ID: 1161755534

View in Genome Browser
Species Human (GRCh38)
Location 19:6130875-6130897
Sequence GGCACCAGTGGAGGACGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 177}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161755526_1161755534 -7 Left 1161755526 19:6130859-6130881 CCCCCTTGCCCAGAGAGGCACCA 0: 1
1: 0
2: 2
3: 29
4: 260
Right 1161755534 19:6130875-6130897 GGCACCAGTGGAGGACGCACAGG 0: 1
1: 0
2: 1
3: 16
4: 177
1161755528_1161755534 -9 Left 1161755528 19:6130861-6130883 CCCTTGCCCAGAGAGGCACCAGT 0: 1
1: 0
2: 3
3: 26
4: 239
Right 1161755534 19:6130875-6130897 GGCACCAGTGGAGGACGCACAGG 0: 1
1: 0
2: 1
3: 16
4: 177
1161755529_1161755534 -10 Left 1161755529 19:6130862-6130884 CCTTGCCCAGAGAGGCACCAGTG 0: 1
1: 0
2: 5
3: 45
4: 535
Right 1161755534 19:6130875-6130897 GGCACCAGTGGAGGACGCACAGG 0: 1
1: 0
2: 1
3: 16
4: 177
1161755521_1161755534 19 Left 1161755521 19:6130833-6130855 CCAGCCAAGTAGTGAGGATCCAA 0: 1
1: 0
2: 0
3: 7
4: 123
Right 1161755534 19:6130875-6130897 GGCACCAGTGGAGGACGCACAGG 0: 1
1: 0
2: 1
3: 16
4: 177
1161755523_1161755534 0 Left 1161755523 19:6130852-6130874 CCAACCGCCCCCTTGCCCAGAGA 0: 1
1: 0
2: 4
3: 17
4: 215
Right 1161755534 19:6130875-6130897 GGCACCAGTGGAGGACGCACAGG 0: 1
1: 0
2: 1
3: 16
4: 177
1161755522_1161755534 15 Left 1161755522 19:6130837-6130859 CCAAGTAGTGAGGATCCAACCGC 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1161755534 19:6130875-6130897 GGCACCAGTGGAGGACGCACAGG 0: 1
1: 0
2: 1
3: 16
4: 177
1161755519_1161755534 26 Left 1161755519 19:6130826-6130848 CCTAGAACCAGCCAAGTAGTGAG 0: 1
1: 0
2: 4
3: 9
4: 137
Right 1161755534 19:6130875-6130897 GGCACCAGTGGAGGACGCACAGG 0: 1
1: 0
2: 1
3: 16
4: 177
1161755525_1161755534 -4 Left 1161755525 19:6130856-6130878 CCGCCCCCTTGCCCAGAGAGGCA 0: 1
1: 0
2: 3
3: 36
4: 346
Right 1161755534 19:6130875-6130897 GGCACCAGTGGAGGACGCACAGG 0: 1
1: 0
2: 1
3: 16
4: 177
1161755527_1161755534 -8 Left 1161755527 19:6130860-6130882 CCCCTTGCCCAGAGAGGCACCAG 0: 1
1: 0
2: 1
3: 30
4: 327
Right 1161755534 19:6130875-6130897 GGCACCAGTGGAGGACGCACAGG 0: 1
1: 0
2: 1
3: 16
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161755534 Original CRISPR GGCACCAGTGGAGGACGCAC AGG Intronic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900580521 1:3406355-3406377 GGCACCTGTGGAGGAGGCTCAGG + Intronic
901018358 1:6244068-6244090 GGGACCGAGGGAGGACGCACTGG - Intergenic
901246111 1:7732549-7732571 GGCAGCAGTGGAGGCGGCAGCGG + Exonic
903181295 1:21606208-21606230 GGTGGCAGTGGAGGAGGCACAGG + Intronic
906070821 1:43015215-43015237 GGGGCTAGTGGAGGACGCATAGG - Intergenic
