1 Left 1161752924 19:6110542-6110564 CCGCCGCCAGCCAGCCTCGCGCA 0: 1
1: 0
2: 2
3: 17
4: 245
Right 1161752935 19:6110566-6110588 CCCGCCCGCCCGACGGGGCGGGG 0: 1
1: 0
2: 3
3: 16
4: 201
1161752924_1161752941 13 Left 1161752924 19:6110542-6110564 CCGCCGCCAGCCAGCCTCGCGCA 0: 1
1: 0
2: 2
3: 17
4: 245
Right 1161752941 19:6110578-6110600 ACGGGGCGGGGCGTTGTTACCGG 0: 1
1: 0
2: 0
3: 0
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161752924 Original CRISPR TGCGCGAGGCTGGCTGGCGG CGG (reversed) Intronic
900330430 1:2131650-2131672 TGCCCCTGGCTGGCTGCCGGGGG - Intronic
900371988 1:2336297-2336319 CGCGAGACCCTGGCTGGCGGGGG + Intronic
900623527 1:3598085-3598107 TGGGGGAGGGTGGCTGGCTGTGG - Intronic
901000192 1:6145178-6145200 TGCCAGAGGCTGGCTGTGGGTGG - Intronic
901022138 1:6260920-6260942 GCCGCGGGGGTGGCTGGCGGCGG + Exonic
901633678 1:10659848-10659870 TGCGGGAGCCAGGCTGGGGGTGG + Exonic
903415197 1:23177689-23177711 TGCACCAGGCTTGCGGGCGGCGG + Exonic
903935314 1:26891084-26891106 TGCTGGTGGGTGGCTGGCGGCGG + Exonic
905657280 1:39692711-39692733 TGGGCCAGGCTCGCTGGGGGAGG + Intronic
906476372 1:46172033-46172055 TGCCTGAGGCTGGCTGGAGCGGG + Intronic
906701176 1:47859291-47859313 AGTGTGAGGCTGGCTGGCTGTGG - Intronic
908506006 1:64801180-64801202 TGCTTGAGGCTGGGAGGCGGAGG - Intronic
908527578 1:65002677-65002699 AGTGCGAGCCTGGCCGGCGGCGG + Intergenic
909443644 1:75724609-75724631 TGCGCTAGGCGGGGTGGCAGCGG - Intronic
910930254 1:92436530-92436552 TAAGCGAGGCTCCCTGGCGGTGG + Intergenic
911508172 1:98779848-98779870 TGAGGGAGGCTGGCTGTCGCTGG - Intergenic
912212581 1:107570988-107571010 TCCACGGGGCTGGCGGGCGGGGG + Intergenic
915359436 1:155277415-155277437 TGTGCTAGACTGGCGGGCGGCGG - Intronic
915572440 1:156751776-156751798 AGCGCGAGGTTGGGGGGCGGGGG - Intronic
916390070 1:164321512-164321534 TGCGCAGGGCGGTCTGGCGGTGG + Intergenic
920795470 1:209132508-209132530 TGCGCCAGGCTGTCTGCCTGTGG - Intergenic
922496596 1:226062504-226062526 GGCGCGAGGCGGCCTGGAGGAGG + Intronic
922581726 1:226703380-226703402 CGCCCGACGCTGGCTGGCCGAGG + Intronic
923100488 1:230810674-230810696 TGCCAGAGGCTGGATGGAGGAGG - Intergenic
924540006 1:244971161-244971183 TGCGCGGCGCTAGCCGGCGGCGG - Intronic
1065099702 10:22321188-22321210 TGGGGGAGGCGGGCGGGCGGGGG - Intronic
1067293349 10:44959992-44960014 TGCGCCAGGCTGGCGGGGGAGGG - Intronic
1067769898 10:49115540-49115562 GGCCCGGGGCGGGCTGGCGGCGG - Intergenic
1069486549 10:68827501-68827523 TCCGCGGCGCTGGCTGCCGGGGG - Intergenic
1070624036 10:78036387-78036409 TGCGTGAACCTGGCAGGCGGAGG - Intronic
1071563517 10:86660147-86660169 GGTGCGAGGATGGCTGGCCGGGG - Intronic
1072636198 10:97180065-97180087 TGGGCGGGGCGGGCTGTCGGTGG - Intronic
