ID: 1161753877

View in Genome Browser
Species Human (GRCh38)
Location 19:6117277-6117299
Sequence CTTTATGAGCTAATGCTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 105}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161753877_1161753879 13 Left 1161753877 19:6117277-6117299 CCTAGCAGCATTAGCTCATAAAG 0: 1
1: 0
2: 0
3: 11
4: 105
Right 1161753879 19:6117313-6117335 ACAACTCCAGTGTCCATCCATGG 0: 1
1: 1
2: 13
3: 115
4: 570
1161753877_1161753880 16 Left 1161753877 19:6117277-6117299 CCTAGCAGCATTAGCTCATAAAG 0: 1
1: 0
2: 0
3: 11
4: 105
Right 1161753880 19:6117316-6117338 ACTCCAGTGTCCATCCATGGAGG 0: 1
1: 0
2: 1
3: 27
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161753877 Original CRISPR CTTTATGAGCTAATGCTGCT AGG (reversed) Intronic
901013175 1:6212292-6212314 CTTGATGAGCGAGTGGTGCTTGG - Exonic
903163467 1:21505417-21505439 ATATATGAGCTATTGTTGCTGGG - Intergenic
904665101 1:32114616-32114638 TGTTATGGGCTAATGCAGCTGGG - Intronic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
910010680 1:82457839-82457861 CTTTGTGAGGGAATGCTTCTTGG + Intergenic
915588875 1:156859679-156859701 CTTCTTGAGCTCAGGCTGCTCGG + Intronic
1064019766 10:11799580-11799602 CTTAATGTGCTTATGCTGCCTGG + Intergenic
1064247174 10:13678235-13678257 CTGTATCCGCTAATGCTGGTTGG + Intronic
1067284241 10:44895830-44895852 CTTTGTGTGCTTCTGCTGCTGGG + Intergenic
1067841677 10:49685810-49685832 CTTTTTGAGTTTATCCTGCTTGG + Intronic
1070375370 10:75825498-75825520 TTTTATGAGGTAAGGCTGCCTGG + Intronic
1074218930 10:111417062-111417084 CTTGACCAGCTAATGTTGCTAGG - Intergenic
1075165405 10:120063676-120063698 CTCTTTGATCTAATGCTGCTGGG + Intergenic
1076030652 10:127155064-127155086 GTTTATAAGCTAATGCAGATGGG - Intronic
1080324523 11:31054744-31054766 CTTTTTCAGCAAATGGTGCTGGG + Intronic
1080686927 11:34523737-34523759 CTTTATGATGTAATGCTGAATGG + Intergenic
1093116660 12:15220638-15220660 CTTTATAAGGTAATCATGCTTGG + Intronic
1096539057 12:52293774-52293796 CTTTACGAGCTAATTTTTCTAGG - Intronic
1103708245 12:122891977-122891999 CTTTCTGAGGAAATGCTGATTGG - Intronic
1107267548 13:38575098-38575120 CTATATGAGCCAATGCTCCCAGG + Intergenic
1107313527 13:39106076-39106098 CTTTATGATGTATAGCTGCTAGG - Intergenic
1108490474 13:50976428-50976450 CTTTAAGAACTACTGATGCTGGG + Intergenic
1109167895 13:59058293-59058315 CTTGCTGAGCTAGTCCTGCTGGG - Intergenic
1110237415 13:73231267-73231289 CTTTATGAGATAATGATGCATGG - Intergenic
1112974236 13:105297653-105297675 CTTTATGAGCAGATGCCCCTGGG + Intergenic
1116349643 14:43844254-43844276 TTCTATGAGCAAAAGCTGCTGGG - Intergenic
1121049808 14:90812937-90812959 CGTAAGGAGCTAATGCTGCTGGG + Intronic
1122677354 14:103426766-103426788 CTTTCTGAACAAAGGCTGCTAGG + Intronic
1126390125 15:48139712-48139734 CTTAACTAGCTACTGCTGCTTGG + Exonic
1127595900 15:60481678-60481700 GTTTAAGAGCTCATGCTGCTGGG + Intergenic
1129046157 15:72736087-72736109 ATTGATGAACTCATGCTGCTAGG - Intronic
1129193916 15:73953177-73953199 GTTGATGAGCTACTGCTGCAGGG + Intergenic