907178844 1:52552840-52552862 GGCACCTGGGGAGGGCGAACCGG + Intronic
911259553 1:95669682-95669704 GGCACTCGTGGAGGAGGCTCGGG + Intergenic
913100621 1:115560724-115560746 GGCACCAGTGGTGGCAGCAATGG - Intergenic
913202021 1:116502676-116502698 GGCAAGAGGGGAGGAAGCACGGG + Intergenic
913316872 1:117561185-117561207 GGCACCAGTGAAGAAAGCTCAGG + Intergenic
916195175 1:162215697-162215719 GGCATGAGTGGAGGACCCAAGGG - Intronic
917629767 1:176880120-176880142 GGCAGCAGTGGAAGAAGCCCAGG - Intronic
918021991 1:180703158-180703180 GGCACCAGTGGTGGTGGCAGTGG + Intronic
919049710 1:192499016-192499038 GGCCCCAGTGCAGGATCCACTGG - Intergenic
919982563 1:202651336-202651358 GTCACCAAGAGAGGACGCACAGG + Intronic
922207009 1:223456670-223456692 GGCTCCAGTGGAGAAGGTACCGG - Intergenic
922748277 1:228059387-228059409 AGCACCAGTGGAACACGCAGCGG - Exonic
922937015 1:229430951-229430973 GCCACCAGCGGAGGCCGCCCCGG + Intergenic
923007914 1:230067061-230067083 GGCACCAGAGCAGGAAGCAGCGG - Intronic
923720819 1:236465205-236465227 GGCTACAGTGTAGGACGCATGGG - Intronic
924359217 1:243218370-243218392 GGCCCCAGTGGAGGAGGCAGGGG + Intronic
924557359 1:245129546-245129568 GGCTCCAGTGGAGAAGGGACCGG + Intergenic
1066598271 10:37076384-37076406 GGCCCCAGTGCAGGATCCACTGG + Intergenic
1067188763 10:44052617-44052639 TGCACCAAGGGAGGAAGCACAGG + Intergenic
1070167774 10:73911352-73911374 GGCACCCGCGGGGGACGCCCGGG - Exonic
1070798506 10:79231018-79231040 GGCACCCCAGGAGGAGGCACAGG - Intronic
1071085279 10:81862624-81862646 GGCCCCAGTGCAGGATCCACTGG - Intergenic
1073120838 10:101121858-101121880 GGCAGCAGTGGAGGATGTGCCGG + Intronic
1073532522 10:104245319-104245341 AGCAGCTGTGGAGGACGCACAGG + Intronic
1074783935 10:116822202-116822224 ATTACCAGTGGAGGAAGCACAGG + Intergenic
1075056583 10:119223179-119223201 TGCACAAGAGGAAGACGCACAGG - Intronic
1075705051 10:124495471-124495493 GCAGGCAGTGGAGGACGCACAGG + Intronic
1080204500 11:29713075-29713097 GGCCCCAGTGCAGGATCCACTGG + Intergenic
1080657420 11:34268810-34268832 GGCACACGTGGAGGATGCATGGG - Intronic
1081577729 11:44329770-44329792 GGCACCTGTGGGGGACCCCCAGG + Intergenic
1083706799 11:64522232-64522254 TGCACCAGTGAAGGAAGCCCCGG - Intergenic
1084063875 11:66692476-66692498 GGGAAGAGTGGAGGACCCACAGG - Intronic
1084945314 11:72635014-72635036 GGCAGCAGTGGAGGAAGGAGAGG - Intronic
1091302608 11:134516952-134516974 GGGACCAGAGGAGGAAGCCCAGG + Intergenic
1091388478 12:110495-110517 GGCCCCAGTGCAGGACCCAAGGG - Intronic
1092133998 12:6132902-6132924 GGCCCCAGTGCGGGACCCACTGG + Intergenic
1101612559 12:106304210-106304232 GGCCCCAGAGGGGGAAGCACAGG + Intronic
1101660320 12:106759576-106759598 GGCAGCAGTGGTGGACCCTCAGG - Intronic