1073504021 10:103967646-103967668 CGCGCGAGCCCGGCTGGCGGCGG - Exonic
1076710599 10:132331882-132331904 TGCGCGGGGGTGGCAGGGGGTGG - Intergenic
1077014648 11:394181-394203 TGGGTGAGGCTGGCTGGGCGGGG + Intronic
1077186246 11:1236662-1236684 TGCGTGAGCCTGGCTGGTGAGGG + Intronic
1077551702 11:3203357-3203379 GGCGCGAGGCTCCCAGGCGGTGG + Intergenic
1078272070 11:9805160-9805182 TGCGTGAGCCTGGGAGGCGGAGG + Intronic
1078660021 11:13278482-13278504 CCCGCGAGGCTGGGTGGGGGCGG + Intronic
1079279838 11:19077128-19077150 AGGGCAAGGCTGGCTGGGGGTGG + Intergenic
1083583259 11:63838859-63838881 TGGGCGTGGCTGGATGGCCGTGG + Intergenic
1083609736 11:63999182-63999204 TGCGCAAGGGCGCCTGGCGGTGG - Intronic
1083643650 11:64159410-64159432 TGCTGGAGTCTGGGTGGCGGAGG + Intronic
1087609838 11:100420995-100421017 TGGGACAGGATGGCTGGCGGTGG - Intergenic
1089356204 11:117855583-117855605 TGCTGGAGGCTGGCTGGGGTGGG + Intronic
1089374219 11:117983165-117983187 TGTGCCAGGTTGGCTGGGGGTGG - Intergenic
1089638160 11:119829849-119829871 TGCTGGAGTCTGGCTGGCAGTGG - Intergenic
1089759554 11:120712986-120713008 TGCGTGAGCCTGGCTGGAGTGGG + Intronic
1090699323 11:129279662-129279684 CGCGCGAGGAGGGCGGGCGGCGG + Intergenic
1091207970 11:133833726-133833748 CGGGAGAGGCTGCCTGGCGGGGG - Intergenic
1091317968 11:134628948-134628970 TGCGTGAGGCTGGCTCACCGAGG + Intergenic
1095684470 12:45016865-45016887 TGCTTGAGCCTGGGTGGCGGAGG - Intronic
1101466914 12:104958337-104958359 TGCGCGGGGCTGCCGCGCGGGGG - Intronic
1103059401 12:117846876-117846898 TGGGGAAGGCTGGCTGGCTGTGG - Intronic
1103561129 12:121793741-121793763 GCCGGGAGGCTGCCTGGCGGAGG - Exonic
1104424569 12:128664758-128664780 TGTGCATGGCTGGCTGGCGGTGG - Intronic
1104550406 12:129751509-129751531 AGCTGGAGGCTGGCTGGTGGGGG - Intronic
1106735781 13:32586758-32586780 AGCGGGTGGCTGCCTGGCGGTGG + Intronic
1107851418 13:44576574-44576596 AGCTCGGGGCTCGCTGGCGGCGG - Intronic
1110442102 13:75537615-75537637 CGTGGGAGGCAGGCTGGCGGAGG + Intronic
1112290887 13:98143339-98143361 CGCGCGAGCAGGGCTGGCGGTGG - Intronic
1113453848 13:110433230-110433252 TGCTCCAGGCTGCCAGGCGGTGG - Intronic
1115331059 14:32198713-32198735 TGCTGGAGGCTGGGAGGCGGAGG + Intergenic
1115398516 14:32934637-32934659 TGCGCGCAGCGGGCTGGGGGTGG - Intergenic
1121473480 14:94174329-94174351 AGCGTGAGGCTGCCAGGCGGCGG - Exonic
1122228111 14:100291440-100291462 TGGGGGATCCTGGCTGGCGGTGG + Exonic
1122959450 14:105087756-105087778 GGCGCGGGGCGAGCTGGCGGGGG + Intergenic
1124454623 15:29829389-29829411 TGTGCGAGGGTGCCTGGAGGAGG + Intronic
1125609289 15:40959912-40959934 TGGGCAAGGCTGGCTGGCTCTGG + Intergenic
1129359017 15:75012827-75012849 TGGGCCAGGGTGGCTGGAGGAGG + Intronic
