ID: 1161754153

View in Genome Browser
Species Human (GRCh38)
Location 19:6119386-6119408
Sequence AAGAAGGAATGGAGGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22017
Summary {0: 2, 1: 24, 2: 572, 3: 5079, 4: 16340}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161754153 Original CRISPR AAGAAGGAATGGAGGGAAGG AGG (reversed) Intronic
Too many off-targets to display for this crispr