1101898625 12:108774508-108774530 GCCACCAGCGGAGGATGCACTGG + Intergenic
1103363680 12:120368385-120368407 GGCGGCAGTGGAGAACGCGCGGG - Intronic
1103447782 12:121005491-121005513 GGAGCCAGTGGAGGGCGCGCTGG + Intronic
1103909586 12:124344907-124344929 GGAGCCAGTGGTGGACGCGCCGG + Exonic
1109155600 13:58905959-58905981 GGCCCCAGTGGTGGACTCAGTGG + Intergenic
1109854220 13:68107658-68107680 GGCCCCAGTGCAGGATCCACTGG - Intergenic
1110751324 13:79119576-79119598 GGCCCCGGTGGAGGATCCACTGG - Intergenic
1113117121 13:106885405-106885427 GGGGACAGTGGAGCACGCACTGG - Intergenic
1114499538 14:23158017-23158039 GGCATCAATAGAGGACACACAGG + Intronic
1115768535 14:36647508-36647530 GGCCCCAGTCGAGGGCGCGCAGG - Intergenic
1115980016 14:39040794-39040816 AGCCCCAGTGGATGATGCACAGG - Exonic
1116799609 14:49429230-49429252 GGCACCAGTGCTGGTCGCTCTGG - Intergenic
1118333403 14:64831736-64831758 TGCCCCAGTGGTGGACGCACAGG - Intronic
1119215846 14:72868519-72868541 GGCTCCAGCGGAGGAGGCCCAGG + Intronic
1122047814 14:99036009-99036031 GGCCGCCGAGGAGGACGCACTGG - Intergenic
1122955247 14:105067339-105067361 GGGACCAGTGGAGGCTGCCCCGG + Intergenic
1123399792 15:19973084-19973106 GGCACCTGTGGAGAAGACACAGG + Intergenic
1123478533 15:20610588-20610610 GGCCCCAGAGGAGGGTGCACTGG - Intergenic
1123639480 15:22389797-22389819 GGCCCCAGAGGAGGGTGCACTGG + Intergenic
1124036431 15:26057294-26057316 GGCCCCAGTGCAGGATCCACTGG + Intergenic
1124226676 15:27901232-27901254 GGCACAAGTGGAGGACTGTCTGG + Intronic
1124624255 15:31299109-31299131 GGCACCACTGGAGGAGGGCCCGG + Intergenic
1126997362 15:54460279-54460301 TGCTCCAGTGGAGGTGGCACAGG + Intronic
1128061026 15:64736212-64736234 GACACCAGTGGAGCATGCACTGG + Intergenic
1128140978 15:65301005-65301027 GGCCCCAGTGGAGGATCCACTGG - Intergenic
1129109638 15:73329963-73329985 GGCACAAGAGGAGGACTCGCTGG - Intronic
1130044767 15:80435218-80435240 GGCACCTATGGAGGAGGCAATGG - Intronic
1132861594 16:2074441-2074463 GGCACCAGAGAAGCCCGCACAGG - Intronic
1135615605 16:23908419-23908441 CGCACCTGGGGAGGACGCTCAGG - Intronic
1139370960 16:66469177-66469199 GGAAGCAGTGGGGGATGCACAGG - Intronic
1139848031 16:69934249-69934271 GGCAGCATTGGAGGAGGCCCTGG + Intronic
1140432778 16:74919105-74919127 GGGACCAGCGGGGGAGGCACAGG - Intronic
1141636297 16:85315649-85315671 GGCAAGAGAGGAGTACGCACCGG + Intergenic
1142201691 16:88764087-88764109 GGCACCAGAGCAGGACCCAGTGG + Intronic
1142251749 16:88995099-88995121 GGCAGCCGTGGAGGATGCAGGGG - Intergenic
1143861942 17:9897468-9897490 AGCACCAGGGGAGGACACAGTGG - Exonic
1143898059 17:10152590-10152612 GGCAGCAGTGGACGAGGCACTGG - Intronic