1129421307 15:75429175-75429197 TTTGGGAGGCTGGCTGGGGGAGG + Intronic
1129712335 15:77826690-77826712 GGCCCCAGGCTGGCTGGAGGTGG + Intergenic
1129887413 15:79048243-79048265 TGCGTGAGGCTAGCTGGGGGTGG + Intronic
1130002646 15:80060167-80060189 TGCGAGCGGTTGGCTGGCGGGGG + Intronic
1131290150 15:91100185-91100207 TGCGCCTGGGCGGCTGGCGGGGG + Intronic
1132639491 16:971131-971153 TGGGCGGGGCCGGCTGGAGGGGG - Intronic
1132952348 16:2570298-2570320 TGGGCGGGGCTGGCTGGAGAGGG + Intronic
1132962003 16:2629872-2629894 TGGGCGGGGCTGGCTGGAGAGGG - Intergenic
1134112122 16:11522176-11522198 TGAGCAAGGATGGCTGGAGGTGG - Intronic
1134134036 16:11668300-11668322 TGCTCGGGGCCGGCAGGCGGTGG - Intergenic
1134696983 16:16232527-16232549 TGCGCGGCGGCGGCTGGCGGCGG + Exonic
1139465250 16:67150779-67150801 AGCGCGAGGGAGGCGGGCGGGGG - Intronic
1139515445 16:67449946-67449968 TGCCCCAGGCTGGCTGGAGCAGG - Intronic
1139853796 16:69965482-69965504 TGCCCGAGGCCGGGGGGCGGTGG + Intergenic
1139882774 16:70188395-70188417 TGCCCGAGGCCGGGGGGCGGTGG + Intergenic
1139924943 16:70480917-70480939 TGAGCGAGGCTGTCTGGCTTGGG - Exonic
1139949663 16:70662959-70662981 CCCGTGAGGCTGGCTGGAGGGGG - Exonic
1140369736 16:74407124-74407146 TGCCCGAGGCCGGGGGGCGGTGG - Intergenic
1141496620 16:84414783-84414805 TGCAGGAGGCTGGCTGGCCGTGG + Intronic
1142174143 16:88637231-88637253 TCGGTGAGGCTGGCTGGGGGTGG - Intergenic
1142673585 17:1499407-1499429 TGCTTGAAGCTGGCAGGCGGAGG + Intronic
1143002089 17:3800832-3800854 GGGGGGAGGCTGGCTGGAGGAGG + Intronic
1143060813 17:4199223-4199245 TGCACCAGCCTGGGTGGCGGGGG - Intronic
1143590693 17:7884751-7884773 TGGGGGAGGCGGGCGGGCGGTGG + Intronic
1144739391 17:17572859-17572881 TGCGGAGGGCTGGCTGGTGGTGG - Intronic
1144754710 17:17672070-17672092 TGTGGGAGGCTGGGTGGCGGGGG + Intergenic
1145006659 17:19342389-19342411 TGGGCGAGGCTGGGAGGTGGGGG + Intronic
1145793803 17:27644185-27644207 TGCTCGAGGCAGGCTGGCAGAGG - Intronic
1146339655 17:32007830-32007852 GGCGCGGGGCGGGCCGGCGGCGG - Intergenic
1146500946 17:33363908-33363930 TCCGGGAGGCTGGCTGCAGGTGG - Intronic
1147123791 17:38352188-38352210 CGCGCGAGGAAGGGTGGCGGCGG - Intergenic
1147313647 17:39608505-39608527 TGCGTGAGGGTGGGTGGGGGAGG - Intronic
1147653964 17:42078012-42078034 TGGGGGAGCCTGGCTGGCGCTGG - Intergenic
1148000332 17:44384044-44384066 TGGGCGTGGCTGGGTGGAGGGGG - Intronic
1148284086 17:46372762-46372784 TGCGCGAGGGCGGGCGGCGGGGG + Intergenic
1148306307 17:46590683-46590705 TGCGCGAGGGCGGGCGGCGGGGG + Exonic
1148923634 17:51062672-51062694 TGCTCGAACCTGGCAGGCGGAGG - Intronic
1149478954 17:56986177-56986199 TGCGAGAGGGAGGCTGGAGGAGG - Intronic
1151945353 17:77316590-77316612 TGACCCAGCCTGGCTGGCGGTGG - Intronic
