ID: 1161755030

View in Genome Browser
Species Human (GRCh38)
Location 19:6126587-6126609
Sequence TCCTCTGGAAGGAGTCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161755030_1161755037 4 Left 1161755030 19:6126587-6126609 CCAGCAGGACTCCTTCCAGAGGA No data
Right 1161755037 19:6126614-6126636 CTGGGACAGAGGAGAGTTAGAGG No data
1161755030_1161755039 9 Left 1161755030 19:6126587-6126609 CCAGCAGGACTCCTTCCAGAGGA No data
Right 1161755039 19:6126619-6126641 ACAGAGGAGAGTTAGAGGCAGGG No data
1161755030_1161755040 23 Left 1161755030 19:6126587-6126609 CCAGCAGGACTCCTTCCAGAGGA No data
Right 1161755040 19:6126633-6126655 GAGGCAGGGCTTAAGTGTCTAGG No data
1161755030_1161755038 8 Left 1161755030 19:6126587-6126609 CCAGCAGGACTCCTTCCAGAGGA No data
Right 1161755038 19:6126618-6126640 GACAGAGGAGAGTTAGAGGCAGG No data
1161755030_1161755035 -7 Left 1161755030 19:6126587-6126609 CCAGCAGGACTCCTTCCAGAGGA No data
Right 1161755035 19:6126603-6126625 CAGAGGAACTCCTGGGACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161755030 Original CRISPR TCCTCTGGAAGGAGTCCTGC TGG (reversed) Intronic