1144208980 17:12999104-12999126 CGCACCAGTGTGGGACCCACAGG + Intronic
1146153512 17:30498747-30498769 GGCACCTGAAGAGGACACACTGG + Intronic
1148044150 17:44732181-44732203 AGCATCAGTGGAGGAGGCAGTGG + Exonic
1148322910 17:46768376-46768398 AGCACCAGTGGAAGATGCAGTGG + Exonic
1148665648 17:49372589-49372611 TGCTCCAGTGGAGGACGGCCTGG + Intronic
1148773432 17:50079760-50079782 GGGACCAAAGGAGGAGGCACTGG + Intronic
1150486959 17:65550599-65550621 GGGACCAGTGGAGGATGCCAGGG - Intronic
1151543919 17:74780388-74780410 GGCTGCACTGGAGGAGGCACAGG - Intronic
1151886030 17:76923874-76923896 TCCACCAGAGGAGGACGCCCGGG - Intronic
1152371654 17:79892101-79892123 GGGACCCGTGGAGGGCCCACAGG + Intergenic
1152469139 17:80481343-80481365 CGCACCAGGGGAGAAGGCACAGG + Intergenic
1152554640 17:81046778-81046800 GGCTCCAGGGAAGGGCGCACGGG - Intronic
1152616811 17:81341663-81341685 GGCTCCAGTGGAGGACGCGGTGG + Intergenic
1152716183 17:81901952-81901974 GGCAGCAGGGGAGGGCCCACGGG - Intronic
1152937638 17:83149804-83149826 GGCCCTGGTGGAGGATGCACTGG - Intergenic
1160628730 18:80230747-80230769 GGTAGCAGTGGAGGACACAGAGG + Intronic
1160967862 19:1754418-1754440 GGGACGCGCGGAGGACGCACTGG + Exonic
1161382179 19:3971176-3971198 GGCACGAGCGGCGGGCGCACCGG - Intergenic
1161755534 19:6130875-6130897 GGCACCAGTGGAGGACGCACAGG + Intronic
1162164141 19:8740815-8740837 GGCTTCAGTGCAGGAGGCACAGG - Intergenic
1162165212 19:8748284-8748306 GGCTTCAGTGCAGGAGGCACAGG - Intergenic
1162166277 19:8755738-8755760 GGCTTCAGTGCAGGAGGCACAGG - Intergenic
1162167343 19:8763194-8763216 GGCTTCAGTGCAGGAGGCACAGG - Intergenic
1162168284 19:8769494-8769516 GGCTTCAGTGCAGGAGGCACAGG - Intergenic
1162169351 19:8776947-8776969 GGCTTCAGTGCAGGAGGCACAGG - Intergenic
1162170031 19:8782259-8782281 GGCTTCAGTGCAGGAGGCACAGG - Intergenic
1162171116 19:8789912-8789934 GGCTTCAGTGCAGGAGGCACAGG - Intergenic
1162395504 19:10416406-10416428 GGCACAGATGGGGGACGCACAGG - Intronic
1165793346 19:38505254-38505276 GGCAGCAGTTGGGGACACACGGG - Intronic
925681414 2:6425623-6425645 GGAGCCAGAGGAGGAAGCACAGG - Intergenic
928106427 2:28473053-28473075 GGCCCCAGTGCAGGATCCACTGG + Intronic
928617870 2:33057365-33057387 GGCCCCAGTGGGAGACCCACTGG - Intronic
933641521 2:84766750-84766772 GGCACCAGAGGAGGAGGCTAAGG + Intronic
936021560 2:108998895-108998917 GGCTCTGGTGGAGGAGGCACGGG - Intergenic
936282534 2:111154906-111154928 GGCACCAGTAGTGCAGGCACAGG + Intronic
937308781 2:120888530-120888552 GGCACCAGTGAGAGACACACAGG + Intronic
937333168 2:121044649-121044671 GGCCCCGGTGAAGGAGGCACTGG + Intergenic
938614859 2:132987161-132987183 AGAGCCAGTGGAGGACACACAGG - Intronic