1152013067 17:77731916-77731938 TGCTTGAGGCTGGGAGGCGGAGG + Intergenic
1152349773 17:79778117-79778139 TGCGCGGGGCGGGCCGGCGCCGG + Exonic
1152419959 17:80187307-80187329 TGAGCAAGATTGGCTGGCGGGGG - Intronic
1152711416 17:81871984-81872006 CGCGCGTGGCTGCCTGGCGCAGG + Intergenic
1153833570 18:8944414-8944436 TGCTTGAGGCTGGGAGGCGGAGG - Intergenic
1154244442 18:12683266-12683288 TGCTTGAGGCTGGGAGGCGGAGG + Intronic
1155221464 18:23689671-23689693 CCCGCGCGGCTGGATGGCGGCGG + Exonic
1156961459 18:43036550-43036572 TTTGCGGGGCAGGCTGGCGGGGG - Intronic
1157860238 18:51134519-51134541 TGCTTGAGGCTGGCAGGCAGAGG + Intergenic
1160540653 18:79618376-79618398 TGAGCGAGGCCGGCTGGAGTTGG - Intergenic
1161221845 19:3121547-3121569 GGCCCCATGCTGGCTGGCGGGGG - Exonic
1161562859 19:4983448-4983470 AGAGCTAGGCTGTCTGGCGGTGG + Intronic
1161720065 19:5897624-5897646 GTGGCGAGGCTGGGTGGCGGGGG - Intronic
1161752924 19:6110542-6110564 TGCGCGAGGCTGGCTGGCGGCGG - Intronic
1161779221 19:6279954-6279976 TGCGCGACCCGGGCTGGCGGTGG - Intergenic
1162059565 19:8086362-8086384 TGGGAGAGGCTGGCTGCCTGTGG - Intronic
1162381235 19:10333181-10333203 TGCGCGGGGGTCGTTGGCGGGGG - Intronic
1162798425 19:13098300-13098322 TGGCCCAGGCTGGCTTGCGGGGG - Intronic
1165893957 19:39130472-39130494 TGAGCGAGGCTGGAAGGAGGTGG + Intronic
1166203320 19:41252769-41252791 GGCTGGAGGCTGGCTGGTGGGGG + Intronic
1167249119 19:48391387-48391409 GGAGGGAGGCAGGCTGGCGGGGG + Exonic
1167565721 19:50255340-50255362 TGGGTGAGGCTTGCTGGAGGAGG + Intronic
1168712504 19:58509978-58510000 TGCGTGAGGATGGCTGGCTTCGG + Exonic
926142048 2:10373662-10373684 TGCTCGAGGCTGGACGGTGGAGG - Intronic
927963423 2:27254945-27254967 TGTGGCAGGCTGGCTGGCTGGGG - Exonic
929320935 2:40542634-40542656 TGCCCGAGACTGGGAGGCGGAGG - Intronic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
933149087 2:78892769-78892791 TGCTCGAGCCTGGGAGGCGGAGG - Intergenic
934502315 2:94870629-94870651 AGGGCCAGGCTGCCTGGCGGAGG - Intergenic
935696686 2:105776665-105776687 CGAGGGAGGCTGGCTGGAGGAGG - Intronic
937745106 2:125403165-125403187 TGCGCTAGGTTGGGTGGGGGAGG + Intergenic
937982597 2:127624176-127624198 TGCGCCAGGGTGACTGGCGCTGG - Exonic
938320302 2:130358079-130358101 TGCGGAAGGCTGGGTGGCGAGGG + Intronic
939443978 2:142285632-142285654 TGCGCGAGGCTGGAGTGCTGGGG - Intergenic
939463279 2:142525663-142525685 TGCTTGAGGCTGGGAGGCGGAGG + Intergenic
943320438 2:186436935-186436957 TGGGTGAGGCTGGCTAGTGGGGG + Intergenic
944766707 2:202871688-202871710 GGCGCGGGGCTCGCGGGCGGTGG - Intronic
945699393 2:213151668-213151690 TGCGCGAGCCCGGCCGGCGGGGG - Intronic
946310545 2:218880580-218880602 CGTGCGAGGCTGGCTGGCGGGGG - Exonic