1130725254 15:86432570-86432592 CTTGCTGAGGTAATGTTGCTGGG + Intronic
1133384811 16:5360885-5360907 CTTGATGTGCTTGTGCTGCTGGG - Intergenic
1141221095 16:82069938-82069960 CTTTATAAACTAATGATGCCTGG - Intronic
1142115743 16:88355277-88355299 CTGTTTGAGGTCATGCTGCTGGG - Intergenic
1143721635 17:8815604-8815626 GTTTATTAGCAAATGCTCCTAGG - Intronic
1144548943 17:16222682-16222704 CTTGATGAACTAATGTTCCTTGG - Intronic
1146963854 17:37008476-37008498 CTCTAAGAGCTAATGCTTCTAGG - Intronic
1147923257 17:43931629-43931651 CTTTAAGAGCTACTGCAGCCGGG + Intergenic
1148900089 17:50868802-50868824 ATTTATGAGTTATTGCTGCTTGG + Intergenic
1149287636 17:55183186-55183208 CATTAAAGGCTAATGCTGCTTGG - Intergenic
1151376371 17:73691577-73691599 CTGTATGAGGGAAAGCTGCTGGG - Intergenic
1151824214 17:76514612-76514634 TTTTAAGAGCTACTGTTGCTGGG + Intergenic
1152990528 18:359767-359789 CTTTATGTGCTGTTGCTCCTGGG - Intronic
1161753877 19:6117277-6117299 CTTTATGAGCTAATGCTGCTAGG - Intronic
1168262060 19:55201015-55201037 CTTTATGACCTAATCTTGCAAGG - Intronic
928632696 2:33210125-33210147 CATAATGTGCTAATGCTGCAAGG + Intronic
931322947 2:61189568-61189590 CTTTAAGAACTAATGAGGCTGGG - Exonic
931527555 2:63173452-63173474 TTTTATTAGACAATGCTGCTAGG + Intronic
932089015 2:68788318-68788340 CTGCATGAGCCAGTGCTGCTGGG - Intronic
937342958 2:121103651-121103673 CTTGATGGGCTAATGCTGATTGG + Intergenic
939138551 2:138325250-138325272 CATTATGAGATCATGATGCTTGG - Intergenic
939599360 2:144169203-144169225 CTTTAAGAACTACTGATGCTTGG - Intronic
940154982 2:150646041-150646063 CTTTGTGAGCCCATGATGCTAGG - Intergenic
940489754 2:154343830-154343852 CTTTATGAGCTATTCAAGCTTGG + Intronic
941299307 2:163781489-163781511 CTTTAGGAACAAATCCTGCTCGG - Intergenic
945092471 2:206188227-206188249 TTTAAAGACCTAATGCTGCTGGG - Intronic
945135781 2:206626205-206626227 TTTTATGAGCTGATTCTGCTGGG + Intergenic
945815832 2:214604070-214604092 CTTTAAAAGCTACTGATGCTGGG - Intergenic
1170080006 20:12464269-12464291 CTTTCTGAGATAAGGGTGCTGGG + Intergenic
1170169905 20:13399055-13399077 CTTTATCAGATGCTGCTGCTGGG - Intronic
1172809332 20:37636305-37636327 CTTTTTGAGCCAATGCAACTGGG + Intergenic
1178013302 21:28312706-28312728 CTTTTTGAGTTAATCCTACTTGG - Intergenic
949526135 3:4906172-4906194 TTGTATGAGTTAATGCTTCTTGG - Intergenic
951659285 3:25044781-25044803 CTGTAGGTCCTAATGCTGCTAGG - Intergenic
953058151 3:39404830-39404852 CTTTAAAAGCTACTGATGCTTGG + Intergenic
954095515 3:48323678-48323700 CTTTTTAAACAAATGCTGCTAGG - Intronic
954862012 3:53698279-53698301 GTACATGTGCTAATGCTGCTGGG - Intronic
958918462 3:100075866-100075888 CTTCTTGAGCTAATCCTTCTGGG + Intronic
970625471 4:17873653-17873675 CTTTAAGATCTCATTCTGCTAGG - Intronic
972187530 4:36549399-36549421 CTCTATCAGCAAATGCAGCTTGG + Intergenic
972658458 4:41089766-41089788 CTTTAAGAGATAATACTGCAGGG + Intronic
975009578 4:69332522-69332544 CTTTTTGAGGTAATCCTACTTGG + Intronic