939865647 2:147469580-147469602 GGCAGCAGGGGAGGAGGCAGTGG - Intergenic
943296074 2:186141181-186141203 GGCTCCAGTGGATGCTGCACAGG - Intergenic
944817650 2:203394728-203394750 GGTACCACTGGAGGACGCACTGG - Exonic
946309277 2:218873767-218873789 AGCACCAGTGGAAGCGGCACAGG - Exonic
948900929 2:240956600-240956622 GGCTCCAGGGGAGGACCCAGGGG - Intronic
1170064657 20:12298664-12298686 GGCCCCAGTGGTGGAAGCAGTGG + Intergenic
1171066892 20:22026351-22026373 TGCTCCAGTGGAGGAGGCAGGGG + Intergenic
1173264751 20:41469040-41469062 GGCAGCAGAGGAAGAGGCACAGG + Intronic
1175823897 20:61926222-61926244 GGAACCAGAGGAGCAAGCACGGG + Intronic
1175931637 20:62496444-62496466 GGCTCAGGTGGAGGACGCACAGG - Intergenic
1176021089 20:62962798-62962820 GCCACCAGGGGAGGAGGCACTGG - Intronic
1176289192 21:5035264-5035286 GCCACCTTTGGAAGACGCACGGG + Intronic
1179868043 21:44228340-44228362 GCCACCTTTGGAAGACGCACGGG - Intronic
1181800892 22:25347144-25347166 AGCACCTGTGGAGGGTGCACTGG - Intergenic
1182869330 22:33632498-33632520 GGCACCAGTGGGGGTCTCAGAGG + Intronic
1183205093 22:36413412-36413434 GGCCCCAGAGGAGGAAGAACAGG - Intergenic
1183863457 22:40685464-40685486 GGCAGCAGTGGATGAAGCACTGG - Intergenic
952355453 3:32579136-32579158 GGCCCCAGTGGGGGATCCACTGG + Intergenic
952543544 3:34395061-34395083 GGCCCCAGTGGTGGAAGCATGGG + Intergenic
953673995 3:44986055-44986077 GGCCCCAGTGCAGGATCCACTGG - Intronic
953793576 3:45966555-45966577 GGAGCGAGTGGAGGAGGCACTGG - Exonic
959996908 3:112690244-112690266 GGCCCCAGTGCAGGTTGCACAGG + Intergenic
962385207 3:134927260-134927282 GAAACCAGTGGAGAATGCACAGG - Intronic
974109521 4:57510778-57510800 GGGACCTGTGGAGGATGGACTGG + Intergenic
974281785 4:59804686-59804708 GGCACATGTGCAGGATGCACAGG + Intergenic
974401464 4:61413255-61413277 GGTATCAGTGGAGGTCACACAGG - Intronic
975406877 4:73999839-73999861 GGCAGCAGTGCAGGGCTCACTGG - Intergenic
978917905 4:114148518-114148540 GGCCCCAGTGCAGGATCCACTGG - Intergenic
981072779 4:140561942-140561964 GGGACCAGTGGAAAAGGCACTGG + Intronic
985527864 5:416133-416155 GGCCCTGGTGGAGGACGCAGGGG + Intronic
985904416 5:2822618-2822640 GGCACAAGTGAAGGATGCACTGG + Intergenic
990270851 5:54137272-54137294 GTCACCAGAGGAGGACACAAGGG - Intronic
990272751 5:54162156-54162178 GGCAGCAGAGGAGGTCCCACAGG - Intronic
992048913 5:72925798-72925820 GGCACCCGTCGAGGAGGCTCAGG - Intergenic
992473205 5:77077585-77077607 GGCACCTGAGGAGCGCGCACCGG - Exonic
993025199 5:82637311-82637333 GCCAGCAGTGGAAGACACACAGG - Intergenic
994932369 5:106206027-106206049 GGCCCCAGTGCAGGATCCACTGG - Intergenic
997158193 5:131580246-131580268 GGCAGCTGTGGAGGAGGCGCTGG - Intronic