946327664 2:218993130-218993152 AGCGTGAGGCTGGCGGGCGCCGG + Exonic
946690555 2:222305775-222305797 TGTGCGGGGCTGGGGGGCGGGGG + Intergenic
947760537 2:232600509-232600531 GGCGCCAGGCTGCCTGGCGGAGG - Intergenic
947968602 2:234302803-234302825 GGCACCAGGCTGGCTGGTGGAGG + Intergenic
948033142 2:234836120-234836142 TGTTAGAGGCTGGCTGGGGGTGG - Intergenic
1168777832 20:462512-462534 TGCGCGCCGCTGGCCGACGGAGG - Exonic
1172248417 20:33461932-33461954 TGCTTGAAGCTGGCAGGCGGAGG + Intergenic
1172644873 20:36462742-36462764 GGGGCCAGGCTGTCTGGCGGAGG + Intronic
1172702713 20:36862992-36863014 TCCGTGAGGCTGGGGGGCGGCGG + Exonic
1173237206 20:41257693-41257715 TGCTTGAAGCTGGCAGGCGGAGG - Intronic
1174434927 20:50499358-50499380 TGCTCGAGCCTGGGAGGCGGAGG + Intergenic
1175306101 20:57976634-57976656 TGCGTGTGGCTGGCTGGAGATGG - Intergenic
1175366513 20:58459961-58459983 TGCACCAGGCTGGCTGCTGGGGG - Exonic
1175479363 20:59300593-59300615 TGCGCGGAGCTGGCCGGCTGTGG - Exonic
1175638576 20:60606705-60606727 TGCAGGGGGCTGGCTGGGGGAGG - Intergenic
1178910597 21:36670178-36670200 TGGGGGAGGTTGGGTGGCGGGGG - Intergenic
1179893965 21:44351144-44351166 TGGGCTGGGCTGGCTGGGGGCGG + Intronic
1180231830 21:46430979-46431001 TGCACAAGGCAGGCTGGTGGTGG + Intronic
1180670495 22:17548961-17548983 TGGGGGAGGCTGACTGGCTGGGG - Exonic
1180879590 22:19194396-19194418 CGCTCGAGGCTGGGAGGCGGAGG + Intronic
1180956757 22:19744725-19744747 TGCACAAGGGTGGCTGGCAGAGG + Intergenic
1181477186 22:23175994-23176016 TGCGTGAGGCTGGGTGGAGAAGG - Intergenic
1181745470 22:24952743-24952765 GGCGCGGCGCGGGCTGGCGGTGG + Intronic
1183729328 22:39608734-39608756 TGCTTGAGGCTGGGAGGCGGAGG + Intronic
1184172583 22:42768719-42768741 TGCCTGAGGGTGGCTGGAGGGGG - Intergenic
1184225796 22:43128262-43128284 GGCGGGCGGCTGGCTGGCGGAGG + Intronic
1184280005 22:43432001-43432023 TGCTCTTGGCTGGCTGGTGGTGG + Intronic
1184342112 22:43891769-43891791 GGCGCGGGGCTCGCTGGCGCAGG + Exonic
1184595007 22:45508549-45508571 TGCGTGAGGCTGGCTGGGCGCGG - Intronic
1185330440 22:50249834-50249856 TGTGCCAGGCTGGCTGCAGGGGG - Intronic
950672127 3:14533599-14533621 TGCCCGATGTTGGCTGGCGAAGG + Intronic
950924544 3:16727482-16727504 TGGGCTGGGCTGGCTGGGGGAGG + Intergenic
952887730 3:38021884-38021906 TGGGACAGGCTGGCTGGGGGAGG - Intronic
953024008 3:39134504-39134526 AGCGGTAGGCTGGCTGGCAGTGG + Intronic
956655137 3:71542691-71542713 TGAGCGAGGCAGGCAGGCGCAGG + Intronic
956738675 3:72258484-72258506 GGAGCGATGCTGGCTGGCGATGG - Intergenic
960714347 3:120560439-120560461 TGCTTGAGCCTGGATGGCGGAGG + Intergenic
961109626 3:124272964-124272986 GGTGGGAGGCTGGTTGGCGGAGG + Intronic
967171795 3:186827569-186827591 TGCGCGAGCGCGGCGGGCGGAGG + Intergenic