977021260 4:91763525-91763547 CTTTATAAACTAATTCTTCTCGG - Intergenic
977465918 4:97382827-97382849 CTTGATGACCTTATGCTGATTGG + Intronic
977834034 4:101627941-101627963 CTTTTTGAACAAATGGTGCTGGG - Intronic
982974968 4:162044541-162044563 TGTTAGGGGCTAATGCTGCTGGG - Intronic
983689076 4:170446155-170446177 CTCTATCAGCTCATTCTGCTAGG - Intergenic
983760869 4:171404887-171404909 CCTGTTGTGCTAATGCTGCTAGG + Intergenic
985703066 5:1385367-1385389 CTTGATGGGCTAATGCTGGCTGG + Intergenic
986940962 5:12948570-12948592 TTTTATGAGCCTATGCTCCTGGG - Intergenic
993978907 5:94517531-94517553 CTTAATGAGCTAAGGCAGTTTGG - Intronic
994284924 5:97953243-97953265 TGTTATGAGCTAAGGCTTCTAGG + Intergenic
994301680 5:98155314-98155336 CTTTGTCAGCTGATGCTGTTGGG - Intergenic
1002873316 6:1187596-1187618 CTTAATGAGTTACTGCTCCTTGG + Intergenic
1003295962 6:4828601-4828623 CTTTTTGAGCTTATTCGGCTTGG + Intronic
1010664626 6:78614145-78614167 GTTTATGAGCTAAAGCTATTGGG + Intergenic
1012159935 6:95871994-95872016 CTTTTTGGTATAATGCTGCTGGG - Intergenic
1014591721 6:123280747-123280769 TTTTATGTGCTAATACTACTTGG + Intronic
1017789828 6:157787561-157787583 TTTTCTGAGCTGCTGCTGCTTGG - Intronic
1021335797 7:19400425-19400447 CTTTATGTACTAATACTTCTTGG + Intergenic
1022613026 7:31896055-31896077 CTTCATGAGCTCACCCTGCTGGG - Intronic
1023730465 7:43186816-43186838 CTATATGACCTATTGCTTCTAGG - Intronic
1024363159 7:48490737-48490759 GTTTAAGATCAAATGCTGCTTGG + Intronic
1024801314 7:53083609-53083631 TTTTATGAGTTGATGTTGCTAGG + Intergenic
1027227700 7:76254812-76254834 CTTGATGAGCTGAGGGTGCTGGG + Intronic
1033592210 7:142819113-142819135 TTTTTTGAGCTTATCCTGCTTGG - Intergenic
1033621203 7:143063316-143063338 ATATATGTGCTGATGCTGCTGGG - Intergenic
1035357356 7:158284412-158284434 CTCTATGAGTAAGTGCTGCTGGG + Intronic
1038349768 8:26765296-26765318 GTGAATGAGCTAATGCTGATGGG + Intronic
1041712381 8:60906255-60906277 CTTCATGAACTCCTGCTGCTTGG + Intergenic
1043020267 8:74991430-74991452 CTTTATAAGCTAATCATGGTGGG - Intronic
1043342047 8:79251715-79251737 CTGTATGACCTAGTGCTTCTGGG - Intergenic
1047266126 8:123310826-123310848 CTTTATGAGGTAATGTTGCCTGG + Intergenic
1056532936 9:87502941-87502963 CTCAATGAGCTAATGCAGTTTGG + Intronic
1057157971 9:92860745-92860767 CTCTTTGAGCTAATGCAGTTGGG - Intronic
1061496537 9:130978013-130978035 CTTTCTGAGGTCATGCTGCTTGG - Intergenic
1062307493 9:135917397-135917419 CTTTTTCAGCAAATGATGCTGGG + Intergenic
1187218520 X:17300314-17300336 CCTTATGATCTTATGATGCTGGG + Intergenic
1189146965 X:38665359-38665381 CTTTAGCAGCTAAAGCTGCCAGG + Intronic
1191206608 X:57841462-57841484 CTTTTTGAGTTAAATCTGCTTGG + Intergenic
1191926163 X:66312294-66312316 CTTTAGGAGCTAAGGCTGTTTGG + Intergenic
1193450573 X:81659755-81659777 TTTTAAGAGCTTATGTTGCTAGG + Intergenic
1197133541 X:123034150-123034172 GATTAGGAGATAATGCTGCTGGG - Intergenic
1197592509 X:128425837-128425859 ATTTAGGAGATAGTGCTGCTAGG - Intergenic
1198585647 X:138117650-138117672 CTTTAAAAGCTAAAGTTGCTGGG - Intergenic