997379737 5:133427075-133427097 GTCACCACTGGAGAACACACAGG + Intronic
1002599601 5:180346657-180346679 GGCCCCAGGGGCGCACGCACTGG - Intronic
1003162683 6:3649892-3649914 GGCACCAGTGGAGGATGTCCAGG - Intergenic
1004501965 6:16217251-16217273 AGCCCCAGTGCAGGACCCACTGG + Intergenic
1005947023 6:30602457-30602479 GGCGCCAGAGGAGGTCGCTCTGG - Exonic
1005976266 6:30802242-30802264 GGCAGGAGTGGAGGAGGCGCAGG + Intergenic
1006003791 6:30987089-30987111 GGCCCCACTGGAGGTCGTACTGG - Exonic
1013176576 6:107682889-107682911 GGCAACAGTGGAGGCAGCAGTGG - Intergenic
1013350508 6:109301612-109301634 GTAACCAGTGGAGGACACAGTGG - Intergenic
1013964159 6:115935369-115935391 GGCCCCAGTGGCGTAGGCACCGG - Exonic
1019612923 7:1945989-1946011 GGCCCCAGTGCAGAACCCACTGG - Intronic
1020495799 7:8852115-8852137 GGCTCCAGAGCAGGAGGCACAGG - Intergenic
1022628343 7:32061438-32061460 GGCACCTCTGGAGCAGGCACAGG + Intronic
1023182712 7:37501620-37501642 GGCTCAAGTGGAGGACTCAGGGG - Intergenic
1023267061 7:38417824-38417846 GGAGCCAGTGGAGGAGGCAGTGG - Exonic
1024739144 7:52336502-52336524 GACACAAGGGGAGGACGCAAAGG + Intergenic
1026736313 7:72950915-72950937 GAGCCCAGTGGAGGAGGCACGGG + Exonic
1026786668 7:73305969-73305991 GAGCCCAGTGGAGGAGGCACGGG + Intronic
1027107420 7:75414147-75414169 GAGCCCAGTGGAGGAGGCACGGG - Intergenic
1028929655 7:96398344-96398366 TGCACCCATGGAGGAAGCACTGG - Intergenic
1029910940 7:104146909-104146931 GGAACCAGTAAAGGACACACAGG + Intronic
1033983758 7:147197449-147197471 GTTACCAGTGGAGGATGTACAGG - Intronic
1034296931 7:149981918-149981940 GGCAGCAGTGGAGGAAGGAGAGG - Intergenic
1038271870 8:26081919-26081941 GGCACCTGTGGAGGAAGGAGAGG - Intergenic
1040024057 8:42765338-42765360 GGCACTGGTGGAGCACGCACAGG - Intronic
1040351346 8:46571948-46571970 GGCCCCAGTGCAGGATCCACTGG + Intergenic
1043620992 8:82192309-82192331 GGCACCAGTCGGGGAGGCTCGGG + Intergenic
1043952202 8:86321829-86321851 GGCATGAGTAGAGGAAGCACAGG + Intergenic
1051852126 9:21521634-21521656 GGCACATGTGAAGGATGCACAGG + Intergenic
1055775391 9:79762226-79762248 GGCTCCAGTGGAGGTCCCAGGGG + Intergenic
1060371834 9:123080966-123080988 GGCAGAAGTGGAGGAGGCAGAGG - Intronic
1060404429 9:123366209-123366231 GGAACCTGGGGAGGGCGCACCGG - Exonic
1061632775 9:131883590-131883612 GGCACCAGTGGAGACCGCTAGGG + Intronic
1062618271 9:137407747-137407769 GGCTCCAGTGACGGAAGCACTGG - Intronic
1185479666 X:436343-436365 GGCACCAGGGGAGGATGAACTGG + Intergenic
1186295581 X:8144909-8144931 GGCCCCAGTGCAGGATCCACCGG - Intergenic
1195463526 X:105154674-105154696 GGATCCAGTGGAGGAGACACAGG - Intronic
1202100547 Y:21303627-21303649 GGCACCCGTCGAGGAGGCTCAGG + Intergenic