968571998 4:1346897-1346919 AGGGCGAGGCAGGCTGCCGGGGG - Intergenic
968619998 4:1599755-1599777 TGCGTGTGGCTGGCAGGTGGCGG - Intergenic
968895993 4:3403752-3403774 TGTGAGGGGCTGGCTTGCGGAGG - Intronic
968950920 4:3690997-3691019 GTCGCGAGGCTGGGTGGCGGTGG - Intergenic
969305352 4:6323262-6323284 TGCATGAGGCTGGGTGGCAGGGG + Exonic
969518066 4:7659695-7659717 TGCATGGGGCTGGCTGGAGGTGG - Intronic
973832261 4:54773570-54773592 TGCCCAAGGCTGGCTGGCGGGGG - Intergenic
974115246 4:57571140-57571162 GGCGGCAGCCTGGCTGGCGGGGG - Intergenic
977575052 4:98666118-98666140 TGGGTGGGGCTGGCTAGCGGGGG - Intergenic
979047927 4:115893609-115893631 TGCTTGAGCCTGGCAGGCGGAGG + Intergenic
981067264 4:140498237-140498259 TGCGGGAGGCCGGCGGGTGGAGG + Intronic
983624811 4:169791736-169791758 GGCGGGCGGCTGTCTGGCGGCGG + Intergenic
984668008 4:182448851-182448873 GGCGCGGGGCTGGCGGGAGGCGG + Intronic
985549308 5:524983-525005 TGGGGGATGCTGGCTGGCGATGG - Intergenic
991168568 5:63593391-63593413 TGGGCGTGGCTGGCTGGGCGTGG - Intergenic
992063820 5:73085307-73085329 TGCGCCAGGCTGGAGGGCAGTGG - Intronic
992700092 5:79333210-79333232 TGCGTGAACCTGGCAGGCGGAGG + Intergenic
992990498 5:82278382-82278404 TGGGCGGGGCTTGCTCGCGGTGG - Exonic
996185279 5:120465620-120465642 CGAGCCAGGCTGGCTGCCGGCGG + Intronic
997267174 5:132501626-132501648 TGAGCGAGGCTGGCTCTCGTGGG + Intergenic
997889252 5:137660401-137660423 TGTGGGAAGCTGGCTGGAGGTGG - Intronic
998130334 5:139648554-139648576 TGAGCGCGGCTCGCGGGCGGAGG - Exonic
1001095556 5:168772998-168773020 AGCGCGAGGCAGGGTGGTGGTGG - Intronic
1001295935 5:170498989-170499011 TGGGCCAGGCTGAGTGGCGGTGG + Intronic
1002051938 5:176576207-176576229 TGGGCGGGGGTGGCTGGGGGAGG + Intronic
1002289058 5:178187364-178187386 TGCTCGGGGAAGGCTGGCGGCGG - Intergenic
1002664272 5:180810929-180810951 TGCCCGAGGCTGCCGGGAGGAGG + Intronic
1003094292 6:3130482-3130504 TGGGCCAGGCTGGCAGGTGGGGG - Intronic
1004442067 6:15663049-15663071 TGCGCGAGCCTGGCGCGCGCGGG - Intronic
1005618781 6:27600874-27600896 TGCTTGAGCCTGGCAGGCGGAGG + Intergenic
1007901990 6:45421761-45421783 TTCTCGCGGCCGGCTGGCGGCGG + Intronic
1013390244 6:109679252-109679274 TGCTGGAGCCTGGCTGGGGGAGG + Intronic
1019297257 7:284715-284737 TGAGCCAGGCTGGGTGGTGGTGG - Intergenic
1019420282 7:947687-947709 TGACCGAGGCCGGGTGGCGGTGG - Intronic
1020099815 7:5388600-5388622 AGCGCGAGGCTGGCAGGCCAGGG - Exonic
1020238508 7:6374636-6374658 GGCGCGCGGCTTGCGGGCGGCGG - Exonic
1022016459 7:26353533-26353555 TGCGTGAGTCTGGGAGGCGGAGG - Intronic
1022105447 7:27193180-27193202 TGCGGCAGGACGGCTGGCGGAGG - Intergenic
1022283757 7:28935602-28935624 TGTGTAAGGCTGGCTGGGGGTGG + Intergenic
1023780182 7:43647875-43647897 TGTGCTGGGCTGGCTGGGGGTGG - Intronic
1024241403 7:47439171-47439193 AGCGCAAGGGTGGCTGGCTGGGG + Intronic
1027111378 7:75442539-75442561 TGCGCTGGCCTGGCTGGCCGTGG - Intronic
1027132251 7:75599338-75599360 TGGGGGAGGTTGGCTGGAGGAGG - Intronic
1027283619 7:76627098-76627120 TGCGCTGGCCTGGCTGGCCGTGG - Exonic
1029459769 7:100687949-100687971 TGGGCGAGGGGGGTTGGCGGTGG - Intronic
1033278599 7:139990468-139990490 TGCTCGAGGCTGGCTGGCTCTGG - Intronic
1033352031 7:140569613-140569635 TGCGGGAGGAGGGCTGGTGGTGG + Intronic
1034203126 7:149294714-149294736 CGCCCGACGGTGGCTGGCGGGGG - Intronic
1034659866 7:152759799-152759821 CGCGCGGGGCTAGCGGGCGGCGG + Exonic
1038157074 8:25000801-25000823 ATCGCGTGGCTGGCTGGGGGCGG - Intergenic
1038957279 8:32481258-32481280 TGCTTGAGCCTGGCAGGCGGAGG + Intronic
1041381754 8:57259526-57259548 GGCGCGTGGCTGCCTGGCCGCGG - Intergenic
1041769016 8:61453042-61453064 CGAGGGAGTCTGGCTGGCGGAGG - Intronic
1043637480 8:82404512-82404534 TGCGATCGGCTGGCTGGAGGAGG + Intergenic
1048385158 8:133905233-133905255 TGTGGGAGGCTGGGTGGAGGTGG + Intergenic
1049363289 8:142224512-142224534 TGAGTGAGGCTGGCTGGGTGCGG + Intronic
1049419094 8:142509084-142509106 TGTGAGCCGCTGGCTGGCGGGGG - Intronic
1050325054 9:4490503-4490525 TGCGCGATCCCGGGTGGCGGCGG + Exonic
1051474863 9:17494963-17494985 TGCTCGAGTCTGGCAGGCGGAGG - Intronic
1051809236 9:21031438-21031460 TGCGCCTTGCTGGCGGGCGGGGG + Intronic
1052996053 9:34552132-34552154 TGAGTGAGGCTGGGTGGCAGAGG - Intronic
1053218064 9:36289241-36289263 TGCTCGAGCCTGGGAGGCGGAGG - Intronic
1059513358 9:114870006-114870028 TGCTCGAGCTTGGCTGGGGGAGG + Intergenic
1060479766 9:124011408-124011430 TGGGCGAGGCTGGAGGGCGGGGG - Intronic
1061084919 9:128393114-128393136 TGCGCGGGGCTGGGCGGGGGCGG - Intergenic
1061589389 9:131588821-131588843 TGCCAGGGGCTGGCTGGAGGTGG + Exonic
1061873894 9:133534597-133534619 TGCGCCAGGCCGGCCGGCGCGGG + Intronic
1062510038 9:136900081-136900103 TGCTTGAGGCTGGGAGGCGGAGG + Intronic
1185878012 X:3715056-3715078 TGGGCGAGGCTGGCAGCCAGGGG - Intergenic
1190057553 X:47190675-47190697 TGCGCGCGGCATGCTGGGGGTGG - Intergenic
1191645670 X:63478420-63478442 GGCGGCAGCCTGGCTGGCGGAGG + Intergenic
1198519891 X:137441913-137441935 GGCGCGAGGCTTGCGGGCGGCGG + Intergenic
1198750305 X:139932205-139932227 TGCGGGCGGCTGGGGGGCGGGGG - Intronic
1199267277 X:145843379-145843401 TGTGTGAGGCTGCCTGGGGGAGG + Intergenic
1200092910 X:153644202-153644224 CGCGCGAGGCCTGCAGGCGGCGG + Intronic
1200111046 X:153741053-153741075 TGCGAGAGGCTGGCTCACAGAGG + Intronic
1200310334 X:155071307-155071329 GGCGCGCGGCTGGCGCGCGGGGG - Exonic
1201307922 Y:12567129-12567151 TGCGCCAGGCTGTCTGCCTGTGG - Intergenic